Incidental Mutation 'R1832:Galc'
ID204890
Institutional Source Beutler Lab
Gene Symbol Galc
Ensembl Gene ENSMUSG00000021003
Gene Namegalactosylceramidase
SynonymsGacy, A930008M05Rik, 2310068B06Rik, galactocerebrosidase
MMRRC Submission 039859-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1832 (G1)
Quality Score225
Status Validated
Chromosome12
Chromosomal Location98202294-98259459 bp(-) (GRCm38)
Type of Mutationcritical splice donor site (2 bp from exon)
DNA Base Change (assembly) A to G at 98234240 bp
ZygosityHeterozygous
Amino Acid Change
Gene Model predicted gene model for transcript(s): [ENSMUST00000021390]
Predicted Effect probably null
Transcript: ENSMUST00000021390
SMART Domains Protein: ENSMUSP00000021390
Gene: ENSMUSG00000021003

DomainStartEndE-ValueType
Pfam:Glyco_hydro_59 17 684 N/A PFAM
Predicted Effect probably null
Transcript: ENSMUST00000221063
Predicted Effect noncoding transcript
Transcript: ENSMUST00000222042
Predicted Effect noncoding transcript
Transcript: ENSMUST00000222379
Meta Mutation Damage Score 0.9495 question?
Coding Region Coverage
  • 1x: 97.4%
  • 3x: 96.7%
  • 10x: 94.6%
  • 20x: 90.7%
Validation Efficiency 100% (82/82)
MGI Phenotype FUNCTION: This gene encodes galactosylceramidase, the lysosomal hydryolase involved in the catabolism of galactosylceramide. Mutations in this gene result in slow growth, tremors and hind leg weakness, collectively termed as the 'twitcher' phenotype. In humans, deficiency of this gene product causes a lysosomal storage disorder known as Krabbe disease. [provided by RefSeq, Dec 2014]
PHENOTYPE: Homozygotes for spontaneous and targeted mutations exhibit tremors, progressive weakness, wasting, both central and peripheral demyelination, massive accumulation of galactosylceramide, abnormal macrophages, and death by 4 months of age. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 73 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700003H04Rik T A 3: 124,556,860 D143V unknown Het
Abca8a A T 11: 110,071,451 N525K probably damaging Het
Abhd12 T A 2: 150,848,418 D119V probably damaging Het
Adamts20 A T 15: 94,286,344 M1526K probably benign Het
AI481877 T G 4: 59,066,441 I768L probably benign Het
Ankdd1a A T 9: 65,504,489 probably null Het
Ankrd1 C T 19: 36,114,978 C283Y possibly damaging Het
Arfgef1 G C 1: 10,204,890 I312M probably benign Het
Bhlhe22 G A 3: 18,054,975 C63Y probably damaging Het
Bmp8a A T 4: 123,325,092 probably benign Het
Ccdc148 A T 2: 59,001,899 S235T probably damaging Het
Ccdc88b G A 19: 6,853,532 Q681* probably null Het
Cep104 T A 4: 154,002,546 V842E probably benign Het
Chac2 T C 11: 30,977,568 N117S probably benign Het
Cldn8 T A 16: 88,562,858 I60F probably benign Het
Col16a1 G A 4: 130,077,057 probably null Het
Col4a1 A G 8: 11,214,644 probably benign Het
Cyp2a4 G T 7: 26,312,210 E285D probably damaging Het
Cyp4a31 G A 4: 115,569,731 G176D probably benign Het
Dmxl2 A C 9: 54,460,949 Y246D probably damaging Het
Dync1h1 A G 12: 110,614,059 K118R probably damaging Het
Eif3h T C 15: 51,865,436 T8A possibly damaging Het
Fam71d G A 12: 78,715,506 probably benign Het
Fbxo18 G T 2: 11,767,400 L157I probably benign Het
Fbxo40 C A 16: 36,968,856 G631* probably null Het
Gabrb1 T A 5: 72,121,938 probably null Het
Gm10436 T C 12: 88,178,448 E44G possibly damaging Het
H2-Q7 C A 17: 35,439,699 S104R probably benign Het
Igkv13-54-1 A T 6: 69,617,293 M31L probably benign Het
Lamc2 C T 1: 153,166,187 R67Q possibly damaging Het
Lcn10 A G 2: 25,685,139 D173G probably damaging Het
Llgl2 G T 11: 115,851,100 R656L probably damaging Het
Lonrf2 G A 1: 38,813,276 P165S probably benign Het
Lrrc66 G A 5: 73,607,426 S758L possibly damaging Het
Ly6d T C 15: 74,762,766 K46E probably damaging Het
Map3k5 A G 10: 20,099,560 N88D probably damaging Het
Mertk A T 2: 128,762,212 E422V probably benign Het
Mixl1 A G 1: 180,694,731 V195A probably benign Het
Nmnat3 T C 9: 98,399,468 V41A probably damaging Het
Olfr13 A G 6: 43,174,900 R305G probably benign Het
Olfr398 A T 11: 73,984,493 N38K probably damaging Het
Olfr854 A G 9: 19,567,196 Y63H possibly damaging Het
Pappa2 T A 1: 158,857,316 E751V probably damaging Het
Pcsk2 A G 2: 143,793,269 S355G probably damaging Het
Pdzd2 A G 15: 12,390,048 V821A probably damaging Het
Pifo C T 3: 106,014,596 E4K possibly damaging Het
