Incidental Mutation 'R0112:Fn1'
ID20484
Institutional Source Beutler Lab
Gene Symbol Fn1
Ensembl Gene ENSMUSG00000026193
Gene Namefibronectin 1
SynonymsFn-1, Fn
MMRRC Submission 038398-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R0112 (G1)
Quality Score225
Status Validated (trace)
Chromosome1
Chromosomal Location71585520-71653200 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 71609653 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 1366 (S1366P)
Ref Sequence ENSEMBL: ENSMUSP00000140816 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000055226] [ENSMUST00000186129] [ENSMUST00000187938] [ENSMUST00000188674] [ENSMUST00000188894] [ENSMUST00000189821] [ENSMUST00000190780]
Predicted Effect probably damaging
Transcript: ENSMUST00000055226
AA Change: S1457P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000054499
Gene: ENSMUSG00000026193
AA Change: S1457P

DomainStartEndE-ValueType
low complexity region 2 19 N/A INTRINSIC
FN1 53 93 6.38e-18 SMART
FN1 98 141 6.04e-19 SMART
FN1 142 185 6.94e-19 SMART
FN1 187 231 3.47e-19 SMART
FN1 232 276 6.04e-19 SMART
FN1 308 347 5.91e-13 SMART
FN2 353 401 6.66e-30 SMART
FN2 413 461 5.05e-30 SMART
FN1 470 513 2.59e-18 SMART
FN1 518 560 1.68e-17 SMART
FN1 561 604 5.69e-15 SMART
FN3 609 688 3.79e-2 SMART
FN3 719 798 1.27e-3 SMART
FN3 810 888 7.92e-14 SMART
FN3 906 985 4.28e-10 SMART
FN3 996 1074 2.53e-12 SMART
FN3 1086 1160 1.31e-5 SMART
FN3 1173 1255 1.13e-9 SMART
FN3 1264 1346 4.22e-9 SMART
FN3 1357 1437 9.6e-13 SMART
FN3 1448 1527 1.82e-13 SMART
FN3 1538 1617 6.69e-12 SMART
FN3 1632 1711 2.72e-12 SMART
FN3 1722 1801 8.9e-8 SMART
FN3 1812 1891 1.66e-7 SMART
FN3 1904 1983 4.92e-10 SMART
FN3 1993 2074 3.64e-13 SMART
low complexity region 2148 2165 N/A INTRINSIC
FN3 2193 2272 2.9e0 SMART
FN1 2296 2340 3.72e-19 SMART
FN1 2341 2383 2.49e-20 SMART
FN1 2385 2425 2.69e-16 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000185408
Predicted Effect probably damaging
Transcript: ENSMUST00000186129
AA Change: S1366P

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000141123
Gene: ENSMUSG00000026193
AA Change: S1366P

DomainStartEndE-ValueType
low complexity region 2 19 N/A INTRINSIC
FN1 53 93 6.38e-18 SMART
FN1 98 141 6.04e-19 SMART
FN1 142 185 6.94e-19 SMART
FN1 187 231 3.47e-19 SMART
FN1 232 276 6.04e-19 SMART
FN1 308 347 5.91e-13 SMART
FN2 353 401 6.66e-30 SMART
FN2 413 461 5.05e-30 SMART
FN1 470 513 2.59e-18 SMART
FN1 518 560 1.68e-17 SMART
FN1 561 604 5.69e-15 SMART
FN3 609 688 3.79e-2 SMART
FN3 719 798 1.27e-3 SMART
FN3 810 888 7.92e-14 SMART
FN3 906 985 4.28e-10 SMART
FN3 996 1074 2.53e-12 SMART
FN3 1086 1160 1.31e-5 SMART
FN3 1173 1255 1.13e-9 SMART
FN3 1266 1346 9.6e-13 SMART
FN3 1357 1436 1.82e-13 SMART
FN3 1447 1526 6.69e-12 SMART
FN3 1541 1620 2.72e-12 SMART
FN3 1631 1710 1.66e-7 SMART
FN3 1723 1802 4.92e-10 SMART
FN3 1812 1893 3.64e-13 SMART
low complexity region 1967 1984 N/A INTRINSIC
FN3 2012 2091 2.9e0 SMART
