Incidental Mutation 'R1820:Aldh5a1'
ID204805
Institutional Source Beutler Lab
Gene Symbol Aldh5a1
Ensembl Gene ENSMUSG00000035936
Gene Namealdhehyde dehydrogenase family 5, subfamily A1
SynonymsD630032B01Rik, SSADH, 6330403E24Rik, OTTMUSG00000000613
MMRRC Submission 039848-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.715) question?
Stock #R1820 (G1)
Quality Score225
Status Not validated
Chromosome13
Chromosomal Location24907579-24937661 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 24927572 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 124 (D124G)
Ref Sequence ENSEMBL: ENSMUSP00000040591 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000037615]
Predicted Effect probably benign
Transcript: ENSMUST00000037615
AA Change: D124G

PolyPhen 2 Score 0.006 (Sensitivity: 0.97; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000040591
Gene: ENSMUSG00000035936
AA Change: D124G

DomainStartEndE-ValueType
Pfam:Aldedh 57 518 7.7e-169 PFAM
Coding Region Coverage
  • 1x: 97.4%
  • 3x: 96.8%
  • 10x: 95.0%
  • 20x: 91.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This protein belongs to the aldehyde dehydrogenase family of proteins. This gene encodes a mitochondrial NAD(+)-dependent succinic semialdehyde dehydrogenase. A deficiency of this enzyme, known as 4-hydroxybutyricaciduria, is a rare inborn error in the metabolism of the neurotransmitter 4-aminobutyric acid (GABA). In response to the defect, physiologic fluids from patients accumulate GHB, a compound with numerous neuromodulatory properties. Two transcript variants encoding distinct isoforms have been identified for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous mutation of this gene results in reduced body weight, ataxia, seizures, gliosis of the hippocampus, and early death. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2410089E03Rik A G 15: 8,269,645 K3106E unknown Het
2700049A03Rik T C 12: 71,150,244 V197A possibly damaging Het
9230109A22Rik T C 15: 25,139,090 noncoding transcript Het
Acbd3 A G 1: 180,745,138 N321S probably benign Het
Actr3b T C 5: 25,849,158 probably null Het
Arhgap35 G A 7: 16,561,949 R1064W possibly damaging Het
Arhgef9 T A X: 95,081,536 I225F probably damaging Het
Arl16 T C 11: 120,466,761 T43A probably damaging Het
Camsap3 T C 8: 3,603,485 W409R probably damaging Het
Cfap43 T A 19: 47,897,216 H320L probably damaging Het
Chac2 T A 11: 30,977,496 N141I probably damaging Het
Chtf18 C A 17: 25,725,939 G211C probably damaging Het
Cwf19l1 T A 19: 44,127,387 Y201F probably benign Het
Dcun1d1 A T 3: 35,919,004 L114* probably null Het
Fam160a1 T A 3: 85,665,829 T938S probably damaging Het
Fdps A T 3: 89,095,043 H249Q probably benign Het
Gabrg1 T A 5: 70,774,413 Y329F probably damaging Het
Kctd8 T A 5: 69,340,341 I321F probably damaging Het
Kdm5b G T 1: 134,597,670 R299L possibly damaging Het
Kif23 T C 9: 61,926,438 T494A possibly damaging Het
Kmt2e A G 5: 23,473,547 H208R probably damaging Het
Lipo5 A T 19: 33,464,595 probably null Het
Lrrc28 G T 7: 67,641,111 T54K probably damaging Het
Luc7l2 G A 6: 38,598,819 probably null Het