Plxna4 A C 6: 32,197,826 D1109E probably benign Het
Ppard A G 17: 28,297,110 M103V probably benign Het
Ralgapa1 T C 12: 55,757,967 T515A probably benign Het
Rin2 A G 2: 145,861,171 I596V possibly damaging Het
Rnls A G 19: 33,168,495 S75P possibly damaging Het
Rsph10b A T 5: 143,967,179 Y236F possibly damaging Het
Runx1t1 C T 4: 13,835,628 probably benign Het
Sardh A G 2: 27,235,569 V311A possibly damaging Het
Sbno2 G T 10: 80,060,605 Y889* probably null Het
Sclt1 A G 3: 41,727,111 V91A probably damaging Het
Sema4g T A 19: 44,999,017 V534E probably benign Het
Slc10a1 G A 12: 80,953,672 S351F probably benign Het
Slc19a3 A T 1: 83,022,747 V183E probably damaging Het
Slc25a12 A G 2: 71,333,710 Y74H possibly damaging Het
Slc6a19 T A 13: 73,692,950 I114L probably benign Het
Smpd2 A T 10: 41,488,236 C189S probably benign Het
Spon1 T A 7: 114,016,785 V295D probably benign Het
Tet3 A G 6: 83,403,645 S514P probably benign Het
Tnk1 T C 11: 69,856,928 I49M probably damaging Het
Trim80 A G 11: 115,446,793 T431A probably benign Het
Vgf A T 5: 137,031,299 Q105L possibly damaging Het
Vmn1r37 G T 6: 66,731,796 L135F probably benign Het
Vps37d C T 5: 135,073,740 A128T possibly damaging Het
Wdr60 T A 12: 116,207,743 S958C probably damaging Het
Wwp1 T C 4: 19,650,197 D323G probably benign Het
Zfp456 T A 13: 67,367,363 I75L probably benign Het
Zfp990 A G 4: 145,538,210 I593V possibly damaging Het
Other mutations in Galc
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01023:Galc APN 12 98231422 missense probably benign
IGL01287:Galc APN 12 98246244 unclassified probably benign
IGL01618:Galc APN 12 98252081 missense possibly damaging 0.92
IGL02125:Galc APN 12 98231509 missense probably damaging 1.00
IGL02274:Galc APN 12 98254214 nonsense probably null
IGL02392:Galc APN 12 98207413 missense probably damaging 0.99
IGL02478:Galc APN 12 98213132 missense possibly damaging 0.96
IGL02544:Galc APN 12 98231442 missense probably benign 0.27
IGL03268:Galc APN 12 98222593 splice site probably benign
IGL03327:Galc APN 12 98207476 splice site probably benign
Crabby2 UTSW 12 98234266 missense probably damaging 1.00
Krabbe UTSW 12 98222647 missense probably damaging 1.00
lobster UTSW 12 98246255 missense probably null 0.84
quake UTSW 12 98242714 missense probably damaging 1.00
teeter UTSW 12 98259162 missense probably damaging 1.00
R0218:Galc UTSW 12 98222647 missense probably damaging 1.00
R0240:Galc UTSW 12 98252034 missense probably damaging 1.00
R0240:Galc UTSW 12 98252034 missense probably damaging 1.00
R0467:Galc UTSW 12 98242645 missense probably damaging 1.00
R1619:Galc UTSW 12 98234304 missense probably benign 0.00
R1763:Galc UTSW 12 98234266 missense probably damaging 1.00
R1844:Galc UTSW 12 98246297 unclassified probably null
R1996:Galc UTSW 12 98252026 missense probably damaging 1.00
R2010:Galc UTSW 12 98254230 missense possibly damaging 0.51
R2097:Galc UTSW 12 98252032 missense probably benign
R2496:Galc UTSW 12 98227281 missense probably damaging 1.00
R2881:Galc UTSW 12 98213096 missense probably benign
R3009:Galc UTSW 12 98203969 missense probably damaging 1.00
R4571:Galc UTSW 12 98222617 missense probably benign 0.00
R4764:Galc UTSW 12 98242744 missense possibly damaging 0.78
R4851:Galc UTSW 12 98227274 missense probably benign 0.00
R4854:Galc UTSW 12 98256877 missense probably damaging 1.00
R4900:Galc UTSW 12 98231472 missense probably damaging 1.00
R4983:Galc UTSW 12 98242768 nonsense probably null
R5220:Galc UTSW 12 98231413 splice site probably null
R5273:Galc UTSW 12 98252071 missense probably damaging 1.00
R5495:Galc UTSW 12 98231414 critical splice donor site probably null
R5689:Galc UTSW 12 98212986 missense possibly damaging 0.94
R5819:Galc UTSW 12 98216261 missense probably benign 0.06
R6191:Galc UTSW 12 98252034 missense probably damaging 1.00
R6196:Galc UTSW 12 98259162 missense probably damaging 1.00
R6305:Galc UTSW 12 98259290 missense possibly damaging 0.57
R6335:Galc UTSW 12 98242714 missense probably damaging 1.00
R7255:Galc UTSW 12 98246255 missense probably null 0.84
R7496:Galc UTSW 12 98259238 nonsense probably null
R7704:Galc UTSW 12 98208843 missense probably benign
Predicted Primers PCR Primer
(F):5'- TGCCTGAGTACACTGTACCC -3'
(R):5'- GAGTTCACCCACCTACTTCACG -3'

Sequencing Primer
(F):5'- GCCTGAGTACACTGTACCCCAATAG -3'
(R):5'- ACGGAAGTGTGGGGCTTC -3'
Posted On2014-06-23