Mutagenetix > Incidental Mutations

Incidental Mutation 'R1832:Pappa2'

204833

Institutional Source

Beutler Lab

Gene Symbol

Pappa2

Ensembl Gene

ENSMUSG00000073530

Gene Name

pappalysin 2

Synonyms

pregnancy-associated plasma preproprotein-A2, placenta-specific 3, pregnancy-associated plasma protein-E, PAPP-A2, PLAC3, Pappe

MMRRC Submission

039859-MU

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R1832 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

158711727-158980490 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 158857316 bp

Zygosity

Heterozygous

Amino Acid Change

Glutamic Acid to Valine at position 751 (E751V)

Ref Sequence

ENSEMBL: ENSMUSP00000124022 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000159861]

Predicted Effect

probably damaging
Transcript: ENSMUST00000159861
AA Change: E751V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000124022
Gene: ENSMUSG00000073530
AA Change: E751V

Domain	Start	End	E-Value	Type
signal peptide	1	18	N/A	INTRINSIC
Pfam:Laminin_G_3	271	440	1.2e-25	PFAM
NL	572	614	2.81e-5	SMART
Pfam:Peptidase_M43	669	832	1.5e-12	PFAM
Blast:FN3	844	1103	1e-169	BLAST
low complexity region	1130	1139	N/A	INTRINSIC
low complexity region	1361	1370	N/A	INTRINSIC
CCP	1394	1457	4.97e0	SMART
CCP	1462	1519	4.81e-1	SMART
CCP	1523	1588	2.58e-4	SMART
CCP	1593	1644	1.13e0	SMART
NL	1720	1757	2.66e-6	SMART

