Incidental Mutation 'R1834:Aox1'
ID 205005
Institutional Source Beutler Lab
Gene Symbol Aox1
Ensembl Gene ENSMUSG00000063558
Gene Name aldehyde oxidase 1
Synonyms Aox-1, retinal oxidase, Aox-2, Aox2
MMRRC Submission 039861-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R1834 (G1)
Quality Score 225
Status Validated
Chromosome 1
Chromosomal Location 58069090-58145572 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) G to A at 58348150 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Alanine to Threonine at position 623 (A623T)
Ref Sequence ENSEMBL: ENSMUSP00000110006 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000114366]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000114366
AA Change: A623T

PolyPhen 2 Score 0.076 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000110006
Gene: ENSMUSG00000079554
AA Change: A623T

DomainStartEndE-ValueType
Pfam:Fer2 13 83 3.4e-9 PFAM
Pfam:Fer2_2 92 166 4.2e-30 PFAM
Pfam:FAD_binding_5 241 421 5.1e-46 PFAM
CO_deh_flav_C 428 532 1.4e-23 SMART
Ald_Xan_dh_C 604 707 4.64e-47 SMART
Pfam:Ald_Xan_dh_C2 717 1251 1.3e-178 PFAM
low complexity region 1257 1271 N/A INTRINSIC
low complexity region 1285 1303 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000161126
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 97.4%
  • 3x: 96.8%
  • 10x: 95.1%
  • 20x: 92.0%
Validation Efficiency 97% (116/119)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Aldehyde oxidase produces hydrogen peroxide and, under certain conditions, can catalyze the formation of superoxide. Aldehyde oxidase is a candidate gene for amyotrophic lateral sclerosis. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 114 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310033P09Rik A G 11: 59,099,313 (GRCm39) D20G probably damaging Het
2310061N02Rik T A 16: 88,504,786 (GRCm39) S4C unknown Het
Abca3 A T 17: 24,595,666 (GRCm39) N340Y probably benign Het
Abcc1 A G 16: 14,240,981 (GRCm39) I513V possibly damaging Het
Acacb C T 5: 114,373,536 (GRCm39) T1855M probably damaging Het
Ace A G 11: 105,876,920 (GRCm39) probably benign Het
Acss2 T A 2: 155,400,550 (GRCm39) Y530N probably damaging Het
Adarb1 C A 10: 77,153,065 (GRCm39) probably benign Het
Afm T A 5: 90,674,283 (GRCm39) M265K probably benign Het
Agl A G 3: 116,582,000 (GRCm39) F293S probably benign Het
Arhgap31 C A 16: 38,424,065 (GRCm39) S667I probably benign Het
Bco1 A G 8: 117,844,176 (GRCm39) T297A probably benign Het
Bmp1 T C 14: 70,746,271 (GRCm39) S123G possibly damaging Het
Caps2 G A 10: 112,031,623 (GRCm39) D283N possibly damaging Het
Ccdc57 A C 11: 120,752,045 (GRCm39) S845R probably benign Het
Cd209f A G 8: 4,154,491 (GRCm39) S119P probably damaging Het
Chrna6 A G 8: 27,897,242 (GRCm39) S212P probably benign Het
Col10a1 G C 10: 34,271,011 (GRCm39) A328P probably damaging Het
Col4a2 A G 8: 11,452,997 (GRCm39) E188G probably benign Het
Creb1 C T 1: 64,590,109 (GRCm39) Q32* probably null Het
Cttnbp2 C T 6: 18,501,965 (GRCm39) V16M probably damaging Het