Man2a2 A G 7: 80,358,933 F899L probably benign Het
Myo9b T C 8: 71,333,358 I633T probably damaging Het
Nynrin A T 14: 55,870,378 I981F possibly damaging Het
Olfr262 A T 19: 12,241,248 S138T probably damaging Het
Olfr945 A G 9: 39,258,399 I91T possibly damaging Het
Pank1 A G 19: 34,877,684 probably null Het
Phc2 C T 4: 128,743,543 A47V probably damaging Het
Plekhs1 A G 19: 56,478,522 R262G possibly damaging Het
Pnp2 C A 14: 50,964,457 P300Q possibly damaging Het
Polq T A 16: 37,029,418 S345T possibly damaging Het
Prag1 A G 8: 36,103,804 T514A probably benign Het
Psmd5 T C 2: 34,870,746 probably null Het
Rfx6 T G 10: 51,723,125 probably null Het
Rhbdd2 G A 5: 135,636,049 C78Y probably damaging Het
Rnf157 G T 11: 116,354,651 P313T probably damaging Het
Ryr2 A G 13: 11,587,316 L4560P probably damaging Het
Scai A T 2: 39,106,978 M268K possibly damaging Het
Scd3 A T 19: 44,241,806 T343S probably benign Het
Scimp A T 11: 70,791,597 S98T probably benign Het
Sfrp2 A G 3: 83,773,154 N207S probably benign Het
Shf G A 2: 122,368,682 P51S probably damaging Het
Sis T C 3: 72,921,142 Y1200C probably damaging Het
Sp1 T A 15: 102,409,076 S343R possibly damaging Het
Spata31d1a A T 13: 59,701,255 C1020S possibly damaging Het
Spink5 A G 18: 43,989,419 N317S possibly damaging Het
Sptbn2 A G 19: 4,726,596 D224G probably damaging Het
St8sia3 T C 18: 64,269,632 I114T probably damaging Het
Zscan5b C A 7: 6,239,163 H460Q probably damaging Het
Other mutations in Aldh5a1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00945:Aldh5a1 APN 13 24926158 splice site probably benign
IGL01468:Aldh5a1 APN 13 24911553 utr 3 prime probably benign
IGL01538:Aldh5a1 APN 13 24918512 missense possibly damaging 0.90
IGL02839:Aldh5a1 APN 13 24911620 missense probably damaging 1.00
R0529:Aldh5a1 UTSW 13 24913873 missense probably benign 0.00
R2295:Aldh5a1 UTSW 13 24926099 missense probably damaging 1.00
R4231:Aldh5a1 UTSW 13 24911653 missense probably damaging 1.00
R4591:Aldh5a1 UTSW 13 24924008 missense probably damaging 1.00
R4865:Aldh5a1 UTSW 13 24911584 missense probably damaging 1.00
R5159:Aldh5a1 UTSW 13 24913793 missense possibly damaging 0.72
R5563:Aldh5a1 UTSW 13 24918626 missense possibly damaging 0.95
R6146:Aldh5a1 UTSW 13 24919678 critical splice donor site probably null
R6362:Aldh5a1 UTSW 13 24918550 missense probably benign 0.24
R6531:Aldh5a1 UTSW 13 24918564 missense probably benign 0.11
R6705:Aldh5a1 UTSW 13 24912270 missense probably damaging 1.00
R7151:Aldh5a1 UTSW 13 24937399 nonsense probably null
R7155:Aldh5a1 UTSW 13 24911589 missense possibly damaging 0.74
R7698:Aldh5a1 UTSW 13 24911748 missense probably damaging 0.99
R8027:Aldh5a1 UTSW 13 24926110 nonsense probably null
R8712:Aldh5a1 UTSW 13 24918541 missense probably damaging 1.00
R8849:Aldh5a1 UTSW 13 24937481 missense probably benign
R8910:Aldh5a1 UTSW 13 24918616 missense probably damaging 1.00
Z1177:Aldh5a1 UTSW 13 24911638 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACCATAATGACTTAGTCCCTCATC -3'
(R):5'- GTGGTGGCTTCTTCATACATATATG -3'

Sequencing Primer
(F):5'- TGACTTAGTCCCTCATCAAAGG -3'
(R):5'- CCAAAACGTTTACTAGCTACTGGGG -3'
Posted On2014-06-23