FN1 2115 2159 3.72e-19 SMART
FN1 2160 2202 2.49e-20 SMART
FN1 2204 2244 2.69e-16 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000187938
AA Change: S1366P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000140975
Gene: ENSMUSG00000026193
AA Change: S1366P

DomainStartEndE-ValueType
low complexity region 2 19 N/A INTRINSIC
FN1 53 93 6.38e-18 SMART
FN1 98 141 6.04e-19 SMART
FN1 142 185 6.94e-19 SMART
FN1 187 231 3.47e-19 SMART
FN1 232 276 6.04e-19 SMART
FN1 308 347 5.91e-13 SMART
FN2 353 401 6.66e-30 SMART
FN2 413 461 5.05e-30 SMART
FN1 470 513 2.59e-18 SMART
FN1 518 560 1.68e-17 SMART
FN1 561 604 5.69e-15 SMART
FN3 609 688 3.79e-2 SMART
FN3 719 798 1.27e-3 SMART
FN3 810 888 7.92e-14 SMART
FN3 906 985 4.28e-10 SMART
FN3 996 1074 2.53e-12 SMART
FN3 1086 1160 1.31e-5 SMART
FN3 1173 1255 1.13e-9 SMART
FN3 1266 1346 9.6e-13 SMART
FN3 1357 1436 1.82e-13 SMART
FN3 1447 1526 6.69e-12 SMART
FN3 1541 1620 2.72e-12 SMART
FN3 1631 1710 8.9e-8 SMART
FN3 1721 1800 1.66e-7 SMART
FN3 1813 1892 4.92e-10 SMART
FN3 1902 1983 3.64e-13 SMART
low complexity region 2032 2049 N/A INTRINSIC
FN3 2077 2156 2.9e0 SMART
FN1 2180 2224 3.72e-19 SMART
FN1 2225 2267 2.49e-20 SMART
FN1 2269 2309 2.69e-16 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000188674
AA Change: S1366P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000140907
Gene: ENSMUSG00000026193
AA Change: S1366P

DomainStartEndE-ValueType
low complexity region 2 19 N/A INTRINSIC
FN1 53 93 6.38e-18 SMART
FN1 98 141 6.04e-19 SMART
FN1 142 185 6.94e-19 SMART
FN1 187 231 3.47e-19 SMART
FN1 232 276 6.04e-19 SMART
FN1 308 347 5.91e-13 SMART
FN2 353 401 6.66e-30 SMART
FN2 413 461 5.05e-30 SMART
FN1 470 513 2.59e-18 SMART
FN1 518 560 1.68e-17 SMART
FN1 561 604 5.69e-15 SMART
FN3 609 688 3.79e-2 SMART
FN3 719 798 1.27e-3 SMART
FN3 810 888 7.92e-14 SMART
FN3 906 985 4.28e-10 SMART
FN3 996 1074 2.53e-12 SMART
FN3 1086 1160 1.31e-5 SMART
FN3 1173 1255 1.13e-9 SMART
FN3 1266 1346 9.6e-13 SMART
FN3 1357 1436 1.82e-13 SMART
FN3 1447 1526 6.69e-12 SMART
FN3 1541 1620 2.72e-12 SMART
FN3 1631 1710 8.9e-8 SMART
FN3 1721 1800 1.66e-7 SMART
FN3 1813 1892 4.92e-10 SMART
FN3 1902 1981 6.79e-13 SMART
FN3 1983 2061 1.01e1 SMART
FN1 2085 2129 3.72e-19 SMART
FN1 2130 2172 2.49e-20 SMART
FN1 2174 2214 2.69e-16 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000188894
AA Change: S1366P

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000140471
Gene: ENSMUSG00000026193
AA Change: S1366P

DomainStartEndE-ValueType
low complexity region 2 19 N/A INTRINSIC
FN1 53 93 6.38e-18 SMART
FN1 98 141 6.04e-19 SMART
FN1 142 185 6.94e-19 SMART
FN1 187 231 3.47e-19 SMART
FN1 232 276 6.04e-19 SMART
FN1 308 347 5.91e-13 SMART
FN2 353 401 6.66e-30 SMART
FN2 413 461 5.05e-30 SMART
FN1 470 513 2.59e-18 SMART
FN1 518 560 1.68e-17 SMART
FN1 561 604 5.69e-15 SMART
FN3 609 688 3.79e-2 SMART
FN3 719 798 1.27e-3 SMART
FN3 810 888 7.92e-14 SMART
FN3 906 985 4.28e-10 SMART
