Incidental Mutation 'R0111:Adgre4'
ID20481
Institutional Source Beutler Lab
Gene Symbol Adgre4
Ensembl Gene ENSMUSG00000032915
Gene Nameadhesion G protein-coupled receptor E4
SynonymsGpr127, EGF-TM7, FIRE, Emr4, D17Ertd479e
MMRRC Submission 038397-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0111 (G1)
Quality Score174
Status Validated (trace)
Chromosome17
Chromosomal Location55749984-55853662 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 55817073 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Leucine at position 491 (H491L)
Ref Sequence ENSEMBL: ENSMUSP00000025004 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025004]
Predicted Effect possibly damaging
Transcript: ENSMUST00000025004
AA Change: H491L

PolyPhen 2 Score 0.922 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000025004
Gene: ENSMUSG00000032915
AA Change: H491L

DomainStartEndE-ValueType
signal peptide 1 36 N/A INTRINSIC
Blast:EGF_like 38 76 2e-10 BLAST
Pfam:EGF_CA 77 117 3.6e-9 PFAM
GPS 288 338 4.03e-12 SMART
Pfam:7tm_2 343 588 5.7e-57 PFAM
low complexity region 613 628 N/A INTRINSIC
Meta Mutation Damage Score 0.1795 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.2%
  • 10x: 96.2%
  • 20x: 92.8%
Validation Efficiency 100% (65/65)
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrg3 T C 8: 95,035,110 probably benign Het
Arhgap5 T C 12: 52,559,960 probably benign Het
Asic1 T C 15: 99,696,983 Y334H probably damaging Het
Calcr T A 6: 3,717,157 D101V probably damaging Het
Cdh2 A T 18: 16,774,509 N57K probably benign Het
Clec4d C A 6: 123,268,047 Y95* probably null Het
Cracr2a A G 6: 127,604,061 T67A probably benign Het
Dennd5a A T 7: 109,934,754 V53D probably damaging Het
Dnah7a T C 1: 53,468,684 D3076G probably benign Het
Espnl T C 1: 91,344,742 M608T probably benign Het
Fam149a C T 8: 45,341,146 probably benign Het
Fam35a T C 14: 34,267,729 K407E probably damaging Het
Fam46c T C 3: 100,472,786 D218G probably damaging Het
Flnc T C 6: 29,454,340 V1884A probably damaging Het
Helz2 A C 2: 181,237,802 S674R probably benign Het
Hoxa2 T G 6: 52,164,487 probably null Het
Ifi47 T A 11: 49,096,070 N221K probably damaging Het
Ipo9 A G 1: 135,405,924 V340A probably damaging Het
Kalrn A T 16: 34,031,590 N373K probably damaging Het
Kif26a T C 12: 112,163,337 probably benign Het
Kiss1r A G 10: 79,918,689 T6A possibly damaging Het
Lama1 A T 17: 67,737,498 I131F probably damaging Het
Nefm T C 14: 68,124,542 D91G probably benign Het
Nos3 C T 5: 24,372,704 T572I probably damaging Het
Notch2 T C 3: 98,138,761 F1710L probably benign Het
Olfr70 T C 4: 43,696,648 N175S probably damaging Het
Olfr804 T A 10: 129,705,277 I133N probably damaging Het
Ostm1 T C 10: 42,679,258 L92P probably damaging Het
Pcdh15 T A 10: 74,626,819 Y1445* probably null Het
Pde1b T C 15: 103,503,513 S14P probably benign Het
Pitpna T C 11: 75,625,484 V265A probably benign Het
Plec G T 15: 76,178,646 T2476K probably damaging Het
Pold2 A G 11: 5,876,760 L58P probably damaging Het
Ppp3cc C T 14: 70,256,359 probably null Het
Prss36 A G 7: 127,934,545 L530P probably damaging Het
Ptpn13 T C 5: 103,580,763 probably benign Het
Ptpn23 T C 9: 110,385,623 D1570G probably damaging Het
Rab42 T C 4: 132,302,365 D182G possibly damaging Het
Rbm27 T A 18: 42,305,672 probably benign Het
Rp1 T C 1: 4,344,760 E2043G probably damaging Het
Rufy3 C T 5: 88,630,584 S341F probably damaging Het
Samd9l C T 6: 3,374,946 V772I possibly damaging Het
Scaper A G 9: 55,602,790 M654T probably benign Het
Sipa1l3 G A 7: 29,348,318 P333S probably damaging Het
Slc30a10 C A 1: 185,455,547 R162S probably benign Het
Spryd3 A T 15: 102,128,537 probably null Het
Tas2r110 T C 6: 132,868,203 F66L probably benign Het
Thap2 T C 10: 115,372,627 N196S probably benign Het
Themis2 C A 4: 132,789,925 R88L probably benign Het
Trip12 A T 1: 84,759,133 probably benign Het
Ube3b T A 5: 114,390,376 probably benign Het
Usp20 T A 2: 31,002,612 H64Q probably damaging Het
Vmn2r100 C A 17: 19,522,120 P252Q possibly damaging Het
Vmn2r15 T C 5: 109,287,156 R561G possibly damaging Het
