Incidental Mutation 'R1820:2700049A03Rik'
ID204803
Institutional Source Beutler Lab
Gene Symbol 2700049A03Rik
Ensembl Gene ENSMUSG00000034601
Gene NameRIKEN cDNA 2700049A03 gene
Synonymstalpid3
MMRRC Submission 039848-MU
Accession Numbers

Genbank: NM_001163378, NM_029818

Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R1820 (G1)
Quality Score225
Status Not validated
Chromosome12
Chromosomal Location71136848-71243303 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 71150244 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 197 (V197A)
Ref Sequence ENSEMBL: ENSMUSP00000044701 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000045907] [ENSMUST00000149564]
Predicted Effect possibly damaging
Transcript: ENSMUST00000045907
AA Change: V197A

PolyPhen 2 Score 0.511 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000044701
Gene: ENSMUSG00000034601
AA Change: V197A

DomainStartEndE-ValueType
Pfam:TALPID3 116 1351 N/A PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000134748
Predicted Effect probably benign
Transcript: ENSMUST00000149564
AA Change: V197A

PolyPhen 2 Score 0.083 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000118956
Gene: ENSMUSG00000034601
AA Change: V197A

DomainStartEndE-ValueType
Pfam:TALPID3 116 1349 N/A PFAM
Coding Region Coverage
  • 1x: 97.4%
  • 3x: 96.8%
  • 10x: 95.0%
  • 20x: 91.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a conserved centrosomal protein that functions in ciliogenesis and responds to hedgehog signaling. Mutations in this gene causes Joubert syndrome 23. Alternative splicing results in multiple transcript variants and protein isoforms. [provided by RefSeq, Aug 2016]
PHENOTYPE: Mice homozygous for a null allele die during organogenesis, lack cilia, and show randomized L-R patterning, face and neural tube defects, pericardial edema and hemorrhages. Mouse embryonic fibroblasts homozygous for a different null allele lack cilia and asymmetrical centriolar localization. [provided by MGI curators]
Allele List at MGI

All alleles(12) : Targeted, other(2) Gene trapped(10)

Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2410089E03Rik A G 15: 8,269,645 K3106E unknown Het
9230109A22Rik T C 15: 25,139,090 noncoding transcript Het
Acbd3 A G 1: 180,745,138 N321S probably benign Het
Actr3b T C 5: 25,849,158 probably null Het
Aldh5a1 T C 13: 24,927,572 D124G probably benign Het
Arhgap35 G A 7: 16,561,949 R1064W possibly damaging Het
Arhgef9 T A X: 95,081,536 I225F probably damaging Het
Arl16 T C 11: 120,466,761 T43A probably damaging Het
Camsap3 T C 8: 3,603,485 W409R probably damaging Het
Cfap43 T A 19: 47,897,216 H320L probably damaging Het
Chac2 T A 11: 30,977,496 N141I probably damaging Het
Chtf18 C A 17: 25,725,939 G211C probably damaging Het
Cwf19l1 T A 19: 44,127,387 Y201F probably benign Het
Dcun1d1 A T 3: 35,919,004 L114* probably null Het
Fam160a1 T A 3: 85,665,829 T938S probably damaging Het
Fdps A T 3: 89,095,043 H249Q probably benign Het
Gabrg1 T A 5: 70,774,413 Y329F probably damaging Het
Kctd8 T A 5: 69,340,341 I321F probably damaging Het
Kdm5b G T 1: 134,597,670 R299L possibly damaging Het
Kif23 T C 9: 61,926,438 T494A possibly damaging Het
Kmt2e A G 5: 23,473,547 H208R probably damaging Het
Lipo5 A T 19: 33,464,595 probably null Het
Lrrc28 G T 7: 67,641,111 T54K probably damaging Het
Luc7l2 G A 6: 38,598,819 probably null Het
Man2a2 A G 7: 80,358,933 F899L probably benign Het
Myo9b T C 8: 71,333,358 I633T probably damaging Het
Nynrin A T 14: 55,870,378 I981F possibly damaging Het
Olfr262 A T 19: 12,241,248 S138T probably damaging Het
Olfr945 A G 9: 39,258,399 I91T possibly damaging Het
Pank1 A G 19: 34,877,684 probably null Het
Phc2 C T 4: 128,743,543 A47V probably damaging Het
Plekhs1 A G 19: 56,478,522 R262G possibly damaging Het
Pnp2 C A 14: 50,964,457 P300Q possibly damaging Het
Polq T A 16: 37,029,418 S345T possibly damaging Het
Prag1 A G 8: 36,103,804 T514A probably benign Het
Psmd5 T C 2: 34,870,746 probably null Het
Rfx6 T G 10: 51,723,125 probably null Het
Rhbdd2 G A 5: 135,636,049 C78Y probably damaging Het
Rnf157 G T 11: 116,354,651 P313T probably damaging Het
Ryr2 A G 13: 11,587,316 L4560P probably damaging Het
Scai A T 2: 39,106,978 M268K possibly damaging Het
Scd3 A T 19: 44,241,806 T343S probably benign Het
Scimp A T 11: 70,791,597 S98T probably benign Het
Sfrp2 A G 3: 83,773,154 N207S probably benign Het
Shf G A 2: 122,368,682 P51S probably damaging Het
Sis T C 3: 72,921,142 Y1200C probably damaging Het
Sp1 T A 15: 102,409,076 S343R possibly damaging Het
Spata31d1a A T 13: 59,701,255 C1020S possibly damaging Het
Spink5 A G 18: 43,989,419 N317S possibly damaging Het
Sptbn2 A G 19: 4,726,596 D224G probably damaging Het
St8sia3 T C 18: 64,269,632 I114T probably damaging Het
Zscan5b C A 7: 6,239,163 H460Q probably damaging Het
Other mutations in 2700049A03Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00339:2700049A03Rik APN 12 71167119 missense probably benign 0.00
IGL01107:2700049A03Rik APN 12 71194468 critical splice donor site probably null
IGL01404:2700049A03Rik APN 12 71164378 splice site probably null
IGL01835:2700049A03Rik APN 12 71167181 nonsense probably null
IGL01835:2700049A03Rik APN 12 71167183 missense probably benign 0.00
IGL02122:2700049A03Rik APN 12 71170525 missense possibly damaging 0.93
IGL02140:2700049A03Rik APN 12 71148260 missense probably benign 0.06
IGL02385:2700049A03Rik APN 12 71154856 missense probably damaging 0.98
IGL03181:2700049A03Rik APN 12 71193373 missense possibly damaging 0.51
IGL03253:2700049A03Rik APN 12 71140883 missense probably benign 0.33
IGL03278:2700049A03Rik APN 12 71158825 splice site probably benign
G4846:2700049A03Rik UTSW 12 71137909 missense probably benign
PIT1430001:2700049A03Rik UTSW 12 71160386 missense possibly damaging 0.71
PIT4519001:2700049A03Rik UTSW 12 71170666 missense probably benign 0.05
R0108:2700049A03Rik UTSW 12 71177918 missense probably benign 0.14
R0165:2700049A03Rik UTSW 12 71167150 missense possibly damaging 0.52
R0211:2700049A03Rik UTSW 12 71216096 missense possibly damaging 0.96
R0211:2700049A03Rik UTSW 12 71216096 missense possibly damaging 0.96
R0220:2700049A03Rik UTSW 12 71148420 critical splice donor site probably null