Meta Mutation Damage Score

0.2265

Coding Region Coverage

1x: 97.4%
3x: 96.7%
10x: 94.6%
20x: 90.7%

Validation Efficiency

100% (82/82)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the pappalysin family of metzincin metalloproteinases. The encoded protein cleaves insulin-like growth factor-binding protein 5 and is thought to be a local regulator of insulin-like growth factor (IGF) bioavailability. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jul 2010]
PHENOTYPE: Mice homozygous for a null mutation are viable and fertile but display postnatal growth retardation that is more pronounced in females compared to males. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 73 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700003H04Rik	T	A	3: 124,556,860	D143V	unknown	Het
Abca8a	A	T	11: 110,071,451	N525K	probably damaging	Het
Abhd12	T	A	2: 150,848,418	D119V	probably damaging	Het
Adamts20	A	T	15: 94,286,344	M1526K	probably benign	Het
AI481877	T	G	4: 59,066,441	I768L	probably benign	Het
Ankdd1a	A	T	9: 65,504,489		probably null	Het
Ankrd1	C	T	19: 36,114,978	C283Y	possibly damaging	Het
Arfgef1	G	C	1: 10,204,890	I312M	probably benign	Het
Bhlhe22	G	A	3: 18,054,975	C63Y	probably damaging	Het
Bmp8a	A	T	4: 123,325,092		probably benign	Het
Ccdc148	A	T	2: 59,001,899	S235T	probably damaging	Het
Ccdc88b	G	A	19: 6,853,532	Q681*	probably null	Het
Cep104	T	A	4: 154,002,546	V842E	probably benign	Het
Chac2	T	C	11: 30,977,568	N117S	probably benign	Het
Cldn8	T	A	16: 88,562,858	I60F	probably benign	Het
Col16a1	G	A	4: 130,077,057		probably null	Het
Col4a1	A	G	8: 11,214,644		probably benign	Het
Cyp2a4	G	T	7: 26,312,210	E285D	probably damaging	Het
Cyp4a31	G	A	4: 115,569,731	G176D	probably benign	Het
Dmxl2	A	C	9: 54,460,949	Y246D	probably damaging	Het
Dync1h1	A	G	12: 110,614,059	K118R	probably damaging	Het
Eif3h	T	C	15: 51,865,436	T8A	possibly damaging	Het
Fam71d	G	A	12: 78,715,506		probably benign	Het
Fbxo18	G	T	2: 11,767,400	L157I	probably benign	Het
Fbxo40	C	A	16: 36,968,856	G631*	probably null	Het
Gabrb1	T	A	5: 72,121,938		probably null	Het
Galc	A	G	12: 98,234,240		probably null	Het
Gm10436	T	C	12: 88,178,448	E44G	possibly damaging	Het
H2-Q7	C	A	17: 35,439,699	S104R	probably benign	Het
Igkv13-54-1	A	T	6: 69,617,293	M31L	probably benign	Het
Lamc2	C	T	1: 153,166,187	R67Q	possibly damaging	Het
Lcn10	A	G	2: 25,685,139	D173G	probably damaging	Het
Llgl2	G	T	11: 115,851,100	R656L	probably damaging	Het
Lonrf2	G	A	1: 38,813,276	P165S	probably benign	Het
Lrrc66	G	A	5: 73,607,426	S758L	possibly damaging	Het
Ly6d	T	C	15: 74,762,766	K46E	probably damaging	Het
Map3k5	A	G	10: 20,099,560	N88D	probably damaging	Het
Mertk	A	T	2: 128,762,212	E422V	probably benign	Het
Mixl1	A	G	1: 180,694,731	V195A	probably benign	Het
Nmnat3	T	C	9: 98,399,468	V41A	probably damaging	Het
Olfr13	A	G	6: 43,174,900	R305G	probably benign	Het
Olfr398	A	T	11: 73,984,493	N38K	probably damaging	Het
Olfr854	A	G	9: 19,567,196	Y63H	possibly damaging	Het
Pcsk2	A	G	2: 143,793,269	S355G	probably damaging	Het
Pdzd2	A	G	15: 12,390,048	V821A	probably damaging	Het
Pifo	C	T	3: 106,014,596	E4K	possibly damaging	Het
Plxna4	A	C	6: 32,197,826	D1109E	probably benign	Het
Ppard	A	G	17: 28,297,110	M103V	probably benign	Het
Ralgapa1	T	C	12: 55,757,967	T515A	probably benign	Het
Rin2	A	G	2: 145,861,171	I596V	possibly damaging	Het
Rnls	A	G	19: 33,168,495	S75P	possibly damaging	Het
Rsph10b	A	T	5: 143,967,179	Y236F	possibly damaging	Het
Runx1t1	C	T	4: 13,835,628		probably benign	Het
Sardh	A	G	2: 27,235,569	V311A	possibly damaging	Het
Sbno2	G	T	10: 80,060,605	Y889*	probably null	Het
Sclt1	A	G	3: 41,727,111	V91A	probably damaging	Het
Sema4g	T	A	19: 44,999,017	V534E	probably benign	Het
Slc10a1	G	A	12: 80,953,672	S351F	probably benign	Het
Slc19a3	A	T	1: 83,022,747	V183E	probably damaging	Het
Slc25a12	A	G	2: 71,333,710	Y74H	possibly damaging	Het
Slc6a19	T	A	13: 73,692,950	I114L	probably benign	Het
Smpd2	A	T	10: 41,488,236	C189S	probably benign	Het
Spon1	T	A	7: 114,016,785	V295D	probably benign	Het
Tet3	A	G	6: 83,403,645	S514P	probably benign	Het
Tnk1	T	C	11: 69,856,928	I49M	probably damaging	Het
Trim80	A	G	11: 115,446,793	T431A	probably benign	Het
Vgf	A	T	5: 137,031,299	Q105L	possibly damaging	Het
Vmn1r37	G	T	6: 66,731,796	L135F	probably benign	Het
Vps37d	C	T	5: 135,073,740	A128T	possibly damaging	Het
Wdr60	T	A	12: 116,207,743	S958C	probably damaging	Het
Wwp1	T	C	4: 19,650,197	D323G	probably benign	Het
Zfp456	T	A	13: 67,367,363	I75L	probably benign	Het
Zfp990	A	G	4: 145,538,210	I593V	possibly damaging	Het