D430041D05Rik A G 2: 103,998,446 (GRCm39) S1102P probably damaging Het
Ddx31 C T 2: 28,782,465 (GRCm39) H603Y probably damaging Het
Ddx52 G A 11: 83,850,323 (GRCm39) C568Y probably benign Het
Dgki C A 6: 37,011,636 (GRCm39) probably benign Het
Dmrt1 A T 19: 25,487,063 (GRCm39) Q123L probably damaging Het
Dnah5 A T 15: 28,409,270 (GRCm39) M3563L probably benign Het
Dnah7b A T 1: 46,272,919 (GRCm39) N2349I possibly damaging Het
Dscaml1 T G 9: 45,594,930 (GRCm39) S678A probably benign Het
Ece1 C T 4: 137,685,312 (GRCm39) R601W probably damaging Het
Ece1 A G 4: 137,685,439 (GRCm39) N643S probably damaging Het
Eno1b A G 18: 48,180,530 (GRCm39) Y236C probably damaging Het
Esco1 T C 18: 10,594,350 (GRCm39) E312G probably damaging Het
Eya3 T A 4: 132,434,429 (GRCm39) V276E probably damaging Het
Fam161b A G 12: 84,395,552 (GRCm39) probably benign Het
Fem1c C T 18: 46,638,349 (GRCm39) G551D probably damaging Het
Fer1l6 T C 15: 58,429,718 (GRCm39) I155T possibly damaging Het
Gbp7 A G 3: 142,240,441 (GRCm39) Y53C probably damaging Het
Gjb3 G A 4: 127,220,224 (GRCm39) R103W probably damaging Het
Gm10030 C T 9: 110,833,947 (GRCm39) noncoding transcript Het
Gm3443 T A 19: 21,533,043 (GRCm39) H2Q unknown Het
Gm5800 T C 14: 51,953,549 (GRCm39) E22G possibly damaging Het
Gsdma2 G T 11: 98,539,905 (GRCm39) R9L probably damaging Het
Gvin3 A T 7: 106,202,983 (GRCm39) V87D possibly damaging Het
Ica1l A G 1: 60,067,395 (GRCm39) probably benign Het
Ice1 G A 13: 70,763,457 (GRCm39) T167I probably damaging Het
Ifi204 T A 1: 173,575,172 (GRCm39) R618S unknown Het
Itga2 C A 13: 114,993,262 (GRCm39) K784N probably damaging Het
Itga2 T A 13: 114,993,263 (GRCm39) K784M probably damaging Het
Kif3b A G 2: 153,159,405 (GRCm39) E402G probably benign Het
Lrp2 T C 2: 69,297,224 (GRCm39) I3246V probably benign Het
Lrrn3 G T 12: 41,503,517 (GRCm39) L267I probably damaging Het
Map1s A G 8: 71,369,055 (GRCm39) Y868C probably damaging Het
Mcm5 A G 8: 75,845,901 (GRCm39) T370A possibly damaging Het
Nat8f7 T C 6: 85,684,793 (GRCm39) S16G probably benign Het
Nav3 T C 10: 109,555,883 (GRCm39) T1683A probably damaging Het
Nbeal2 T C 9: 110,456,197 (GRCm39) N2417S probably damaging Het
Neb T C 2: 52,126,907 (GRCm39) N3605S probably damaging Het
Net1 A T 13: 3,962,941 (GRCm39) probably benign Het
Nsd1 A G 13: 55,461,164 (GRCm39) T2464A possibly damaging Het
Nt5e T A 9: 88,252,240 (GRCm39) I534N probably damaging Het
Nudt12 T A 17: 59,318,071 (GRCm39) H58L probably damaging Het
Ocrl T A X: 47,050,993 (GRCm39) I74N probably damaging Het
Or1a1 A G 11: 74,086,479 (GRCm39) H50R probably benign Het
Or2ag13 A G 7: 106,473,348 (GRCm39) Y35H probably damaging Het
Or5ae2 A G 7: 84,505,690 (GRCm39) T38A probably damaging Het
Or9k2b A G 10: 130,016,701 (GRCm39) I16T probably benign Het
Pef1 C A 4: 130,014,966 (GRCm39) C10* probably null Het
Phf21b A G 15: 84,681,547 (GRCm39) Y256H probably damaging Het
Phox2a G T 7: 101,470,152 (GRCm39) probably null Het
