Incidental Mutation 'R1832:Runx1t1'
ID204848
Institutional Source Beutler Lab
Gene Symbol Runx1t1
Ensembl Gene ENSMUSG00000006586
Gene Namerunt-related transcription factor 1; translocated to, 1 (cyclin D-related)
SynonymsCbfa2t1h, ETO, MTG8
MMRRC Submission 039859-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.797) question?
Stock #R1832 (G1)
Quality Score225
Status Validated
Chromosome4
Chromosomal Location13743436-13893649 bp(+) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) C to T at 13835628 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000127109 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000006761] [ENSMUST00000098256] [ENSMUST00000098257] [ENSMUST00000105566]
Predicted Effect probably benign
Transcript: ENSMUST00000006761
SMART Domains Protein: ENSMUSP00000006761
Gene: ENSMUSG00000006586

DomainStartEndE-ValueType
low complexity region 32 48 N/A INTRINSIC
low complexity region 68 96 N/A INTRINSIC
TAFH 102 192 1.12e-53 SMART
low complexity region 266 277 N/A INTRINSIC
Pfam:NHR2 317 383 6.9e-42 PFAM
SCOP:d1gpua1 384 454 7e-3 SMART
PDB:2KYG|C 417 447 2e-12 PDB
Pfam:zf-MYND 495 531 4e-10 PFAM
low complexity region 543 558 N/A INTRINSIC
low complexity region 562 583 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000098256
SMART Domains Protein: ENSMUSP00000095856
Gene: ENSMUSG00000006586

DomainStartEndE-ValueType
low complexity region 25 41 N/A INTRINSIC
low complexity region 61 89 N/A INTRINSIC
TAFH 95 185 1.12e-53 SMART
low complexity region 259 270 N/A INTRINSIC
Pfam:NHR2 310 376 7.3e-42 PFAM
SCOP:d1gpua1 377 447 7e-3 SMART
PDB:2KYG|C 410 440 2e-12 PDB
Pfam:zf-MYND 488 524 2.5e-10 PFAM
low complexity region 536 551 N/A INTRINSIC
low complexity region 555 576 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000098257
SMART Domains Protein: ENSMUSP00000095857
Gene: ENSMUSG00000006586

DomainStartEndE-ValueType
low complexity region 52 68 N/A INTRINSIC
low complexity region 88 116 N/A INTRINSIC
TAFH 122 212 1.12e-53 SMART
low complexity region 286 297 N/A INTRINSIC
Pfam:NHR2 337 403 5.2e-43 PFAM
SCOP:d1gpua1 404 474 7e-3 SMART
PDB:2KYG|C 437 467 2e-12 PDB
Pfam:zf-MYND 515 551 6.7e-10 PFAM
low complexity region 563 578 N/A INTRINSIC
low complexity region 582 603 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000105566
SMART Domains Protein: ENSMUSP00000127109
Gene: ENSMUSG00000006586

