Incidental Mutation 'R1820:Cfap43'
ID 204825
Institutional Source Beutler Lab
Gene Symbol Cfap43
Ensembl Gene ENSMUSG00000044948
Gene Name cilia and flagella associated protein 43
Synonyms D19Ertd652e, 4632415N18Rik, Wdr96, 4930428C11Rik, 4930463G05Rik
MMRRC Submission 039848-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.111) question?
Stock # R1820 (G1)
Quality Score 225
Status Not validated
Chromosome 19
Chromosomal Location 47723706-47825893 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 47885655 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Histidine to Leucine at position 320 (H320L)
Ref Sequence ENSEMBL: ENSMUSP00000093697 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000095998]
AlphaFold E9Q7R9
Predicted Effect noncoding transcript
Transcript: ENSMUST00000026048
Predicted Effect probably damaging
Transcript: ENSMUST00000095998
AA Change: H320L

PolyPhen 2 Score 0.991 (Sensitivity: 0.71; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000093697
Gene: ENSMUSG00000044948
AA Change: H320L

DomainStartEndE-ValueType
SCOP:d1eq1a_ 27 82 3e-3 SMART
low complexity region 115 135 N/A INTRINSIC
Mab-21 194 528 4.37e-84 SMART
Coding Region Coverage
  • 1x: 97.4%
  • 3x: 96.8%
  • 10x: 95.0%
  • 20x: 91.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the cilia- and flagella-associated protein family. [provided by RefSeq, Sep 2016]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit complete male sterility, asthenozoospermia, and teratozoospermia characterized by short, thick, and coiled flagella and sperm axonemal defects. [provided by MGI curators]
Allele List at MGI

All alleles(4) : Gene trapped(4)

Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2700049A03Rik T C 12: 71,197,018 (GRCm39) V197A possibly damaging Het
9230109A22Rik T C 15: 25,139,176 (GRCm39) noncoding transcript Het
Acbd3 A G 1: 180,572,703 (GRCm39) N321S probably benign Het
Actr3b T C 5: 26,054,156 (GRCm39) probably null Het
Aldh5a1 T C 13: 25,111,555 (GRCm39) D124G probably benign Het
Arhgap35 G A 7: 16,295,874 (GRCm39) R1064W possibly damaging Het
Arhgef9 T A X: 94,125,142 (GRCm39) I225F probably damaging Het
Arl16 T C 11: 120,357,587 (GRCm39) T43A probably damaging Het
Camsap3 T C 8: 3,653,485 (GRCm39) W409R probably damaging Het
Chac2 T A 11: 30,927,496 (GRCm39) N141I probably damaging Het
Chtf18 C A 17: 25,944,913 (GRCm39) G211C probably damaging Het
Cplane1 A G 15: 8,299,129 (GRCm39) K3106E unknown Het
Cwf19l1 T A 19: 44,115,826 (GRCm39) Y201F probably benign Het
Dcun1d1 A T 3: 35,973,153 (GRCm39) L114* probably null Het
Fdps A T 3: 89,002,350 (GRCm39) H249Q probably benign Het
Fhip1a T A 3: 85,573,136 (GRCm39) T938S probably damaging Het
Gabrg1 T A 5: 70,931,756 (GRCm39) Y329F probably damaging Het
Kctd8 T A 5: 69,497,684 (GRCm39) I321F probably damaging Het
Kdm5b G T 1: 134,525,408 (GRCm39) R299L possibly damaging Het
