Incidental Mutation 'R1832:Slc25a12'
ID204839
Institutional Source Beutler Lab
Gene Symbol Slc25a12
Ensembl Gene ENSMUSG00000027010
Gene Namesolute carrier family 25 (mitochondrial carrier, Aralar), member 12
Synonyms
MMRRC Submission 039859-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.224) question?
Stock #R1832 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location71271063-71367749 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 71333710 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Histidine at position 74 (Y74H)
Ref Sequence ENSEMBL: ENSMUSP00000122103 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000151937] [ENSMUST00000184169]
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126493
Predicted Effect noncoding transcript
Transcript: ENSMUST00000137916
Predicted Effect possibly damaging
Transcript: ENSMUST00000151937
AA Change: Y74H

PolyPhen 2 Score 0.846 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000122103
Gene: ENSMUSG00000027010
AA Change: Y74H

DomainStartEndE-ValueType
EFh 56 84 1.83e1 SMART
EFh 90 118 5.8e-1 SMART
EFh 161 189 2.49e0 SMART
Pfam:Mito_carr 324 421 3e-27 PFAM
Pfam:Mito_carr 422 513 2.9e-18 PFAM
Pfam:Mito_carr 515 609 2.1e-27 PFAM
low complexity region 662 677 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000184169
SMART Domains Protein: ENSMUSP00000139371
Gene: ENSMUSG00000027010

