Incidental Mutation 'R1833:Gpx1'
ID204968
Institutional Source Beutler Lab
Gene Symbol Gpx1
Ensembl Gene ENSMUSG00000063856
Gene Nameglutathione peroxidase 1
SynonymsGPx-1, GSHPx-1, Gpx, CGPx, cellular GPx
MMRRC Submission 039860-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1833 (G1)
Quality Score126
Status Validated
Chromosome9
Chromosomal Location108338903-108340343 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 108339356 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Phenylalanine at position 15 (Y15F)
Ref Sequence ENSEMBL: ENSMUSP00000081010 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000007959] [ENSMUST00000082429] [ENSMUST00000191997] [ENSMUST00000193987] [ENSMUST00000194701]
Predicted Effect probably benign
Transcript: ENSMUST00000007959
SMART Domains Protein: ENSMUSP00000007959
Gene: ENSMUSG00000007815

DomainStartEndE-ValueType
RHO 8 181 1.09e-134 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000082429
AA Change: Y15F

PolyPhen 2 Score 0.888 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000081010
Gene: ENSMUSG00000063856
AA Change: Y15F

DomainStartEndE-ValueType
Pfam:GSHPx 14 128 5.6e-45 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000191997
SMART Domains Protein: ENSMUSP00000142257
Gene: ENSMUSG00000063856

DomainStartEndE-ValueType
Pfam:GSHPx 1 71 3.2e-23 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000192053
Predicted Effect noncoding transcript
Transcript: ENSMUST00000192401
Predicted Effect noncoding transcript
Transcript: ENSMUST00000193424
Predicted Effect probably benign
Transcript: ENSMUST00000193987
SMART Domains Protein: ENSMUSP00000141279
Gene: ENSMUSG00000063856

DomainStartEndE-ValueType
Pfam:GSHPx 1 72 6.1e-26 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000194701
SMART Domains Protein: ENSMUSP00000141967
Gene: ENSMUSG00000007815