Other mutations in Pappa2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01097:Pappa2	APN	1	158857148	missense	probably damaging	1.00
IGL01394:Pappa2	APN	1	158765104	splice site	probably benign
IGL01570:Pappa2	APN	1	158814540	nonsense	probably null
IGL01618:Pappa2	APN	1	158857378	missense	probably damaging	1.00
IGL01717:Pappa2	APN	1	158857132	critical splice donor site	probably null
IGL01804:Pappa2	APN	1	158936519	missense	probably benign
IGL01904:Pappa2	APN	1	158783941	missense	probably damaging	0.99
IGL02116:Pappa2	APN	1	158845125	missense	probably benign	0.01
IGL02174:Pappa2	APN	1	158761618	missense	probably damaging	1.00
IGL02302:Pappa2	APN	1	158715001	missense	probably benign	0.38
IGL02422:Pappa2	APN	1	158936933	missense	probably damaging	1.00
IGL02572:Pappa2	APN	1	158851216	missense	probably benign
IGL02659:Pappa2	APN	1	158936794	missense	probably damaging	0.97
IGL02887:Pappa2	APN	1	158782259	missense	probably damaging	1.00
IGL02981:Pappa2	APN	1	158851144	missense	probably benign	0.00
IGL03128:Pappa2	APN	1	158936484	missense	probably benign	0.16
IGL03142:Pappa2	APN	1	158854931	missense	probably damaging	1.00
IGL03270:Pappa2	APN	1	158765067	missense	possibly damaging	0.78
Gulliver	UTSW	1	158857136	missense	probably null	1.00
Lilliputian	UTSW	1	158716990	missense	probably damaging	1.00
Lilliputian2	UTSW	1	158834918	nonsense	probably null
lilliputian3	UTSW	1	158782403	splice site	probably null
Pitzel	UTSW	1	158956645	missense	probably damaging	1.00
R0106:Pappa2	UTSW	1	158714977	missense	probably damaging	1.00
R0106:Pappa2	UTSW	1	158714977	missense	probably damaging	1.00
R0172:Pappa2	UTSW	1	158854849	critical splice donor site	probably null
R0194:Pappa2	UTSW	1	158765101	splice site	probably benign
R0418:Pappa2	UTSW	1	158716990	missense	probably damaging	1.00
R0421:Pappa2	UTSW	1	158848080	missense	probably damaging	1.00
R0441:Pappa2	UTSW	1	158763058	unclassified	probably benign
R0602:Pappa2	UTSW	1	158763055	unclassified	probably benign
R0630:Pappa2	UTSW	1	158832773	missense	probably benign
R0760:Pappa2	UTSW	1	158716961	critical splice donor site	probably null
R1146:Pappa2	UTSW	1	158854982	missense	probably damaging	1.00
R1146:Pappa2	UTSW	1	158854982	missense	probably damaging	1.00
R1243:Pappa2	UTSW	1	158845100	missense	probably damaging	1.00
R1413:Pappa2	UTSW	1	158936554	missense	probably benign	0.00
R1502:Pappa2	UTSW	1	158957288	missense	probably damaging	1.00
R1599:Pappa2	UTSW	1	158857172	missense	probably damaging	1.00
R1689:Pappa2	UTSW	1	158957398	missense	probably damaging	1.00
R1750:Pappa2	UTSW	1	158763150	nonsense	probably null
R1772:Pappa2	UTSW	1	158814368	missense	possibly damaging	0.92
R1905:Pappa2	UTSW	1	158803503	splice site	probably null
R1914:Pappa2	UTSW	1	158750563	missense	probably damaging	0.97
R2013:Pappa2	UTSW	1	158834928	missense	probably damaging	1.00
R2037:Pappa2	UTSW	1	158956644	nonsense	probably null
R2118:Pappa2	UTSW	1	158857266	missense	probably damaging	1.00