R0352:2700049A03Rik UTSW 12 71138030 missense possibly damaging 0.96
R0468:2700049A03Rik UTSW 12 71193310 missense possibly damaging 0.71
R0508:2700049A03Rik UTSW 12 71164388 missense probably damaging 0.98
R0673:2700049A03Rik UTSW 12 71177868 missense probably damaging 0.97
R0840:2700049A03Rik UTSW 12 71158883 missense probably benign 0.16
R0893:2700049A03Rik UTSW 12 71219308 splice site probably benign
R1244:2700049A03Rik UTSW 12 71216144 missense probably benign 0.25
R1432:2700049A03Rik UTSW 12 71170587 unclassified probably null
R1599:2700049A03Rik UTSW 12 71150259 missense probably damaging 0.98
R1732:2700049A03Rik UTSW 12 71219221 missense probably benign 0.18
R1939:2700049A03Rik UTSW 12 71160412 splice site probably null
R1998:2700049A03Rik UTSW 12 71188619 missense possibly damaging 0.86
R2337:2700049A03Rik UTSW 12 71164546 nonsense probably null
R2337:2700049A03Rik UTSW 12 71164547 missense possibly damaging 0.93
R2340:2700049A03Rik UTSW 12 71164546 nonsense probably null
R2340:2700049A03Rik UTSW 12 71164547 missense possibly damaging 0.93
R2382:2700049A03Rik UTSW 12 71164546 nonsense probably null
R2382:2700049A03Rik UTSW 12 71164547 missense possibly damaging 0.93
R2384:2700049A03Rik UTSW 12 71164546 nonsense probably null
R2384:2700049A03Rik UTSW 12 71164547 missense possibly damaging 0.93
R2445:2700049A03Rik UTSW 12 71164546 nonsense probably null
R2445:2700049A03Rik UTSW 12 71164547 missense possibly damaging 0.93
R2449:2700049A03Rik UTSW 12 71164546 nonsense probably null
R2449:2700049A03Rik UTSW 12 71164547 missense possibly damaging 0.93
R2512:2700049A03Rik UTSW 12 71173171 missense possibly damaging 0.71
R2872:2700049A03Rik UTSW 12 71154756 splice site probably benign
R3236:2700049A03Rik UTSW 12 71164546 nonsense probably null
R3236:2700049A03Rik UTSW 12 71164547 missense possibly damaging 0.93
R3237:2700049A03Rik UTSW 12 71164546 nonsense probably null
R3237:2700049A03Rik UTSW 12 71164547 missense possibly damaging 0.93
R3734:2700049A03Rik UTSW 12 71164546 nonsense probably null
R3734:2700049A03Rik UTSW 12 71164547 missense possibly damaging 0.93
R3808:2700049A03Rik UTSW 12 71164546 nonsense probably null
R3808:2700049A03Rik UTSW 12 71164547 missense possibly damaging 0.93
R3809:2700049A03Rik UTSW 12 71164546 nonsense probably null
R3809:2700049A03Rik UTSW 12 71164547 missense possibly damaging 0.93
R3944:2700049A03Rik UTSW 12 71164546 nonsense probably null
R3944:2700049A03Rik UTSW 12 71164547 missense possibly damaging 0.93
R3959:2700049A03Rik UTSW 12 71164546 nonsense probably null
R3959:2700049A03Rik UTSW 12 71164547 missense possibly damaging 0.93
R3960:2700049A03Rik UTSW 12 71164546 nonsense probably null
R3960:2700049A03Rik UTSW 12 71164547 missense possibly damaging 0.93
R4593:2700049A03Rik UTSW 12 71164546 nonsense probably null
R4593:2700049A03Rik UTSW 12 71164547 missense possibly damaging 0.93
R4595:2700049A03Rik UTSW 12 71164546 nonsense probably null
R4595:2700049A03Rik UTSW 12 71164547 missense possibly damaging 0.93
R4596:2700049A03Rik UTSW 12 71164546 nonsense probably null
R4596:2700049A03Rik UTSW 12 71164547 missense possibly damaging 0.93
R4600:2700049A03Rik UTSW 12 71148263 missense possibly damaging 0.67
R4649:2700049A03Rik UTSW 12 71164546 nonsense probably null
R4649:2700049A03Rik UTSW 12 71164547 missense possibly damaging 0.93
R4651:2700049A03Rik UTSW 12 71164546 nonsense probably null
R4651:2700049A03Rik UTSW 12 71164547 missense possibly damaging 0.93
R4652:2700049A03Rik UTSW 12 71164546 nonsense probably null
R4652:2700049A03Rik UTSW 12 71164547 missense possibly damaging 0.93
R4714:2700049A03Rik UTSW 12 71164546 nonsense probably null
R4714:2700049A03Rik UTSW 12 71164547 missense possibly damaging 0.93
R4735:2700049A03Rik UTSW 12 71216123 missense possibly damaging 0.88
R4810:2700049A03Rik UTSW 12 71189442 missense possibly damaging 0.51
R4852:2700049A03Rik UTSW 12 71164546 nonsense probably null
R4852:2700049A03Rik UTSW 12 71164547 missense possibly damaging 0.93
R4854:2700049A03Rik UTSW 12 71164546 nonsense probably null
R4854:2700049A03Rik UTSW 12 71164547 missense possibly damaging 0.93