FN3 996 1074 2.53e-12 SMART
FN3 1086 1160 1.31e-5 SMART
FN3 1173 1255 1.13e-9 SMART
FN3 1266 1346 9.6e-13 SMART
FN3 1357 1436 1.82e-13 SMART
FN3 1447 1526 6.69e-12 SMART
FN3 1541 1620 2.72e-12 SMART
FN3 1631 1710 8.9e-8 SMART
FN3 1721 1800 1.66e-7 SMART
FN3 1813 1892 4.92e-10 SMART
FN3 1902 1983 3.64e-13 SMART
low complexity region 2057 2074 N/A INTRINSIC
FN3 2102 2181 2.9e0 SMART
FN1 2205 2249 3.72e-19 SMART
FN1 2250 2292 2.49e-20 SMART
FN1 2294 2334 2.69e-16 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000189160
Predicted Effect probably damaging
Transcript: ENSMUST00000189821
AA Change: S1366P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000139702
Gene: ENSMUSG00000026193
AA Change: S1366P

DomainStartEndE-ValueType
low complexity region 2 19 N/A INTRINSIC
FN1 53 93 6.38e-18 SMART
FN1 98 141 6.04e-19 SMART
FN1 142 185 6.94e-19 SMART
FN1 187 231 3.47e-19 SMART
FN1 232 276 6.04e-19 SMART
FN1 308 347 5.91e-13 SMART
FN2 353 401 6.66e-30 SMART
FN2 413 461 5.05e-30 SMART
FN1 470 513 2.59e-18 SMART
FN1 518 560 1.68e-17 SMART
FN1 561 604 5.69e-15 SMART
FN3 609 688 3.79e-2 SMART
FN3 719 798 1.27e-3 SMART
FN3 810 888 7.92e-14 SMART
FN3 906 985 4.28e-10 SMART
FN3 996 1074 2.53e-12 SMART
FN3 1086 1160 1.31e-5 SMART
FN3 1173 1255 1.13e-9 SMART
FN3 1266 1346 9.6e-13 SMART
FN3 1357 1436 1.82e-13 SMART
FN3 1447 1526 6.69e-12 SMART
FN3 1541 1620 2.72e-12 SMART
FN3 1631 1710 1.66e-7 SMART
FN3 1723 1802 4.92e-10 SMART
FN3 1812 1891 6.79e-13 SMART
FN3 1893 1971 1.01e1 SMART
FN1 1995 2039 3.72e-19 SMART
FN1 2040 2082 2.49e-20 SMART
FN1 2084 2124 2.69e-16 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000190780
AA Change: S1366P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000140816
Gene: ENSMUSG00000026193
AA Change: S1366P

DomainStartEndE-ValueType
low complexity region 2 19 N/A INTRINSIC
FN1 53 93 6.38e-18 SMART
FN1 98 141 6.04e-19 SMART
FN1 142 185 6.94e-19 SMART
FN1 187 231 3.47e-19 SMART
FN1 232 276 6.04e-19 SMART
FN1 308 347 5.91e-13 SMART
FN2 353 401 6.66e-30 SMART
FN2 413 461 5.05e-30 SMART
FN1 470 513 2.59e-18 SMART
FN1 518 560 1.68e-17 SMART
FN1 561 604 5.69e-15 SMART
FN3 609 688 3.79e-2 SMART
FN3 719 798 1.27e-3 SMART
FN3 810 888 7.92e-14 SMART
FN3 906 985 4.28e-10 SMART
FN3 996 1074 2.53e-12 SMART
FN3 1086 1160 1.31e-5 SMART
FN3 1173 1255 1.13e-9 SMART
FN3 1266 1346 9.6e-13 SMART
FN3 1357 1436 1.82e-13 SMART
FN3 1447 1526 6.69e-12 SMART
FN3 1541 1620 2.72e-12 SMART
FN3 1631 1710 1.66e-7 SMART
FN3 1723 1802 4.92e-10 SMART
FN3 1812 1893 3.64e-13 SMART
low complexity region 1942 1959 N/A INTRINSIC
FN3 1987 2066 2.9e0 SMART
FN1 2090 2134 3.72e-19 SMART
FN1 2135 2177 2.49e-20 SMART
FN1 2179 2219 2.69e-16 SMART
Meta Mutation Damage Score 0.9478 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.1%
  • 10x: 96.0%
  • 20x: 91.8%