Vsig10l A G 7: 43,468,101 D604G probably damaging Het
Wdr90 A G 17: 25,848,444 probably benign Het
Xirp2 A T 2: 67,508,378 N321I probably damaging Het
Zfp595 A G 13: 67,320,920 F11S possibly damaging Het
Zfp953 T A 13: 67,343,075 H271L probably damaging Het
Other mutations in Adgre4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00089:Adgre4 APN 17 55791915 splice site probably benign
IGL00228:Adgre4 APN 17 55802135 missense probably damaging 1.00
IGL00572:Adgre4 APN 17 55820648 missense probably benign 0.00
IGL01404:Adgre4 APN 17 55797639 missense possibly damaging 0.63
IGL01420:Adgre4 APN 17 55799785 splice site probably benign
IGL01501:Adgre4 APN 17 55802002 splice site probably benign
IGL01510:Adgre4 APN 17 55818760 critical splice donor site probably null
IGL01554:Adgre4 APN 17 55817090 missense probably damaging 1.00
IGL01607:Adgre4 APN 17 55794748 splice site probably benign
IGL01767:Adgre4 APN 17 55797740 missense probably benign 0.19
IGL02253:Adgre4 APN 17 55760573 missense probably benign 0.01
IGL02358:Adgre4 APN 17 55843209 missense probably benign 0.15
IGL02466:Adgre4 APN 17 55814188 missense probably benign 0.42
IGL03057:Adgre4 APN 17 55799602 splice site probably benign
R0070:Adgre4 UTSW 17 55802154 missense probably damaging 0.98
R0070:Adgre4 UTSW 17 55802154 missense probably damaging 0.98
R0311:Adgre4 UTSW 17 55802010 missense probably benign 0.36
R0366:Adgre4 UTSW 17 55792001 nonsense probably null
R0415:Adgre4 UTSW 17 55852288 missense probably benign 0.03
R0465:Adgre4 UTSW 17 55785137 splice site probably benign
R0619:Adgre4 UTSW 17 55820679 missense possibly damaging 0.52
R0685:Adgre4 UTSW 17 55792035 missense probably benign 0.05
R0724:Adgre4 UTSW 17 55852281 missense probably benign 0.00
R0835:Adgre4 UTSW 17 55799637 missense probably damaging 1.00
R1330:Adgre4 UTSW 17 55778814 missense probably benign 0.36
R1452:Adgre4 UTSW 17 55784996 missense probably benign 0.35
R1960:Adgre4 UTSW 17 55791497 missense probably benign
R1961:Adgre4 UTSW 17 55791497 missense probably benign
R2046:Adgre4 UTSW 17 55778847 missense possibly damaging 0.82
R2421:Adgre4 UTSW 17 55778872 missense probably benign 0.10
R2570:Adgre4 UTSW 17 55778878 missense possibly damaging 0.54
R3162:Adgre4 UTSW 17 55802218 splice site probably benign
R4222:Adgre4 UTSW 17 55785121 missense probably damaging 1.00
R4526:Adgre4 UTSW 17 55785016 nonsense probably null
R4631:Adgre4 UTSW 17 55814305 missense probably null 1.00
R4689:Adgre4 UTSW 17 55802096 missense probably damaging 1.00
R4701:Adgre4 UTSW 17 55784971 missense probably damaging 1.00
R4792:Adgre4 UTSW 17 55791491 missense probably benign 0.00
R5205:Adgre4 UTSW 17 55794727 nonsense probably null
R5210:Adgre4 UTSW 17 55785029 missense probably damaging 0.97
R5358:Adgre4 UTSW 17 55818758 missense probably benign 0.00
R5873:Adgre4 UTSW 17 55852282 missense probably benign 0.13
R6025:Adgre4 UTSW 17 55792013 missense probably benign 0.00
R6257:Adgre4 UTSW 17 55802133 missense possibly damaging 0.87
R6426:Adgre4 UTSW 17 55802196 missense probably benign 0.18
R6440:Adgre4 UTSW 17 55794744 critical splice donor site probably null
R6484:Adgre4 UTSW 17 55802036 missense possibly damaging 0.52
R6680:Adgre4 UTSW 17 55791959 missense probably benign 0.09
R7086:Adgre4 UTSW 17 55820649 missense probably benign 0.00
R7442:Adgre4 UTSW 17 55852340 missense probably benign 0.04
R7467:Adgre4 UTSW 17 55791952 missense probably benign 0.00
R7875:Adgre4 UTSW 17 55792016 missense probably benign 0.00
R7958:Adgre4 UTSW 17 55792016 missense probably benign 0.00
R8007:Adgre4 UTSW 17 55814233 missense probably damaging 0.99
S24628:Adgre4 UTSW 17 55852288 missense probably benign 0.03
X0010:Adgre4 UTSW 17 55814308 missense probably damaging 1.00
Z1177:Adgre4 UTSW 17 55814152 critical splice acceptor site probably null
Predicted Primers PCR Primer
(F):5'- ATGCACCCAGCGTGTCAGACAA -3'
(R):5'- TGCAGCATTGCATAGAGAGTTGGAG -3'

Sequencing Primer
(F):5'- GCGTGTCAGACAAGAAATTCTTC -3'
(R):5'- TGATGATATACTCAGGAAAAAAGGC -3'
Posted On2013-04-11