Pi16 A G 17: 29,546,419 (GRCm39) E399G possibly damaging Het
Pipox A T 11: 77,772,949 (GRCm39) Y321N probably damaging Het
Plin4 A G 17: 56,410,522 (GRCm39) S1170P probably damaging Het
Pnma2 C T 14: 67,154,662 (GRCm39) S362L possibly damaging Het
Ppp1r9a T C 6: 5,113,710 (GRCm39) I738T probably damaging Het
Prkcsh A T 9: 21,919,634 (GRCm39) K188M probably damaging Het
Rcc1l A T 5: 134,192,498 (GRCm39) Y309N probably damaging Het
Ripk1 A G 13: 34,199,196 (GRCm39) T123A probably benign Het
Robo4 A G 9: 37,324,355 (GRCm39) D961G probably benign Het
Rps27a A G 11: 29,496,299 (GRCm39) Y105H probably benign Het
Scaper A G 9: 55,724,018 (GRCm39) Y641H possibly damaging Het
Scn1a C A 2: 66,154,960 (GRCm39) Q666H probably benign Het
Scn1a T A 2: 66,154,961 (GRCm39) Q666L probably benign Het
Sdhaf4 T C 1: 24,042,234 (GRCm39) probably null Het
Sec14l3 A G 11: 4,016,510 (GRCm39) probably benign Het
Selp C A 1: 163,955,729 (GRCm39) probably null Het
Sim1 A G 10: 50,785,924 (GRCm39) D259G probably damaging Het
Sptan1 T A 2: 29,882,013 (GRCm39) probably benign Het
Sptbn4 T A 7: 27,066,071 (GRCm39) E679V probably null Het
Sytl3 G A 17: 6,995,726 (GRCm39) E169K probably benign Het
Taar1 T C 10: 23,797,087 (GRCm39) C262R probably benign Het
Taf7l2 T C 10: 115,948,570 (GRCm39) R319G probably benign Het
Tbc1d32 A G 10: 55,893,700 (GRCm39) I1291T probably benign Het
Tet1 G A 10: 62,649,444 (GRCm39) P89S probably damaging Het
Tgfbrap1 C A 1: 43,110,795 (GRCm39) G7W probably damaging Het
Thada A G 17: 84,533,432 (GRCm39) V1673A possibly damaging Het
Thbs4 A G 13: 92,897,989 (GRCm39) V610A probably benign Het
Tmem163 A G 1: 127,605,246 (GRCm39) S41P probably benign Het
Tmem65 A T 15: 58,658,962 (GRCm39) H200Q probably damaging Het
Trgc3 A G 13: 19,447,535 (GRCm39) T163A possibly damaging Het
Trim62 T C 4: 128,803,018 (GRCm39) V356A possibly damaging Het
Ttn T C 2: 76,562,502 (GRCm39) D28781G probably damaging Het
Ttn C T 2: 76,593,604 (GRCm39) V20679I probably benign Het
Tut7 A T 13: 59,962,749 (GRCm39) Y339* probably null Het
Unc80 A T 1: 66,678,407 (GRCm39) T2063S possibly damaging Het
Vav3 A G 3: 109,413,742 (GRCm39) T227A probably benign Het
Vmn2r118 A T 17: 55,899,456 (GRCm39) I816N probably damaging Het
Vmn2r26 T A 6: 124,038,369 (GRCm39) M648K possibly damaging Het
Vmn2r88 T G 14: 51,650,487 (GRCm39) probably benign Het
Vwa3a A G 7: 120,389,359 (GRCm39) T66A probably benign Het
Xirp2 T A 2: 67,341,484 (GRCm39) Y1242N probably damaging Het
Ywhag G A 5: 135,940,384 (GRCm39) T70M probably damaging Het
Zfp248 T C 6: 118,405,931 (GRCm39) T452A probably damaging Het
Zfp988 A T 4: 147,417,344 (GRCm39) I593F probably damaging Het
Other mutations in Aox1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00336:Aox1 APN 1 58,098,203 (GRCm39) missense probably damaging 1.00
IGL01014:Aox1 APN 1 58,361,960 (GRCm39) missense possibly damaging 0.73
IGL01077:Aox1 APN 1 58,096,569 (GRCm39) splice site probably benign
IGL01288:Aox1 APN 1 58,333,566 (GRCm39) missense probably damaging 0.99