Validation Efficiency 100% (86/86)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes fibronectin, a glycoprotein present in a soluble dimeric form in plasma, and in a dimeric or multimeric form at the cell surface and in extracellular matrix. The encoded preproprotein is proteolytically processed to generate the mature protein. Fibronectin is involved in cell adhesion and migration processes including embryogenesis, wound healing, blood coagulation, host defense, and metastasis. The gene has three regions subject to alternative splicing, with the potential to produce 20 different transcript variants, at least one of which encodes an isoform that undergoes proteolytic processing. The full-length nature of some variants has not been determined. [provided by RefSeq, Jan 2016]
PHENOTYPE: Mutants are defective in mesodermal function. Null mutants are embryonic lethal with major patterning and organizational defects. Conditional mutants live and show increased neuronal apoptosis and susceptibility to induced cerebral ischemia. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 81 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930568D16Rik T A 2: 35,354,803 Y179F probably benign Het
Abcd4 A G 12: 84,612,899 probably benign Het
Abhd12b C T 12: 70,181,017 T191M probably benign Het
Adcy5 A G 16: 35,156,178 E27G possibly damaging Het
Adgb G A 10: 10,407,158 probably benign Het
Afdn T C 17: 13,884,637 S1186P probably damaging Het
Atf6b G T 17: 34,651,626 R351L probably damaging Het
Axin2 T C 11: 108,939,397 S348P possibly damaging Het
BC030499 T C 11: 78,291,681 probably benign Het
Bfsp1 A C 2: 143,827,643 probably null Het
Brd1 A G 15: 88,730,383 V103A probably benign Het
Ccdc13 C A 9: 121,813,481 K392N probably damaging Het
Ccdc18 A G 5: 108,173,761 K577R probably damaging Het
Csmd2 G T 4: 128,496,029 G2186C probably damaging Het
Cyp2j5 A T 4: 96,629,523 M484K probably benign Het
Defb3 T A 8: 19,293,407 L12Q probably null Het
Defb7 G T 8: 19,495,170 probably null Het
Dhx35 T A 2: 158,840,620 M491K probably damaging Het
Dnah17 T C 11: 118,074,434 S2261G possibly damaging Het
Dnah5 A C 15: 28,263,679 E853D probably benign Het
Dner C A 1: 84,583,053 A23S probably benign Het
Dock5 A C 14: 67,819,641 S539A probably benign Het
Dsg2 T A 18: 20,583,042 F317I probably benign Het
Enox1 A T 14: 77,699,198 I539F possibly damaging Het
Eogt G A 6: 97,135,284 probably benign Het
Fbxo22 A G 9: 55,223,346 T300A probably benign Het
Fes T C 7: 80,384,005 D166G probably damaging Het
Fndc3a A T 14: 72,540,495 probably benign Het
Foxh1 T C 15: 76,669,010 H168R probably benign Het
Galnt14 T G 17: 73,574,984 probably benign Het
Gdf6 A G 4: 9,844,482 D2G probably damaging Het
Gp6 C A 7: 4,370,184 A247S probably benign Het
Gp6 G C 7: 4,371,627 P232A probably benign Het
Grin2c A G 11: 115,251,134 Y820H probably damaging Het
Gtf2h4 T C 17: 35,670,448 T198A possibly damaging Het
Helz T C 11: 107,672,948 probably benign Het
Htr1d A G 4: 136,443,000 E180G probably benign Het
Igsf10 A G 3: 59,326,008 V1768A probably benign Het