DomainStartEndE-ValueType
low complexity region 52 68 N/A INTRINSIC
low complexity region 88 116 N/A INTRINSIC
TAFH 122 212 1.12e-53 SMART
low complexity region 286 297 N/A INTRINSIC
Pfam:NHR2 337 403 3.6e-42 PFAM
SCOP:d1gpua1 404 474 7e-3 SMART
PDB:2KYG|C 437 467 2e-12 PDB
Pfam:zf-MYND 515 551 1.4e-10 PFAM
low complexity region 563 578 N/A INTRINSIC
low complexity region 582 603 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150583
Coding Region Coverage
  • 1x: 97.4%
  • 3x: 96.7%
  • 10x: 94.6%
  • 20x: 90.7%
Validation Efficiency 100% (82/82)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the myeloid translocation gene family which interact with DNA-bound transcription factors and recruit a range of corepressors to facilitate transcriptional repression. The t(8;21)(q22;q22) translocation is one of the most frequent karyotypic abnormalities in acute myeloid leukemia. The translocation produces a chimeric gene made up of the 5'-region of the runt-related transcription factor 1 gene fused to the 3'-region of this gene. The chimeric protein is thought to associate with the nuclear corepressor/histone deacetylase complex to block hematopoietic differentiation. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Nov 2010]
PHENOTYPE: Homozygous disruption of this gene results in increased perinatal lethality and surviving animals show severe growth retardation. The midgut is absent in 25% of mutant animals which could explain increased perinatal mortality. Surviving animals display thinned intestinal walls and dilated lumens. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 73 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700003H04Rik T A 3: 124,556,860 D143V unknown Het
Abca8a A T 11: 110,071,451 N525K probably damaging Het
Abhd12 T A 2: 150,848,418 D119V probably damaging Het
Adamts20 A T 15: 94,286,344 M1526K probably benign Het
AI481877 T G 4: 59,066,441 I768L probably benign Het
Ankdd1a A T 9: 65,504,489 probably null Het
Ankrd1 C T 19: 36,114,978 C283Y possibly damaging Het
Arfgef1 G C 1: 10,204,890 I312M probably benign Het
Bhlhe22 G A 3: 18,054,975 C63Y probably damaging Het
Bmp8a A T 4: 123,325,092 probably benign Het
Ccdc148 A T 2: 59,001,899 S235T probably damaging Het
Ccdc88b G A 19: 6,853,532 Q681* probably null Het
Cep104 T A 4: 154,002,546 V842E probably benign Het
Chac2 T C 11: 30,977,568 N117S probably benign Het
Cldn8 T A 16: 88,562,858 I60F probably benign Het
Col16a1 G A 4: 130,077,057 probably null Het
Col4a1 A G 8: 11,214,644 probably benign Het
Cyp2a4 G T 7: 26,312,210 E285D probably damaging Het
Cyp4a31 G A 4: 115,569,731 G176D probably benign Het
Dmxl2 A C 9: 54,460,949 Y246D probably damaging Het
Dync1h1 A G 12: 110,614,059 K118R probably damaging Het
Eif3h T C 15: 51,865,436 T8A possibly damaging Het
Fam71d G A 12: 78,715,506 probably benign Het
Fbxo18 G T 2: 11,767,400 L157I probably benign Het
Fbxo40 C A 16: 36,968,856 G631* probably null Het
Gabrb1 T A 5: 72,121,938 probably null Het
Galc A G 12: 98,234,240 probably null Het
Gm10436 T C 12: 88,178,448 E44G possibly damaging Het
H2-Q7 C A 17: 35,439,699 S104R probably benign Het
Igkv13-54-1 A T 6: 69,617,293 M31L probably benign Het
Lamc2 C T 1: 153,166,187 R67Q possibly damaging Het
Lcn10 A G 2: 25,685,139 D173G probably damaging Het
Llgl2 G T 11: 115,851,100 R656L probably damaging Het
Lonrf2 G A 1: 38,813,276 P165S probably benign Het
Lrrc66 G A 5: 73,607,426 S758L possibly damaging Het
Ly6d T C 15: 74,762,766 K46E probably damaging Het
Map3k5 A G 10: 20,099,560 N88D probably damaging Het
Mertk A T 2: 128,762,212 E422V probably benign Het
Mixl1 A G 1: 180,694,731 V195A probably benign Het
Nmnat3 T C 9: 98,399,468 V41A probably damaging Het
Olfr13 A G 6: 43,174,900 R305G probably benign Het
Olfr398 A T 11: 73,984,493 N38K probably damaging Het