Kif23 T C 9: 61,833,720 (GRCm39) T494A possibly damaging Het
Kmt2e A G 5: 23,678,545 (GRCm39) H208R probably damaging Het
Lipo5 A T 19: 33,441,995 (GRCm39) probably null Het
Lrrc28 G T 7: 67,290,859 (GRCm39) T54K probably damaging Het
Luc7l2 G A 6: 38,575,754 (GRCm39) probably null Het
Man2a2 A G 7: 80,008,681 (GRCm39) F899L probably benign Het
Myo9b T C 8: 71,786,002 (GRCm39) I633T probably damaging Het
Nynrin A T 14: 56,107,835 (GRCm39) I981F possibly damaging Het
Or5an1c A T 19: 12,218,612 (GRCm39) S138T probably damaging Het
Or8g28 A G 9: 39,169,695 (GRCm39) I91T possibly damaging Het
Pank1 A G 19: 34,855,084 (GRCm39) probably null Het
Phc2 C T 4: 128,637,336 (GRCm39) A47V probably damaging Het
Plekhs1 A G 19: 56,466,954 (GRCm39) R262G possibly damaging Het
Pnp2 C A 14: 51,201,914 (GRCm39) P300Q possibly damaging Het
Polq T A 16: 36,849,780 (GRCm39) S345T possibly damaging Het
Prag1 A G 8: 36,570,958 (GRCm39) T514A probably benign Het
Psmd5 T C 2: 34,760,758 (GRCm39) probably null Het
Rfx6 T G 10: 51,599,221 (GRCm39) probably null Het
Rhbdd2 G A 5: 135,664,903 (GRCm39) C78Y probably damaging Het
Rnf157 G T 11: 116,245,477 (GRCm39) P313T probably damaging Het
Ryr2 A G 13: 11,602,202 (GRCm39) L4560P probably damaging Het
Scai A T 2: 38,996,990 (GRCm39) M268K possibly damaging Het
Scd3 A T 19: 44,230,245 (GRCm39) T343S probably benign Het
Scimp A T 11: 70,682,423 (GRCm39) S98T probably benign Het
Sfrp2 A G 3: 83,680,461 (GRCm39) N207S probably benign Het
Shf G A 2: 122,199,163 (GRCm39) P51S probably damaging Het
Sis T C 3: 72,828,475 (GRCm39) Y1200C probably damaging Het
Sp1 T A 15: 102,317,511 (GRCm39) S343R possibly damaging Het
Spata31d1a A T 13: 59,849,069 (GRCm39) C1020S possibly damaging Het
Spink5 A G 18: 44,122,486 (GRCm39) N317S possibly damaging Het
Sptbn2 A G 19: 4,776,624 (GRCm39) D224G probably damaging Het
St8sia3 T C 18: 64,402,703 (GRCm39) I114T probably damaging Het
Zscan5b C A 7: 6,242,162 (GRCm39) H460Q probably damaging Het
Other mutations in Cfap43
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00158:Cfap43 APN 19 47,818,914 (GRCm39) missense probably benign 0.08
IGL00325:Cfap43 APN 19 47,811,627 (GRCm39) splice site probably benign
IGL00918:Cfap43 APN 19 47,885,100 (GRCm39) missense probably damaging 1.00
IGL01402:Cfap43 APN 19 47,784,105 (GRCm39) missense probably benign 0.25
IGL01404:Cfap43 APN 19 47,784,105 (GRCm39) missense probably benign 0.25
IGL01656:Cfap43 APN 19 47,740,339 (GRCm39) missense possibly damaging 0.95
IGL01738:Cfap43 APN 19 47,785,624 (GRCm39) missense probably damaging 0.97
IGL02168:Cfap43 APN 19 47,740,362 (GRCm39) splice site probably benign
IGL02225:Cfap43 APN 19 47,800,616 (GRCm39) missense probably benign 0.00
IGL02308:Cfap43 APN 19 47,736,463 (GRCm39) missense probably benign
IGL02354:Cfap43 APN 19 47,885,852 (GRCm39) nonsense probably null