Ints10 A T 8: 68,827,302 T694S probably damaging Het
Krt81 C A 15: 101,463,627 R24L possibly damaging Het
Lipc T A 9: 70,820,427 Y131F probably damaging Het
Litaf G T 16: 10,966,511 T45K probably damaging Het
Lmo7 A T 14: 101,887,193 R363* probably null Het
Lrrc37a A T 11: 103,500,913 Y1229N probably benign Het
Man2a2 C T 7: 80,358,276 A943T probably damaging Het
Mtor A G 4: 148,480,923 Y1030C probably damaging Het
Naalad2 G T 9: 18,351,447 Y384* probably null Het
Nat2 C T 8: 67,501,726 Q163* probably null Het
Nell2 A G 15: 95,431,681 probably benign Het
Nphp3 C T 9: 104,037,348 H102Y possibly damaging Het
Olfr1383 A T 11: 49,524,134 H137L possibly damaging Het
Olfr1442 C T 19: 12,674,757 T184I probably benign Het
Olfr686 A T 7: 105,203,659 M228K probably benign Het
Olr1 T C 6: 129,488,906 S46G possibly damaging Het
Parg C A 14: 32,202,433 A63E probably damaging Het
Pik3cg A G 12: 32,195,715 probably benign Het
Ripk4 A G 16: 97,743,561 C629R probably benign Het
Rnf145 A G 11: 44,564,151 T620A probably benign Het
Samd9l T G 6: 3,376,031 D410A possibly damaging Het
Serpinb9f A T 13: 33,327,951 probably benign Het
Slc19a1 T C 10: 77,042,165 I178T probably benign Het
Slco1b2 A T 6: 141,671,111 Y390F probably benign Het
Speg A G 1: 75,385,032 E230G possibly damaging Het
Tbc1d9 C A 8: 83,264,837 probably benign Het
Tmem131l G A 3: 83,940,587 Q324* probably null Het
Trf A G 9: 103,226,956 probably benign Het
Trp53 T G 11: 69,588,679 Y202D probably damaging Het
Trpv1 T A 11: 73,253,272 M618K probably damaging Het
Trrap C A 5: 144,822,761 Y2250* probably null Het
Ttc3 A G 16: 94,385,322 probably benign Het
Ubtfl1 T G 9: 18,409,787 S204A probably benign Het
Uck2 A T 1: 167,227,771 Y203N probably damaging Het
Utrn A T 10: 12,686,465 L1280* probably null Het
Vmn1r178 A T 7: 23,894,184 H146L possibly damaging Het
Vmn2r100 C A 17: 19,522,120 P252Q possibly damaging Het
Vmn2r108 T C 17: 20,471,635 M209V probably benign Het
Vmn2r9 G A 5: 108,843,125 T790I probably damaging Het
Vmn2r94 C A 17: 18,243,604 R808L probably benign Het
Zbtb7c A T 18: 76,136,891 S17C probably damaging Het
Zfp811 C T 17: 32,797,764 R434Q probably damaging Het
Zkscan6 A T 11: 65,814,863 probably benign Het
Other mutations in Fn1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00236:Fn1 APN 1 71652873 missense probably benign 0.28
IGL00402:Fn1 APN 1 71641163 missense probably damaging 1.00
IGL00946:Fn1 APN 1 71645540 splice site probably benign
IGL01311:Fn1 APN 1 71628140 missense probably damaging 1.00
IGL01338:Fn1 APN 1 71626210 missense probably damaging 0.98
IGL01353:Fn1 APN 1 71586939 missense probably damaging 1.00
IGL01674:Fn1 APN 1 71606741 missense probably damaging 1.00
IGL01701:Fn1 APN 1 71629853 splice site probably benign
IGL01734:Fn1 APN 1 71619485 missense probably damaging 1.00
IGL01788:Fn1 APN 1 71613837 missense probably damaging 1.00
IGL02186:Fn1 APN 1 71638534 missense probably damaging 1.00
IGL02398:Fn1 APN 1 71618670 splice site probably null