R4855:2700049A03Rik UTSW 12 71164546 nonsense probably null
R4855:2700049A03Rik UTSW 12 71164547 missense possibly damaging 0.93
R4884:2700049A03Rik UTSW 12 71164546 nonsense probably null
R4884:2700049A03Rik UTSW 12 71164547 missense possibly damaging 0.93
R4893:2700049A03Rik UTSW 12 71164546 nonsense probably null
R4893:2700049A03Rik UTSW 12 71164547 missense possibly damaging 0.93
R4905:2700049A03Rik UTSW 12 71164546 nonsense probably null
R4905:2700049A03Rik UTSW 12 71164547 missense possibly damaging 0.93
R4915:2700049A03Rik UTSW 12 71189646 missense possibly damaging 0.92
R4919:2700049A03Rik UTSW 12 71164546 nonsense probably null
R4919:2700049A03Rik UTSW 12 71164547 missense possibly damaging 0.93
R4959:2700049A03Rik UTSW 12 71164546 nonsense probably null
R4959:2700049A03Rik UTSW 12 71164547 missense possibly damaging 0.93
R4989:2700049A03Rik UTSW 12 71164546 nonsense probably null
R4989:2700049A03Rik UTSW 12 71164547 missense possibly damaging 0.93
R5011:2700049A03Rik UTSW 12 71164546 nonsense probably null
R5011:2700049A03Rik UTSW 12 71164547 missense possibly damaging 0.93
R5012:2700049A03Rik UTSW 12 71164546 nonsense probably null
R5012:2700049A03Rik UTSW 12 71164547 missense possibly damaging 0.93
R5118:2700049A03Rik UTSW 12 71164546 nonsense probably null
R5118:2700049A03Rik UTSW 12 71164547 missense possibly damaging 0.93
R5146:2700049A03Rik UTSW 12 71243025 missense possibly damaging 0.85
R5163:2700049A03Rik UTSW 12 71164546 nonsense probably null
R5163:2700049A03Rik UTSW 12 71164547 missense possibly damaging 0.93
R5188:2700049A03Rik UTSW 12 71164546 nonsense probably null
R5188:2700049A03Rik UTSW 12 71164547 missense possibly damaging 0.93
R5189:2700049A03Rik UTSW 12 71164546 nonsense probably null
R5189:2700049A03Rik UTSW 12 71164547 missense possibly damaging 0.93
R5189:2700049A03Rik UTSW 12 71193349 missense possibly damaging 0.93
R5190:2700049A03Rik UTSW 12 71164546 nonsense probably null
R5190:2700049A03Rik UTSW 12 71164547 missense possibly damaging 0.93
R5290:2700049A03Rik UTSW 12 71188791 missense probably benign 0.00
R5344:2700049A03Rik UTSW 12 71243027 missense probably benign
R5502:2700049A03Rik UTSW 12 71164546 nonsense probably null
R5502:2700049A03Rik UTSW 12 71164547 missense possibly damaging 0.93
R5503:2700049A03Rik UTSW 12 71164546 nonsense probably null
R5503:2700049A03Rik UTSW 12 71164547 missense possibly damaging 0.93
R5619:2700049A03Rik UTSW 12 71164546 nonsense probably null
R5619:2700049A03Rik UTSW 12 71164547 missense possibly damaging 0.93
R5667:2700049A03Rik UTSW 12 71164546 nonsense probably null
R5667:2700049A03Rik UTSW 12 71164547 missense possibly damaging 0.93
R5669:2700049A03Rik UTSW 12 71164546 nonsense probably null
R5669:2700049A03Rik UTSW 12 71164547 missense possibly damaging 0.93
R5671:2700049A03Rik UTSW 12 71164546 nonsense probably null
R5671:2700049A03Rik UTSW 12 71164547 missense possibly damaging 0.93
R5725:2700049A03Rik UTSW 12 71193319 missense probably benign 0.05
R5956:2700049A03Rik UTSW 12 71157119 missense possibly damaging 0.86
R6051:2700049A03Rik UTSW 12 71184530 missense possibly damaging 0.84
R6148:2700049A03Rik UTSW 12 71187426 missense possibly damaging 0.71
R6158:2700049A03Rik UTSW 12 71170636 missense possibly damaging 0.51
R6916:2700049A03Rik UTSW 12 71164544 missense possibly damaging 0.86
R7129:2700049A03Rik UTSW 12 71216230 intron probably null
R7168:2700049A03Rik UTSW 12 71216057 missense probably damaging 0.98
R7193:2700049A03Rik UTSW 12 71219189 critical splice acceptor site probably null
R7200:2700049A03Rik UTSW 12 71140906 missense probably damaging 0.96
R7359:2700049A03Rik UTSW 12 71189574 missense possibly damaging 0.51
R7488:2700049A03Rik UTSW 12 71150405 missense possibly damaging 0.67
R7755:2700049A03Rik UTSW 12 71189413 missense probably benign 0.02
R7757:2700049A03Rik UTSW 12 71189413 missense probably benign 0.02
Predicted Primers PCR Primer
(F):5'- TGGAGGCCAGAATATGTATGTATAG -3'
(R):5'- TATGCTGCTCCATGAACGCG -3'

Sequencing Primer
(F):5'- GTTCAAGAAACAAAACATACCTAAGG -3'
(R):5'- GAACGCGTTCATCTGCTTG -3'
Posted On2014-06-23