DomainStartEndE-ValueType
SCOP:d1irja_ 3 71 5e-5 SMART
Meta Mutation Damage Score 0.5142 question?
Coding Region Coverage
  • 1x: 97.4%
  • 3x: 96.7%
  • 10x: 94.6%
  • 20x: 90.7%
Validation Efficiency 100% (82/82)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a calcium-binding mitochondrial carrier protein. The encoded protein localizes to the mitochondria and is involved in the exchange of aspartate for glutamate across the inner mitochondrial membrane. Polymorphisms in this gene may be associated with autism, and mutations in this gene may also be a cause of global cerebral hypomyelination. Alternatively spliced transcript variants have been observed for this gene. [provided by RefSeq, Apr 2012]
PHENOTYPE: Mice homozygous for a null allele show severe growth defects, generalized tremors, postnatal lethality, impaired motor coordination, and CNS dysmyelination associated with decreased synthesis of myelin lipids and a striking reduction in brain aspartate and N-acetylaspartate levels. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 73 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700003H04Rik T A 3: 124,556,860 D143V unknown Het
Abca8a A T 11: 110,071,451 N525K probably damaging Het
Abhd12 T A 2: 150,848,418 D119V probably damaging Het
Adamts20 A T 15: 94,286,344 M1526K probably benign Het
AI481877 T G 4: 59,066,441 I768L probably benign Het
Ankdd1a A T 9: 65,504,489 probably null Het
Ankrd1 C T 19: 36,114,978 C283Y possibly damaging Het
Arfgef1 G C 1: 10,204,890 I312M probably benign Het
Bhlhe22 G A 3: 18,054,975 C63Y probably damaging Het
Bmp8a A T 4: 123,325,092 probably benign Het
Ccdc148 A T 2: 59,001,899 S235T probably damaging Het
Ccdc88b G A 19: 6,853,532 Q681* probably null Het
Cep104 T A 4: 154,002,546 V842E probably benign Het
Chac2 T C 11: 30,977,568 N117S probably benign Het
Cldn8 T A 16: 88,562,858 I60F probably benign Het
Col16a1 G A 4: 130,077,057 probably null Het
Col4a1 A G 8: 11,214,644 probably benign Het
Cyp2a4 G T 7: 26,312,210 E285D probably damaging Het
Cyp4a31 G A 4: 115,569,731 G176D probably benign Het
Dmxl2 A C 9: 54,460,949 Y246D probably damaging Het
Dync1h1 A G 12: 110,614,059 K118R probably damaging Het
Eif3h T C 15: 51,865,436 T8A possibly damaging Het
Fam71d G A 12: 78,715,506 probably benign Het
Fbxo18 G T 2: 11,767,400 L157I probably benign Het
Fbxo40 C A 16: 36,968,856 G631* probably null Het
Gabrb1 T A 5: 72,121,938 probably null Het
Galc A G 12: 98,234,240 probably null Het
Gm10436 T C 12: 88,178,448 E44G possibly damaging Het
H2-Q7 C A 17: 35,439,699 S104R probably benign Het
Igkv13-54-1 A T 6: 69,617,293 M31L probably benign Het
Lamc2 C T 1: 153,166,187 R67Q possibly damaging Het
Lcn10 A G 2: 25,685,139 D173G probably damaging Het
Llgl2 G T 11: 115,851,100 R656L probably damaging Het
Lonrf2 G A 1: 38,813,276 P165S probably benign Het
Lrrc66 G A 5: 73,607,426 S758L possibly damaging Het
Ly6d T C 15: 74,762,766 K46E probably damaging Het
Map3k5 A G 10: 20,099,560 N88D probably damaging Het
Mertk A T 2: 128,762,212 E422V probably benign Het
Mixl1 A G 1: 180,694,731 V195A probably benign Het
Nmnat3 T C 9: 98,399,468 V41A probably damaging Het
Olfr13 A G 6: 43,174,900 R305G probably benign Het
Olfr398 A T 11: 73,984,493 N38K probably damaging Het
Olfr854 A G 9: 19,567,196 Y63H possibly damaging Het
Pappa2 T A 1: 158,857,316 E751V probably damaging Het
Pcsk2 A G 2: 143,793,269 S355G probably damaging Het
Pdzd2 A G 15: 12,390,048 V821A probably damaging Het
Pifo C T 3: 106,014,596 E4K possibly damaging Het
Plxna4 A C 6: 32,197,826 D1109E probably benign Het
Ppard A G 17: 28,297,110 M103V probably benign Het
Ralgapa1 T C 12: 55,757,967 T515A probably benign Het
Rin2 A G 2: 145,861,171 I596V possibly damaging Het
Rnls A G 19: 33,168,495 S75P possibly damaging Het
Rsph10b A T 5: 143,967,179 Y236F possibly damaging Het
Runx1t1 C T 4: 13,835,628 probably benign Het
Sardh A G 2: 27,235,569 V311A possibly damaging Het
Sbno2 G T 10: 80,060,605 Y889* probably null Het
Sclt1 A G 3: 41,727,111 V91A probably damaging Het
Sema4g T A 19: 44,999,017 V534E probably benign Het
Slc10a1 G A 12: 80,953,672 S351F probably benign Het
Slc19a3 A T 1: 83,022,747 V183E probably damaging Het
Slc6a19 T A 13: 73,692,950 I114L probably benign Het
Smpd2 A T 10: 41,488,236 C189S probably benign Het
Spon1 T A 7: 114,016,785 V295D probably benign Het
Tet3 A G 6: 83,403,645 S514P probably benign Het
Tnk1 T C 11: 69,856,928 I49M probably damaging Het
Trim80 A G 11: 115,446,793 T431A probably benign Het
Vgf A T 5: 137,031,299 Q105L possibly damaging Het
Vmn1r37 G T 6: 66,731,796 L135F probably benign Het
Vps37d C T 5: 135,073,740 A128T possibly damaging Het
Wdr60 T A 12: 116,207,743 S958C probably damaging Het
Wwp1 T C 4: 19,650,197 D323G probably benign Het
Zfp456 T A 13: 67,367,363 I75L probably benign Het
Zfp990 A G 4: 145,538,210 I593V possibly damaging Het
Other mutations in Slc25a12
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00886:Slc25a12 APN 2 71344032 missense possibly damaging 0.63
IGL01116:Slc25a12 APN 2 71293352 splice site probably benign
IGL01375:Slc25a12 APN 2 71308050 splice site probably benign
IGL02631:Slc25a12 APN 2 71296742 missense possibly damaging 0.90
IGL02899:Slc25a12 APN 2 71279635 missense probably damaging 1.00
R0031:Slc25a12 UTSW 2 71333614 missense possibly damaging 0.93
R0689:Slc25a12 UTSW 2 71311493 missense possibly damaging 0.95
R1148:Slc25a12 UTSW 2 71312568 splice site probably benign
R1148:Slc25a12 UTSW 2 71312568 splice site probably benign
R2044:Slc25a12 UTSW 2 71312548 missense probably benign 0.00
R4537:Slc25a12 UTSW 2 71275106 utr 3 prime probably benign
R4668:Slc25a12 UTSW 2 71315062 missense probably benign 0.22
R4830:Slc25a12 UTSW 2 71296805 missense probably damaging 1.00
R5476:Slc25a12 UTSW 2 71275322 missense probably benign
R5698:Slc25a12 UTSW 2 71282573 missense probably damaging 1.00
R6074:Slc25a12 UTSW 2 71276454 missense probably benign 0.01
R6516:Slc25a12 UTSW 2 71324083 missense probably damaging 0.97
R7270:Slc25a12 UTSW 2 71324025 missense probably benign
R7794:Slc25a12 UTSW 2 71311508 missense probably damaging 1.00
R8022:Slc25a12 UTSW 2 71275189 missense unknown
Z1176:Slc25a12 UTSW 2 71296746 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- TCTGGGAGTGAAGAACTGGACC -3'
(R):5'- CAGTCCTCTACTAGCCTGTAAC -3'

Sequencing Primer
(F):5'- CCAGCACTGGGAACTTTACTTATTAC -3'
(R):5'- ACTTTATTTGTGTGTGTGTGAGAGAG -3'
Posted On2014-06-23