IGL02425:Fn1 APN 1 71641143 splice site probably benign
IGL02516:Fn1 APN 1 71637323 missense possibly damaging 0.78
IGL02593:Fn1 APN 1 71602432 missense probably benign
IGL02651:Fn1 APN 1 71597676 missense possibly damaging 0.65
IGL02681:Fn1 APN 1 71619482 missense probably damaging 1.00
IGL02890:Fn1 APN 1 71598372 critical splice donor site probably null
IGL02929:Fn1 APN 1 71595662 critical splice donor site probably null
IGL03036:Fn1 APN 1 71629773 missense probably damaging 1.00
IGL03088:Fn1 APN 1 71614038 splice site probably null
IGL03142:Fn1 APN 1 71637296 missense probably damaging 1.00
IGL03172:Fn1 APN 1 71641262 missense probably damaging 0.99
IGL03184:Fn1 APN 1 71609497 missense probably benign 0.02
IGL03212:Fn1 APN 1 71641325 nonsense probably null
IGL03246:Fn1 APN 1 71624296 missense possibly damaging 0.89
IGL03367:Fn1 APN 1 71597553 missense probably benign 0.27
PIT4514001:Fn1 UTSW 1 71628456 missense probably benign 0.01
R0008:Fn1 UTSW 1 71595720 missense probably damaging 0.98
R0138:Fn1 UTSW 1 71624110 missense possibly damaging 0.82
R0383:Fn1 UTSW 1 71597685 missense probably damaging 0.99
R0386:Fn1 UTSW 1 71595786 missense probably damaging 1.00
R0648:Fn1 UTSW 1 71597585 missense possibly damaging 0.79
R0684:Fn1 UTSW 1 71595809 splice site probably null
R1054:Fn1 UTSW 1 71586214 makesense probably null
R1183:Fn1 UTSW 1 71586245 missense probably damaging 0.98
R1405:Fn1 UTSW 1 71642078 missense probably damaging 1.00
R1405:Fn1 UTSW 1 71642078 missense probably damaging 1.00
R1414:Fn1 UTSW 1 71601303 splice site probably benign
R1677:Fn1 UTSW 1 71597655 missense probably benign 0.00
R1773:Fn1 UTSW 1 71637383 missense probably damaging 1.00
R1830:Fn1 UTSW 1 71624259 missense probably damaging 1.00
R1987:Fn1 UTSW 1 71651625 missense probably damaging 1.00
R1989:Fn1 UTSW 1 71651625 missense probably damaging 1.00
R2068:Fn1 UTSW 1 71600439 missense probably damaging 1.00
R2113:Fn1 UTSW 1 71626164 missense probably damaging 1.00
R2145:Fn1 UTSW 1 71606004 missense probably damaging 1.00
R2246:Fn1 UTSW 1 71628535 missense probably benign 0.10
R2273:Fn1 UTSW 1 71613943 missense probably null 1.00
R2274:Fn1 UTSW 1 71613943 missense probably null 1.00
R2275:Fn1 UTSW 1 71613943 missense probably null 1.00
R2303:Fn1 UTSW 1 71614036 critical splice acceptor site probably null
R2379:Fn1 UTSW 1 71649284 nonsense probably null
R2382:Fn1 UTSW 1 71648119 missense probably damaging 1.00
R2567:Fn1 UTSW 1 71597736 nonsense probably null
R2864:Fn1 UTSW 1 71602419 missense probably damaging 0.99
R3154:Fn1 UTSW 1 71593083 missense probably damaging 1.00
R3837:Fn1 UTSW 1 71653155 utr 5 prime probably null
R3844:Fn1 UTSW 1 71609574 missense possibly damaging 0.61
R3886:Fn1 UTSW 1 71640306 missense probably damaging 1.00
R3887:Fn1 UTSW 1 71640306 missense probably damaging 1.00
R3888:Fn1 UTSW 1 71640306 missense probably damaging 1.00
R3889:Fn1 UTSW 1 71640306 missense probably damaging 1.00
