Mutagenetix > Incidental Mutation

Incidental Mutation 'R1820:Sptbn2'

204819

Institutional Source

Beutler Lab

Gene Symbol

Sptbn2

Ensembl Gene

ENSMUSG00000067889

Gene Name

spectrin beta, non-erythrocytic 2

Synonyms

Spnb3

MMRRC Submission

039848-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R1820 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

4761195-4802388 bp(+) (GRCm39)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 4776624 bp (GRCm39)

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Glycine at position 224 (D224G)

Ref Sequence

ENSEMBL: ENSMUSP00000008991 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000008991]

AlphaFold

Q68FG2

Predicted Effect

probably damaging
Transcript: ENSMUST00000008991
AA Change: D224G

PolyPhen 2 Score 0.978 (Sensitivity: 0.76; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000008991
Gene: ENSMUSG00000067889
AA Change: D224G

Domain	Start	End	E-Value	Type
CH	59	159	1.86e-28	SMART
CH	178	276	2.86e-20	SMART
SPEC	308	414	4.63e-1	SMART
SPEC	428	528	3.07e-23	SMART
SPEC	534	638	4.47e-25	SMART
SPEC	644	744	1.28e-25	SMART
SPEC	750	849	4.98e-23	SMART
SPEC	855	955	1.63e-18	SMART
SPEC	961	1062	1.45e-24	SMART
SPEC	1068	1169	4.15e-20	SMART
SPEC	1175	1275	5.26e-22	SMART
SPEC	1281	1380	1.17e-19	SMART
SPEC	1386	1485	2.06e-24	SMART
SPEC	1491	1585	1.74e-22	SMART
SPEC	1591	1691	5.42e-24	SMART
SPEC	1697	1798	2.1e-21	SMART
SPEC	1804	1904	5.47e-20	SMART
SPEC	1910	2010	1.99e-22	SMART
SPEC	2016	2256	2.92e-6	SMART
PH	2219	2330	1.65e-14	SMART
low complexity region	2373	2386	N/A	INTRINSIC