IGL02361:Cfap43 APN 19 47,885,852 (GRCm39) nonsense probably null
IGL03283:Cfap43 APN 19 47,779,851 (GRCm39) splice site probably benign
3-1:Cfap43 UTSW 19 47,740,294 (GRCm39) missense probably benign 0.02
IGL03046:Cfap43 UTSW 19 47,804,302 (GRCm39) missense probably damaging 1.00
PIT4495001:Cfap43 UTSW 19 47,885,741 (GRCm39) missense probably damaging 1.00
R0270:Cfap43 UTSW 19 47,785,642 (GRCm39) splice site probably benign
R0421:Cfap43 UTSW 19 47,824,014 (GRCm39) missense probably benign 0.00
R0433:Cfap43 UTSW 19 47,814,210 (GRCm39) missense probably benign 0.44
R0576:Cfap43 UTSW 19 47,785,579 (GRCm39) missense probably benign 0.00
R0646:Cfap43 UTSW 19 47,752,115 (GRCm39) missense probably benign 0.25
R0740:Cfap43 UTSW 19 47,824,243 (GRCm39) missense possibly damaging 0.95
R0836:Cfap43 UTSW 19 47,804,285 (GRCm39) missense probably benign 0.02
R0899:Cfap43 UTSW 19 47,736,433 (GRCm39) missense possibly damaging 0.93
R1171:Cfap43 UTSW 19 47,824,150 (GRCm39) missense probably benign 0.03
R1271:Cfap43 UTSW 19 47,736,387 (GRCm39) missense probably damaging 0.98
R1271:Cfap43 UTSW 19 47,728,183 (GRCm39) missense probably benign 0.22
R1371:Cfap43 UTSW 19 47,824,045 (GRCm39) missense possibly damaging 0.95
R1469:Cfap43 UTSW 19 47,885,314 (GRCm39) missense probably damaging 1.00
R1541:Cfap43 UTSW 19 47,752,291 (GRCm39) splice site probably null
R1625:Cfap43 UTSW 19 47,739,527 (GRCm39) missense probably damaging 1.00
R1679:Cfap43 UTSW 19 47,761,553 (GRCm39) missense probably benign 0.00
R1690:Cfap43 UTSW 19 47,739,505 (GRCm39) critical splice donor site probably null
R1891:Cfap43 UTSW 19 47,802,380 (GRCm39) missense probably damaging 0.97
R1956:Cfap43 UTSW 19 47,885,649 (GRCm39) missense probably benign 0.19
R1958:Cfap43 UTSW 19 47,885,649 (GRCm39) missense probably benign 0.19
R2110:Cfap43 UTSW 19 47,824,197 (GRCm39) missense probably damaging 1.00
R2118:Cfap43 UTSW 19 47,758,877 (GRCm39) missense probably damaging 1.00
R2290:Cfap43 UTSW 19 47,761,574 (GRCm39) missense probably damaging 0.99
R3691:Cfap43 UTSW 19 47,885,512 (GRCm39) missense probably benign 0.01
R3765:Cfap43 UTSW 19 47,824,014 (GRCm39) missense probably benign 0.01
R3917:Cfap43 UTSW 19 47,886,189 (GRCm39) missense probably benign 0.00
R3924:Cfap43 UTSW 19 47,785,555 (GRCm39) missense probably benign 0.00
R3925:Cfap43 UTSW 19 47,785,555 (GRCm39) missense probably benign 0.00
R3947:Cfap43 UTSW 19 47,754,418 (GRCm39) missense probably benign 0.28
R4256:Cfap43 UTSW 19 47,770,844 (GRCm39) missense probably benign 0.06
R4385:Cfap43 UTSW 19 47,785,568 (GRCm39) missense probably benign 0.28
R4395:Cfap43 UTSW 19 47,740,352 (GRCm39) missense probably benign 0.00
R4405:Cfap43 UTSW 19 47,728,236 (GRCm39) missense possibly damaging 0.57
R4541:Cfap43 UTSW 19 47,736,454 (GRCm39) missense probably benign 0.02
R4583:Cfap43 UTSW 19 47,825,655 (GRCm39) missense probably null 0.99
R4690:Cfap43 UTSW 19 47,736,298 (GRCm39) missense probably benign 0.45