DomainStartEndE-ValueType
RHO 8 165 8.9e-117 SMART
Meta Mutation Damage Score 0.2189 question?
Coding Region Coverage
  • 1x: 97.4%
  • 3x: 96.8%
  • 10x: 95.1%
  • 20x: 91.9%
Validation Efficiency 99% (83/84)
MGI Phenotype FUNCTION: The protein encoded by this gene belongs to the glutathione peroxidase family, members of which catalyze the reduction of organic hydroperoxides and hydrogen peroxide (H2O2) by glutathione, and thereby protect cells against oxidative damage. Knockout mice lacking this gene are highly sensitive to oxidants, and develop mature cataracts due to damage to the eye lens nucleus. Other studies indicate that H2O2 is also essential for growth-factor mediated signal transduction, mitochondrial function, and maintenance of thiol redox-balance; therefore, by limiting H2O2 accumulation, glutathione peroxidases are also involved in modulating these processes. Several isozymes of this gene family exist in vertebrates, which vary in cellular location and substrate specificity. This isozyme is the most abundant, is ubiquitously expressed and localized in the cytoplasm, and whose preferred substrate is hydrogen peroxide. It is also a selenoprotein, containing the rare amino acid selenocysteine (Sec) at its active site. Sec is encoded by the UGA codon, which normally signals translation termination. The 3' UTRs of selenoprotein mRNAs contain a conserved stem-loop structure, designated the Sec insertion sequence (SECIS) element, that is necessary for the recognition of UGA as a Sec codon, rather than as a stop signal. Alternatively spliced transcript variants have been found for this gene. [provided by RefSeq, Jul 2016]
PHENOTYPE: Homozygotes for targeted null mutations show increased sensitivity to the oxidative stress agents paraquat and hydrogen peroxide and to ischemia/reperfusion and cold-induced brain injury. Mutants also show paradoxical bradykinin-induced vasoconstriction. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 79 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700003H04Rik T A 3: 124,556,860 D143V unknown Het
4930438A08Rik C T 11: 58,288,388 Q183* probably null Het
9230009I02Rik A G 11: 51,091,466 noncoding transcript Het
Abhd12 T A 2: 150,848,418 D119V probably damaging Het
Adam1b A G 5: 121,502,937 I15T possibly damaging Het
Agtpbp1 A T 13: 59,465,983 probably null Het
Arfgef1 G C 1: 10,204,890 I312M probably benign Het
Arid4a C T 12: 71,075,466 L874F possibly damaging Het
Bcas3 G A 11: 85,583,949 V317I probably benign Het
Ccr1 T A 9: 123,964,089 I135F probably damaging Het
Ces2h A G 8: 105,020,373 E547G possibly damaging Het
Ces3b T A 8: 105,085,639 D173E probably damaging Het
Chd3 A G 11: 69,354,123 L1197S probably damaging Het
Cngb1 A G 8: 95,242,355 L1175P probably damaging Het
Cyp4f17 T C 17: 32,524,210 F286L probably benign Het
Dclre1a C T 19: 56,541,500 probably null Het
Dennd6a T A 14: 26,606,954 L44H probably damaging Het
Dhx16 A G 17: 35,885,619 T560A probably benign Het
Dusp12 T C 1: 170,874,453 M326V probably benign Het
Eif3k T C 7: 28,971,427 I180V probably benign Het
Erc1 A G 6: 119,743,429 I437T possibly damaging Het
Fam71d G A 12: 78,715,506 probably benign Het
Farp2 T A 1: 93,576,364 probably benign Het
Foxa3 A G 7: 19,014,574 L209P probably damaging Het
Gen1 A T 12: 11,248,351 probably benign Het
Gm10305 A G 4: 99,273,126 T91A unknown Het
Gm10436 T C 12: 88,178,448 E44G possibly damaging Het
Gm14412 T C 2: 177,315,790 D104G probably benign Het
Gm340 T C 19: 41,584,948 I714T probably benign Het
Gm6900 T C 7: 10,656,588 noncoding transcript Het
H2-M10.3 T C 17: 36,367,495 Y146C probably damaging Het
H2-Q7 C A 17: 35,439,699 S104R probably benign Het
Hephl1 T C 9: 15,076,928 Y628C probably damaging Het
Hspa5 T A 2: 34,776,053 Y636* probably null Het
Htt A G 5: 34,905,748 probably benign Het
Idh1 T C 1: 65,161,114 I364V probably benign Het
Itgae G T 11: 73,117,162 A423S possibly damaging Het
Kng2 T C 16: 23,012,052 N169S possibly damaging Het
Larp4b C T 13: 9,151,199 T369I possibly damaging Het
Lonrf2 G A 1: 38,813,276 P165S probably benign Het
Magi2 G T 5: 19,227,457 G57C probably damaging Het
Mdn1 T A 4: 32,720,761 H2291Q probably damaging Het
Mgam T C 6: 40,654,718 probably null Het
Micall2 A G 5: 139,716,753 V245A probably benign Het
Mipep T G 14: 60,872,063 Y630D probably damaging Het
Msx2 A T 13: 53,468,185 M263K probably damaging Het
Nectin2 G T 7: 19,717,708 P467H probably damaging Het
Nek10 A T 14: 14,842,789 M165L probably benign Het
Nlrp4b A T 7: 10,725,936 M455L probably benign Het
Oaz3 TGGAGGCAGGAGCACGGGAGGCAGGAGCACGGGAGGCAG TGGAGGCAGGAGCACGGGAGGCAG 3: 94,436,042 probably benign Het
Olfr1258 T A 2: 89,930,301 L164* probably null Het
Olfr286 T A 15: 98,226,965 I227F probably damaging Het
Pcx T A 19: 4,619,104 V710E probably damaging Het
Pkn2 C T 3: 142,821,647 R347Q probably damaging Het
Qsox1 C T 1: 155,791,045 G233S probably benign Het
Rbl1 T A 2: 157,195,555 N224I probably damaging Het
Rspry1 A G 8: 94,635,488 T132A probably damaging Het
Sclt1 A G 3: 41,727,111 V91A probably damaging Het
Sema4f A T 6: 82,918,559 L331H probably benign Het
Sf3b3 T A 8: 110,817,566 Q814L probably benign Het
Slc19a2 T G 1: 164,262,184 Y190D probably damaging Het
Smarcc1 T A 9: 110,153,811 H204Q possibly damaging Het
Sox6 T C 7: 115,777,093 K135E probably damaging Het
Tecpr1 T C 5: 144,208,608 Q607R probably damaging Het
Tgfb1i1 A G 7: 128,249,498 probably benign Het
Tirap T G 9: 35,188,703 R228S probably benign Het
Tmem211 A G 5: 113,234,569 probably benign Het
Trp53bp2 T A 1: 182,429,016 H50Q probably damaging Het
Try4 A G 6: 41,303,431 H63R probably damaging Het
Vmn2r25 G A 6: 123,839,684 P313S probably benign Het
Vps26a A C 10: 62,459,046 L250V probably benign Het
Vwf A G 6: 125,642,037 H1226R probably benign Het
Wdtc1 TCC TC 4: 133,308,742 probably benign Het
Zc3hav1l A T 6: 38,297,946 probably benign Het
Zfp119b T G 17: 55,939,271 H305P probably damaging Het
Zfp326 C T 5: 105,891,169 Q134* probably null Het
Zfp975 C T 7: 42,661,839 R450Q probably benign Het
Zfyve26 A T 12: 79,286,258 M313K probably benign Het
Zscan5b T C 7: 6,238,966 S395P possibly damaging Het
Other mutations in Gpx1
AlleleSourceChrCoordTypePredicted EffectPPH Score
R1692:Gpx1 UTSW 9 108339475 missense possibly damaging 0.95
R3442:Gpx1 UTSW 9 108339350 missense probably benign
R4864:Gpx1 UTSW 9 108339395 missense probably benign 0.35
R6640:Gpx1 UTSW 9 108340096 missense probably damaging 1.00
R6838:Gpx1 UTSW 9 108339940 missense possibly damaging 0.94
Predicted Primers PCR Primer
(F):5'- CTGAGACTTAGAGCTGGCTG -3'
(R):5'- AGAAAGTAAGCGGTGTCCC -3'

Sequencing Primer
(F):5'- CTGCCAGCCGGAAAGAAAGC -3'
(R):5'- TGTCCGAACTGATTGCACG -3'
Posted On2014-06-23