Coding Region Coverage

1x: 97.4%
3x: 96.8%
10x: 95.0%
20x: 91.5%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Spectrins are principle components of a cell's membrane-cytoskeleton and are composed of two alpha and two beta spectrin subunits. The protein encoded by this gene (SPTBN2), is called spectrin beta non-erythrocytic 2 or beta-III spectrin. It is related to, but distinct from, the beta-II spectrin gene which is also known as spectrin beta non-erythrocytic 1 (SPTBN1). SPTBN2 regulates the glutamate signaling pathway by stabilizing the glutamate transporter EAAT4 at the surface of the plasma membrane. Mutations in this gene cause a form of spinocerebellar ataxia, SCA5, that is characterized by neurodegeneration, progressive locomotor incoordination, dysarthria, and uncoordinated eye movements. [provided by RefSeq, Dec 2009]
PHENOTYPE: Homozygous hypomorphic mutants exhibit a progressive ataxic phenotype with gait abnormalities, tremor, deteriorating motor coordination, Purkinje cell loss, and cerebellar atrophy (molecular layer thinning) and age-related reduction in simple firing ratein surviving Purkinje cells. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 52 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2700049A03Rik	T	C	12: 71,197,018 (GRCm39)	V197A	possibly damaging	Het
9230109A22Rik	T	C	15: 25,139,176 (GRCm39)		noncoding transcript	Het
Acbd3	A	G	1: 180,572,703 (GRCm39)	N321S	probably benign	Het
Actr3b	T	C	5: 26,054,156 (GRCm39)		probably null	Het
Aldh5a1	T	C	13: 25,111,555 (GRCm39)	D124G	probably benign	Het
Arhgap35	G	A	7: 16,295,874 (GRCm39)	R1064W	possibly damaging	Het
Arhgef9	T	A	X: 94,125,142 (GRCm39)	I225F	probably damaging	Het
Arl16	T	C	11: 120,357,587 (GRCm39)	T43A	probably damaging	Het
Camsap3	T	C	8: 3,653,485 (GRCm39)	W409R	probably damaging	Het
Cfap43	T	A	19: 47,885,655 (GRCm39)	H320L	probably damaging	Het
Chac2	T	A	11: 30,927,496 (GRCm39)	N141I	probably damaging	Het
Chtf18	C	A	17: 25,944,913 (GRCm39)	G211C	probably damaging	Het
Cplane1	A	G	15: 8,299,129 (GRCm39)	K3106E	unknown	Het
Cwf19l1	T	A	19: 44,115,826 (GRCm39)	Y201F	probably benign	Het
Dcun1d1	A	T	3: 35,973,153 (GRCm39)	L114*	probably null	Het
Fdps	A	T	3: 89,002,350 (GRCm39)	H249Q	probably benign	Het
Fhip1a	T	A	3: 85,573,136 (GRCm39)	T938S	probably damaging	Het
Gabrg1	T	A	5: 70,931,756 (GRCm39)	Y329F	probably damaging	Het
Kctd8	T	A	5: 69,497,684 (GRCm39)	I321F	probably damaging	Het
Kdm5b	G	T	1: 134,525,408 (GRCm39)	R299L	possibly damaging	Het
Kif23	T	C	9: 61,833,720 (GRCm39)	T494A	possibly damaging	Het
Kmt2e	A	G	5: 23,678,545 (GRCm39)	H208R	probably damaging	Het
Lipo5	A	T	19: 33,441,995 (GRCm39)		probably null	Het
Lrrc28	G	T	7: 67,290,859 (GRCm39)	T54K	probably damaging	Het
Luc7l2	G	A	6: 38,575,754 (GRCm39)		probably null	Het
Man2a2	A	G	7: 80,008,681 (GRCm39)	F899L	probably benign	Het
Myo9b	T	C	8: 71,786,002 (GRCm39)	I633T	probably damaging	Het
Nynrin	A	T	14: 56,107,835 (GRCm39)	I981F	possibly damaging	Het
Or5an1c	A	T	19: 12,218,612 (GRCm39)	S138T	probably damaging	Het
Or8g28	A	G	9: 39,169,695 (GRCm39)	I91T	possibly damaging	Het
Pank1	A	G	19: 34,855,084 (GRCm39)		probably null	Het
Phc2	C	T	4: 128,637,336 (GRCm39)	A47V	probably damaging	Het
Plekhs1	A	G	19: 56,466,954 (GRCm39)	R262G	possibly damaging	Het
Pnp2	C	A	14: 51,201,914 (GRCm39)	P300Q	possibly damaging	Het
Polq	T	A	16: 36,849,780 (GRCm39)	S345T	possibly damaging	Het
Prag1	A	G	8: 36,570,958 (GRCm39)	T514A	probably benign	Het
Psmd5	T	C	2: 34,760,758 (GRCm39)		probably null	Het
Rfx6	T	G	10: 51,599,221 (GRCm39)		probably null	Het
Rhbdd2	G	A	5: 135,664,903 (GRCm39)	C78Y	probably damaging	Het
Rnf157	G	T	11: 116,245,477 (GRCm39)	P313T	probably damaging	Het
Ryr2	A	G	13: 11,602,202 (GRCm39)	L4560P	probably damaging	Het
Scai	A	T	2: 38,996,990 (GRCm39)	M268K	possibly damaging	Het
Scd3	A	T	19: 44,230,245 (GRCm39)	T343S	probably benign	Het
Scimp	A	T	11: 70,682,423 (GRCm39)	S98T	probably benign	Het
Sfrp2	A	G	3: 83,680,461 (GRCm39)	N207S	probably benign	Het
Shf	G	A	2: 122,199,163 (GRCm39)	P51S	probably damaging	Het
Sis	T	C	3: 72,828,475 (GRCm39)	Y1200C	probably damaging	Het
Sp1	T	A	15: 102,317,511 (GRCm39)	S343R	possibly damaging	Het
Spata31d1a	A	T	13: 59,849,069 (GRCm39)	C1020S	possibly damaging	Het
Spink5	A	G	18: 44,122,486 (GRCm39)	N317S	possibly damaging	Het
St8sia3	T	C	18: 64,402,703 (GRCm39)	I114T	probably damaging	Het
Zscan5b	C	A	7: 6,242,162 (GRCm39)	H460Q	probably damaging	Het