R4852:Cfap43 UTSW 19 47,885,550 (GRCm39) missense possibly damaging 0.87
R5185:Cfap43 UTSW 19 47,768,833 (GRCm39) missense probably benign 0.00
R5192:Cfap43 UTSW 19 47,814,364 (GRCm39) missense probably damaging 1.00
R5196:Cfap43 UTSW 19 47,814,364 (GRCm39) missense probably damaging 1.00
R5197:Cfap43 UTSW 19 47,885,811 (GRCm39) missense probably damaging 1.00
R5205:Cfap43 UTSW 19 47,885,987 (GRCm39) missense possibly damaging 0.76
R5425:Cfap43 UTSW 19 47,885,371 (GRCm39) missense possibly damaging 0.94
R5516:Cfap43 UTSW 19 47,726,648 (GRCm39) splice site probably null
R5644:Cfap43 UTSW 19 47,784,114 (GRCm39) missense possibly damaging 0.66
R5844:Cfap43 UTSW 19 47,784,135 (GRCm39) missense probably benign
R5901:Cfap43 UTSW 19 47,885,538 (GRCm39) missense probably damaging 0.97
R5910:Cfap43 UTSW 19 47,768,710 (GRCm39) missense possibly damaging 0.63
R5920:Cfap43 UTSW 19 47,749,335 (GRCm39) missense possibly damaging 0.88
R5963:Cfap43 UTSW 19 47,734,013 (GRCm39) missense probably benign 0.42
R6817:Cfap43 UTSW 19 47,744,524 (GRCm39) missense possibly damaging 0.88
R6974:Cfap43 UTSW 19 47,773,717 (GRCm39) critical splice donor site probably null
R7219:Cfap43 UTSW 19 47,779,912 (GRCm39) missense probably benign 0.02
R7270:Cfap43 UTSW 19 47,728,224 (GRCm39) missense possibly damaging 0.86
R7733:Cfap43 UTSW 19 47,886,432 (GRCm39) missense possibly damaging 0.75
R7995:Cfap43 UTSW 19 47,886,462 (GRCm39) missense probably damaging 1.00
R8013:Cfap43 UTSW 19 47,761,548 (GRCm39) missense probably damaging 0.99
R8176:Cfap43 UTSW 19 47,784,114 (GRCm39) missense probably benign 0.00
R8242:Cfap43 UTSW 19 47,885,808 (GRCm39) missense probably damaging 1.00
R8303:Cfap43 UTSW 19 47,754,274 (GRCm39) nonsense probably null
R8333:Cfap43 UTSW 19 47,885,765 (GRCm39) nonsense probably null
R8353:Cfap43 UTSW 19 47,735,086 (GRCm39) missense probably damaging 1.00
R8453:Cfap43 UTSW 19 47,735,086 (GRCm39) missense probably damaging 1.00
R8474:Cfap43 UTSW 19 47,886,363 (GRCm39) missense probably benign 0.32
R8478:Cfap43 UTSW 19 47,764,515 (GRCm39) missense probably benign 0.02
R8676:Cfap43 UTSW 19 47,736,456 (GRCm39) missense possibly damaging 0.95
R8928:Cfap43 UTSW 19 47,804,399 (GRCm39) missense probably benign 0.00
R9190:Cfap43 UTSW 19 47,726,293 (GRCm39) missense possibly damaging 0.65
R9426:Cfap43 UTSW 19 47,814,237 (GRCm39) missense probably damaging 0.99
R9450:Cfap43 UTSW 19 47,886,310 (GRCm39) missense probably benign 0.23
R9491:Cfap43 UTSW 19 47,800,505 (GRCm39) critical splice donor site probably null
R9515:Cfap43 UTSW 19 47,773,814 (GRCm39) missense probably damaging 1.00
R9732:Cfap43 UTSW 19 47,775,446 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AAAGCCTTGCCTGTCATCCG -3'
(R):5'- ATATGTTGTGTCTCCTCTACGG -3'

Sequencing Primer
(F):5'- GGAACTCTCGCTCATAGACAG -3'
(R):5'- GTGTCTCCTCTACGGCAAGAATAG -3'
Posted On 2014-06-23