R3905:Fn1 UTSW 1 71607913 missense probably damaging 1.00
R3906:Fn1 UTSW 1 71607913 missense probably damaging 1.00
R3907:Fn1 UTSW 1 71607913 missense probably damaging 1.00
R3909:Fn1 UTSW 1 71607913 missense probably damaging 1.00
R4611:Fn1 UTSW 1 71624178 nonsense probably null
R4724:Fn1 UTSW 1 71648148 critical splice acceptor site probably null
R4732:Fn1 UTSW 1 71602512 splice site probably null
R4733:Fn1 UTSW 1 71602512 splice site probably null
R4756:Fn1 UTSW 1 71590808 missense probably damaging 1.00
R4809:Fn1 UTSW 1 71652800 intron probably benign
R4839:Fn1 UTSW 1 71642083 missense probably damaging 1.00
R4915:Fn1 UTSW 1 71595809 splice site probably null
R4917:Fn1 UTSW 1 71595809 splice site probably null
R4918:Fn1 UTSW 1 71595809 splice site probably null
R5002:Fn1 UTSW 1 71629728 missense possibly damaging 0.48
R5015:Fn1 UTSW 1 71626177 missense probably damaging 0.98
R5022:Fn1 UTSW 1 71624179 missense probably damaging 1.00
R5109:Fn1 UTSW 1 71649235 missense probably damaging 1.00
R5267:Fn1 UTSW 1 71629704 missense probably damaging 1.00
R5323:Fn1 UTSW 1 71597432 missense probably benign 0.09
R5333:Fn1 UTSW 1 71624180 missense probably damaging 1.00
R5631:Fn1 UTSW 1 71590196 missense probably damaging 1.00
R5644:Fn1 UTSW 1 71627250 missense probably damaging 1.00
R5754:Fn1 UTSW 1 71600322 missense probably damaging 1.00
R5807:Fn1 UTSW 1 71648059 missense probably damaging 1.00
R6053:Fn1 UTSW 1 71599290 missense probably damaging 1.00
R6133:Fn1 UTSW 1 71597727 missense probably damaging 1.00
R6186:Fn1 UTSW 1 71637290 missense probably damaging 1.00
R6270:Fn1 UTSW 1 71637275 missense probably damaging 1.00
R6332:Fn1 UTSW 1 71628071 missense probably benign 0.01
R6431:Fn1 UTSW 1 71647844 intron probably null
R6571:Fn1 UTSW 1 71626190 missense probably damaging 1.00
R6596:Fn1 UTSW 1 71609482 missense probably damaging 1.00
R6862:Fn1 UTSW 1 71613907 missense probably benign 0.43
R6898:Fn1 UTSW 1 71600413 missense probably damaging 1.00
R6984:Fn1 UTSW 1 71626079 missense probably damaging 1.00
R7107:Fn1 UTSW 1 71627249 missense probably damaging 1.00
R7121:Fn1 UTSW 1 71600538 intron probably benign
R7127:Fn1 UTSW 1 71597544 missense probably benign 0.16
R7194:Fn1 UTSW 1 71602323 missense probably damaging 1.00
R7274:Fn1 UTSW 1 71628113 missense probably benign
R7285:Fn1 UTSW 1 71637339 missense probably damaging 1.00
R7426:Fn1 UTSW 1 71649225 missense probably damaging 1.00
R7453:Fn1 UTSW 1 71590880 missense probably damaging 1.00
R7508:Fn1 UTSW 1 71597516 missense probably benign 0.01
R7724:Fn1 UTSW 1 71603735 missense probably benign 0.02
X0023:Fn1 UTSW 1 71598373 critical splice donor site probably null
Z1088:Fn1 UTSW 1 71649292 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TACTCGGTGCCCGGATTAAGGTTG -3'
(R):5'- GCTGAAGCCCTCAGAAGTATCAGTG -3'

Sequencing Primer
(F):5'- CCCGGATTAAGGTTGGTGAG -3'
(R):5'- CCCTCAGAAGTATCAGTGTTTCG -3'
Posted On2013-04-11