Other mutations in Sptbn2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00421:Sptbn2	APN	19	4,774,733 (GRCm39)	missense	possibly damaging	0.94
IGL00688:Sptbn2	APN	19	4,775,966 (GRCm39)	missense	probably damaging	1.00
IGL01339:Sptbn2	APN	19	4,796,000 (GRCm39)	nonsense	probably null
IGL01373:Sptbn2	APN	19	4,796,000 (GRCm39)	nonsense	probably null
IGL01420:Sptbn2	APN	19	4,784,153 (GRCm39)	missense	probably benign
IGL01456:Sptbn2	APN	19	4,796,777 (GRCm39)	missense	probably damaging	1.00
IGL01953:Sptbn2	APN	19	4,799,721 (GRCm39)	missense	probably benign
IGL03026:Sptbn2	APN	19	4,774,261 (GRCm39)	critical splice donor site	probably null
IGL03275:Sptbn2	APN	19	4,782,689 (GRCm39)	missense	possibly damaging	0.65
IGL03286:Sptbn2	APN	19	4,797,860 (GRCm39)	missense	probably damaging	0.97
F5770:Sptbn2	UTSW	19	4,800,660 (GRCm39)	missense	probably damaging	1.00
PIT4696001:Sptbn2	UTSW	19	4,795,605 (GRCm39)	missense	probably benign	0.00
R0046:Sptbn2	UTSW	19	4,795,405 (GRCm39)	intron	probably benign
R0046:Sptbn2	UTSW	19	4,795,405 (GRCm39)	intron	probably benign
R0121:Sptbn2	UTSW	19	4,795,321 (GRCm39)	missense	probably damaging	1.00
R0127:Sptbn2	UTSW	19	4,774,772 (GRCm39)	missense	probably damaging	1.00
R0212:Sptbn2	UTSW	19	4,796,970 (GRCm39)	critical splice donor site	probably null
R0277:Sptbn2	UTSW	19	4,795,173 (GRCm39)	missense	probably benign	0.28
R0417:Sptbn2	UTSW	19	4,787,954 (GRCm39)	missense	probably benign	0.01
R0457:Sptbn2	UTSW	19	4,795,966 (GRCm39)	missense	possibly damaging	0.89
R0536:Sptbn2	UTSW	19	4,776,718 (GRCm39)	missense	probably damaging	0.99
R0631:Sptbn2	UTSW	19	4,790,014 (GRCm39)	missense	probably benign	0.01
R0734:Sptbn2	UTSW	19	4,798,151 (GRCm39)	nonsense	probably null
R0742:Sptbn2	UTSW	19	4,769,011 (GRCm39)	missense	possibly damaging	0.46
R1195:Sptbn2	UTSW	19	4,795,921 (GRCm39)	missense	possibly damaging	0.85
R1195:Sptbn2	UTSW	19	4,795,921 (GRCm39)	missense	possibly damaging	0.85
R1195:Sptbn2	UTSW	19	4,795,921 (GRCm39)	missense	possibly damaging	0.85
R1364:Sptbn2	UTSW	19	4,782,693 (GRCm39)	missense	probably damaging	1.00
R1495:Sptbn2	UTSW	19	4,769,004 (GRCm39)	missense	possibly damaging	0.92
R1498:Sptbn2	UTSW	19	4,794,274 (GRCm39)	missense	possibly damaging	0.94
R1606:Sptbn2	UTSW	19	4,800,270 (GRCm39)	critical splice donor site	probably null
R1678:Sptbn2	UTSW	19	4,800,525 (GRCm39)	missense	probably damaging	1.00
R1746:Sptbn2	UTSW	19	4,795,992 (GRCm39)	nonsense	probably null
R1830:Sptbn2	UTSW	19	4,782,569 (GRCm39)	missense	probably benign	0.09
R1863:Sptbn2	UTSW	19	4,782,713 (GRCm39)	missense	possibly damaging	0.54
R1967:Sptbn2	UTSW	19	4,795,327 (GRCm39)	missense	probably benign	0.00