R2268:Pappa2	UTSW	1	158857271	missense	probably damaging	1.00
R2269:Pappa2	UTSW	1	158857271	missense	probably damaging	1.00
R2347:Pappa2	UTSW	1	158765043	missense	probably damaging	1.00
R3024:Pappa2	UTSW	1	158936225	missense	probably benign	0.00
R3706:Pappa2	UTSW	1	158834918	nonsense	probably null
R3707:Pappa2	UTSW	1	158834918	nonsense	probably null
R3708:Pappa2	UTSW	1	158834918	nonsense	probably null
R4600:Pappa2	UTSW	1	158814445	missense	probably damaging	1.00
R4737:Pappa2	UTSW	1	158957012	missense	probably benign
R4738:Pappa2	UTSW	1	158957012	missense	probably benign
R4739:Pappa2	UTSW	1	158957002	missense	probably damaging	0.99
R4739:Pappa2	UTSW	1	158957012	missense	probably benign
R4788:Pappa2	UTSW	1	158783917	missense	possibly damaging	0.86
R4798:Pappa2	UTSW	1	158857379	missense	probably damaging	0.99
R4952:Pappa2	UTSW	1	158857136	missense	probably null	1.00
R5121:Pappa2	UTSW	1	158838627	missense	probably benign	0.01
R5144:Pappa2	UTSW	1	158957133	missense	probably benign	0.03
R5159:Pappa2	UTSW	1	158761619	missense	probably damaging	1.00
R5278:Pappa2	UTSW	1	158782403	splice site	probably null
R5428:Pappa2	UTSW	1	158814785	missense	possibly damaging	0.53
R5452:Pappa2	UTSW	1	158838602	missense	probably benign	0.00
R5477:Pappa2	UTSW	1	158956738	missense	probably benign	0.00
R5504:Pappa2	UTSW	1	158848045	missense	probably benign	0.00
R5852:Pappa2	UTSW	1	158717014	missense	probably damaging	1.00
R6003:Pappa2	UTSW	1	158936250	missense	probably benign	0.23
R6129:Pappa2	UTSW	1	158714997	nonsense	probably null
R6137:Pappa2	UTSW	1	158871543	missense	probably damaging	1.00
R6374:Pappa2	UTSW	1	158956645	missense	probably damaging	1.00
R6472:Pappa2	UTSW	1	158834799	missense	probably damaging	1.00
R6804:Pappa2	UTSW	1	158936868	missense	probably benign	0.24
R7020:Pappa2	UTSW	1	158848009	missense	probably damaging	0.98
R7051:Pappa2	UTSW	1	158957183	missense	unknown
R7082:Pappa2	UTSW	1	158763119	missense	possibly damaging	0.65
R7111:Pappa2	UTSW	1	158956526	missense	probably benign	0.38
R7213:Pappa2	UTSW	1	158936886	missense	possibly damaging	0.93
R7575:Pappa2	UTSW	1	158814530	missense	probably damaging	1.00
R7587:Pappa2	UTSW	1	158851131	missense	probably damaging	1.00
R7826:Pappa2	UTSW	1	158936440	nonsense	probably null
R8007:Pappa2	UTSW	1	158782304	missense	probably damaging	0.99
R8050:Pappa2	UTSW	1	158848400	missense	probably damaging	1.00
R8063:Pappa2	UTSW	1	158936556	missense	possibly damaging	0.79
R8068:Pappa2	UTSW	1	158935985	missense	possibly damaging	0.87
X0058:Pappa2	UTSW	1	158814397	missense	probably null
X0061:Pappa2	UTSW	1	158936618	missense	possibly damaging	0.87
Z1176:Pappa2	UTSW	1	158814814	missense	probably damaging	1.00
Z1176:Pappa2	UTSW	1	158814816	missense	probably damaging	1.00
Z1176:Pappa2	UTSW	1	158956933	missense	probably benign

Predicted Primers

PCR Primer
(F):5'- ACATTGGGCTTGTGGTGATACC -3'
(R):5'- GTTTGGTGTTTGCCGAAGATATAAC -3'

Sequencing Primer
(F):5'- TGATACCTGTGTAGCTCATGTAG -3'
(R):5'- ATAACTAAGGGTAGCTGCTGTTC -3'

Posted On

2014-06-23