Olfr854 A G 9: 19,567,196 Y63H possibly damaging Het
Pappa2 T A 1: 158,857,316 E751V probably damaging Het
Pcsk2 A G 2: 143,793,269 S355G probably damaging Het
Pdzd2 A G 15: 12,390,048 V821A probably damaging Het
Pifo C T 3: 106,014,596 E4K possibly damaging Het
Plxna4 A C 6: 32,197,826 D1109E probably benign Het
Ppard A G 17: 28,297,110 M103V probably benign Het
Ralgapa1 T C 12: 55,757,967 T515A probably benign Het
Rin2 A G 2: 145,861,171 I596V possibly damaging Het
Rnls A G 19: 33,168,495 S75P possibly damaging Het
Rsph10b A T 5: 143,967,179 Y236F possibly damaging Het
Sardh A G 2: 27,235,569 V311A possibly damaging Het
Sbno2 G T 10: 80,060,605 Y889* probably null Het
Sclt1 A G 3: 41,727,111 V91A probably damaging Het
Sema4g T A 19: 44,999,017 V534E probably benign Het
Slc10a1 G A 12: 80,953,672 S351F probably benign Het
Slc19a3 A T 1: 83,022,747 V183E probably damaging Het
Slc25a12 A G 2: 71,333,710 Y74H possibly damaging Het
Slc6a19 T A 13: 73,692,950 I114L probably benign Het
Smpd2 A T 10: 41,488,236 C189S probably benign Het
Spon1 T A 7: 114,016,785 V295D probably benign Het
Tet3 A G 6: 83,403,645 S514P probably benign Het
Tnk1 T C 11: 69,856,928 I49M probably damaging Het
Trim80 A G 11: 115,446,793 T431A probably benign Het
Vgf A T 5: 137,031,299 Q105L possibly damaging Het
Vmn1r37 G T 6: 66,731,796 L135F probably benign Het
Vps37d C T 5: 135,073,740 A128T possibly damaging Het
Wdr60 T A 12: 116,207,743 S958C probably damaging Het
Wwp1 T C 4: 19,650,197 D323G probably benign Het
Zfp456 T A 13: 67,367,363 I75L probably benign Het
Zfp990 A G 4: 145,538,210 I593V possibly damaging Het
Other mutations in Runx1t1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00425:Runx1t1 APN 4 13835663 missense probably benign 0.07
IGL01600:Runx1t1 APN 4 13841871 missense probably damaging 1.00
IGL02120:Runx1t1 APN 4 13846884 missense probably benign
IGL02172:Runx1t1 APN 4 13859924 missense probably benign 0.00
IGL02429:Runx1t1 APN 4 13865294 splice site probably benign
IGL02730:Runx1t1 APN 4 13860019 missense probably benign 0.01
IGL02870:Runx1t1 APN 4 13889867 missense unknown
IGL02879:Runx1t1 APN 4 13889868 missense unknown
IGL03369:Runx1t1 APN 4 13881107 missense probably damaging 1.00
IGL03047:Runx1t1 UTSW 4 13865882 missense probably damaging 1.00
R1884:Runx1t1 UTSW 4 13835767 missense probably benign 0.00
R2277:Runx1t1 UTSW 4 13771501 missense probably benign 0.00
R4059:Runx1t1 UTSW 4 13889769 missense probably benign 0.33
R4505:Runx1t1 UTSW 4 13889676 missense probably damaging 1.00
R4585:Runx1t1 UTSW 4 13889864 missense unknown
R4586:Runx1t1 UTSW 4 13889864 missense unknown
R4758:Runx1t1 UTSW 4 13865907 missense probably damaging 1.00
R4795:Runx1t1 UTSW 4 13837767 missense probably damaging 0.99
R4796:Runx1t1 UTSW 4 13837767 missense probably damaging 0.99
R4897:Runx1t1 UTSW 4 13771459 start codon destroyed probably null 0.01
R4971:Runx1t1 UTSW 4 13837978 missense probably damaging 1.00
R5009:Runx1t1 UTSW 4 13865231 missense possibly damaging 0.80
R5091:Runx1t1 UTSW 4 13846830 nonsense probably null
R5844:Runx1t1 UTSW 4 13881068 missense probably damaging 1.00
R5968:Runx1t1 UTSW 4 13841890 splice site probably null
R5993:Runx1t1 UTSW 4 13841863 missense probably damaging 0.98
R5993:Runx1t1 UTSW 4 13875490 missense probably benign 0.00
R6329:Runx1t1 UTSW 4 13785136 start codon destroyed probably null 0.38
R6915:Runx1t1 UTSW 4 13865257 missense probably damaging 0.99
R7283:Runx1t1 UTSW 4 13846935 missense probably damaging 1.00
R8251:Runx1t1 UTSW 4 13846947 missense possibly damaging 0.46
Z1088:Runx1t1 UTSW 4 13865892 missense possibly damaging 0.52
Predicted Primers PCR Primer
(F):5'- ATGCTACACCTTCTCAAGCGG -3'
(R):5'- CAAGGCTTTTGCACTTGATTCTG -3'

Sequencing Primer
(F):5'- TTCTCAAGCGGCTGCATG -3'
(R):5'- TGCACTTGATTCTGCATAAAGC -3'
Posted On2014-06-23