R2085:Sptbn2	UTSW	19	4,788,587 (GRCm39)	missense	probably benign	0.09
R2301:Sptbn2	UTSW	19	4,784,166 (GRCm39)	missense	probably benign	0.00
R2310:Sptbn2	UTSW	19	4,768,963 (GRCm39)	missense	probably benign	0.19
R2888:Sptbn2	UTSW	19	4,798,664 (GRCm39)	missense	possibly damaging	0.52
R3788:Sptbn2	UTSW	19	4,795,950 (GRCm39)	missense	probably damaging	1.00
R4429:Sptbn2	UTSW	19	4,788,383 (GRCm39)	missense	probably damaging	1.00
R4536:Sptbn2	UTSW	19	4,782,630 (GRCm39)	missense	probably damaging	1.00
R4662:Sptbn2	UTSW	19	4,789,267 (GRCm39)	missense	probably damaging	1.00
R4672:Sptbn2	UTSW	19	4,782,524 (GRCm39)	missense	probably benign	0.25
R4731:Sptbn2	UTSW	19	4,792,508 (GRCm39)	missense	probably damaging	0.96
R4747:Sptbn2	UTSW	19	4,798,182 (GRCm39)	missense	probably benign	0.27
R4889:Sptbn2	UTSW	19	4,779,458 (GRCm39)	missense	possibly damaging	0.69
R4891:Sptbn2	UTSW	19	4,788,497 (GRCm39)	missense	probably damaging	1.00
R4965:Sptbn2	UTSW	19	4,779,337 (GRCm39)	missense	probably benign	0.13
R4968:Sptbn2	UTSW	19	4,779,230 (GRCm39)	splice site	probably null
R4981:Sptbn2	UTSW	19	4,801,686 (GRCm39)	missense	probably benign	0.22
R5159:Sptbn2	UTSW	19	4,787,885 (GRCm39)	missense	probably benign	0.12
R5202:Sptbn2	UTSW	19	4,774,212 (GRCm39)	missense	probably damaging	1.00
R5253:Sptbn2	UTSW	19	4,800,110 (GRCm39)	missense	probably benign	0.01
R5294:Sptbn2	UTSW	19	4,768,936 (GRCm39)	missense	possibly damaging	0.67
R5465:Sptbn2	UTSW	19	4,800,133 (GRCm39)	missense	probably benign	0.00
R5546:Sptbn2	UTSW	19	4,775,978 (GRCm39)	missense	probably damaging	1.00
R5593:Sptbn2	UTSW	19	4,798,975 (GRCm39)	missense	probably damaging	1.00
R5780:Sptbn2	UTSW	19	4,774,695 (GRCm39)	missense	probably damaging	1.00
R5835:Sptbn2	UTSW	19	4,788,247 (GRCm39)	missense	probably damaging	1.00
R6008:Sptbn2	UTSW	19	4,789,306 (GRCm39)	missense	possibly damaging	0.89
R6108:Sptbn2	UTSW	19	4,781,420 (GRCm39)	critical splice donor site	probably null
R6236:Sptbn2	UTSW	19	4,798,166 (GRCm39)	missense	probably benign	0.01
R6307:Sptbn2	UTSW	19	4,774,674 (GRCm39)	missense	probably damaging	1.00
R6383:Sptbn2	UTSW	19	4,782,524 (GRCm39)	missense	possibly damaging	0.89
R6397:Sptbn2	UTSW	19	4,792,446 (GRCm39)	missense	possibly damaging	0.91
R6453:Sptbn2	UTSW	19	4,794,208 (GRCm39)	missense	possibly damaging	0.67
R6561:Sptbn2	UTSW	19	4,797,954 (GRCm39)	missense	probably benign	0.39
R6564:Sptbn2	UTSW	19	4,782,052 (GRCm39)	missense	probably damaging	1.00
R6644:Sptbn2	UTSW	19	4,799,040 (GRCm39)	missense	probably benign	0.05
R6703:Sptbn2	UTSW	19	4,799,843 (GRCm39)	missense	probably benign
R6703:Sptbn2	UTSW	19	4,799,842 (GRCm39)	missense	probably benign
R6753:Sptbn2	UTSW	19	4,797,813 (GRCm39)	missense	probably benign	0.01
R7007:Sptbn2	UTSW	19	4,794,173 (GRCm39)	missense	possibly damaging	0.82
R7131:Sptbn2	UTSW	19	4,799,488 (GRCm39)	missense	probably null
R7219:Sptbn2	UTSW	19	4,774,201 (GRCm39)	missense	probably damaging	1.00
R7285:Sptbn2	UTSW	19	4,787,471 (GRCm39)	missense	probably benign	0.00
R7308:Sptbn2	UTSW	19	4,801,602 (GRCm39)	missense	probably benign
R7469:Sptbn2	UTSW	19	4,795,146 (GRCm39)	missense	probably benign	0.00
R7502:Sptbn2	UTSW	19	4,798,110 (GRCm39)	missense	probably benign	0.02
R7623:Sptbn2	UTSW	19	4,776,196 (GRCm39)	missense	probably damaging	1.00
R7635:Sptbn2	UTSW	19	4,794,235 (GRCm39)	missense	probably damaging	1.00
R7733:Sptbn2	UTSW	19	4,799,040 (GRCm39)	missense	probably benign	0.05
R7738:Sptbn2	UTSW	19	4,774,153 (GRCm39)	missense	probably damaging	1.00
R7742:Sptbn2	UTSW	19	4,799,040 (GRCm39)	missense	probably benign	0.05
R7767:Sptbn2	UTSW	19	4,784,171 (GRCm39)	missense	possibly damaging	0.62
R7795:Sptbn2	UTSW	19	4,799,040 (GRCm39)	missense	probably benign	0.05
R7796:Sptbn2	UTSW	19	4,799,040 (GRCm39)	missense	probably benign	0.05
R7871:Sptbn2	UTSW	19	4,799,040 (GRCm39)	missense	probably benign	0.05
R7877:Sptbn2	UTSW	19	4,794,290 (GRCm39)	missense	possibly damaging	0.93
R7920:Sptbn2	UTSW	19	4,799,040 (GRCm39)	missense	probably benign	0.05
R7921:Sptbn2	UTSW	19	4,799,040 (GRCm39)	missense	probably benign	0.05
R7923:Sptbn2	UTSW	19	4,796,827 (GRCm39)	missense	probably benign	0.01
R8137:Sptbn2	UTSW	19	4,787,431 (GRCm39)	missense	possibly damaging	0.81
R8305:Sptbn2	UTSW	19	4,779,158 (GRCm39)	missense	possibly damaging	0.81
R8695:Sptbn2	UTSW	19	4,796,724 (GRCm39)	missense	possibly damaging	0.86
R8790:Sptbn2	UTSW	19	4,782,052 (GRCm39)	missense	probably damaging	1.00
R9125:Sptbn2	UTSW	19	4,784,241 (GRCm39)	missense	probably benign	0.04
R9483:Sptbn2	UTSW	19	4,789,974 (GRCm39)	missense	probably damaging	1.00
R9620:Sptbn2	UTSW	19	4,800,535 (GRCm39)	missense	probably damaging	0.99
R9631:Sptbn2	UTSW	19	4,788,218 (GRCm39)	missense	probably damaging	1.00
R9646:Sptbn2	UTSW	19	4,795,341 (GRCm39)	missense	probably damaging	1.00
R9694:Sptbn2	UTSW	19	4,800,535 (GRCm39)	missense	probably damaging	0.99
V7580:Sptbn2	UTSW	19	4,800,660 (GRCm39)	missense	probably damaging	1.00
Z1176:Sptbn2	UTSW	19	4,795,219 (GRCm39)	missense	probably benign	0.01
Z1176:Sptbn2	UTSW	19	4,788,233 (GRCm39)	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- GGCTGAACTGTAGCATAGCC -3'
(R):5'- GCTGTGGAAACCATTGCTACTAC -3'

Sequencing Primer
(F):5'- TAGTAAACTCAAGGCCAGTCTGGTC -3'
(R):5'- GGAAACCATTGCTACTACCTAATTC -3'

Posted On

2014-06-23