IGL01335:Aox1 APN 1 58,121,312 (GRCm39) nonsense probably null
IGL01383:Aox1 APN 1 58,333,464 (GRCm39) missense probably benign 0.09
IGL01410:Aox1 APN 1 58,145,184 (GRCm39) splice site probably null
IGL01684:Aox1 APN 1 58,116,740 (GRCm39) splice site probably null
IGL01727:Aox1 APN 1 58,112,387 (GRCm39) nonsense probably null
IGL01734:Aox1 APN 1 58,393,469 (GRCm39) missense possibly damaging 0.95
IGL01793:Aox1 APN 1 58,375,783 (GRCm39) missense possibly damaging 0.79
IGL01805:Aox1 APN 1 58,120,672 (GRCm39) missense possibly damaging 0.94
IGL01834:Aox1 APN 1 58,348,183 (GRCm39) missense possibly damaging 0.90
IGL01924:Aox1 APN 1 58,326,902 (GRCm39) missense possibly damaging 0.90
IGL01996:Aox1 APN 1 58,121,225 (GRCm39) missense probably benign 0.11
IGL02060:Aox1 APN 1 58,137,114 (GRCm39) missense possibly damaging 0.95
IGL02206:Aox1 APN 1 58,104,499 (GRCm39) missense probably benign 0.00
IGL02591:Aox1 APN 1 58,398,158 (GRCm39) nonsense probably null
IGL02645:Aox1 APN 1 58,373,883 (GRCm39) missense probably damaging 1.00
IGL02710:Aox1 APN 1 58,373,928 (GRCm39) critical splice donor site probably null
IGL02801:Aox1 APN 1 58,393,336 (GRCm39) missense probably damaging 1.00
IGL02839:Aox1 APN 1 58,107,943 (GRCm39) missense probably benign 0.05
IGL02975:Aox1 APN 1 58,107,550 (GRCm39) missense probably damaging 1.00
IGL02988:Aox1 APN 1 58,376,509 (GRCm39) missense probably benign
IGL03062:Aox1 APN 1 58,117,624 (GRCm39) missense probably benign 0.01
IGL03104:Aox1 APN 1 58,321,918 (GRCm39) missense probably benign
IGL03121:Aox1 APN 1 58,398,113 (GRCm39) missense probably damaging 1.00
IGL03191:Aox1 APN 1 58,398,228 (GRCm39) missense probably null 0.98
IGL03236:Aox1 APN 1 58,349,156 (GRCm39) nonsense probably null
IGL03286:Aox1 APN 1 58,088,543 (GRCm39) missense probably benign 0.19
IGL03335:Aox1 APN 1 58,115,319 (GRCm39) missense probably damaging 0.98
IGL03395:Aox1 APN 1 58,107,884 (GRCm39) splice site probably benign
IGL03409:Aox1 APN 1 58,393,588 (GRCm39) missense possibly damaging 0.91
PIT4362001:Aox1 UTSW 1 58,321,839 (GRCm39) missense probably damaging 1.00
R0035:Aox1 UTSW 1 58,393,581 (GRCm39) missense probably benign 0.00
R0035:Aox1 UTSW 1 58,393,581 (GRCm39) missense probably benign 0.00
R0048:Aox1 UTSW 1 58,112,371 (GRCm39) missense probably damaging 0.98
R0144:Aox1 UTSW 1 58,109,233 (GRCm39) missense probably benign 0.00
R0207:Aox1 UTSW 1 58,144,173 (GRCm39) missense possibly damaging 0.82
R0267:Aox1 UTSW 1 58,378,605 (GRCm39) splice site probably benign
R0357:Aox1 UTSW 1 58,131,675 (GRCm39) missense probably damaging 1.00
R0383:Aox1 UTSW 1 58,100,400 (GRCm39) missense probably benign 0.00
R0388:Aox1 UTSW 1 58,393,565 (GRCm39) missense probably damaging 1.00
R0399:Aox1 UTSW 1 58,108,008 (GRCm39) splice site probably null
R0409:Aox1 UTSW 1 58,375,783 (GRCm39) missense possibly damaging 0.90
R0465:Aox1 UTSW 1 58,101,366 (GRCm39) missense probably damaging 1.00
R0480:Aox1 UTSW 1 58,082,810 (GRCm39) splice site probably benign
R0547:Aox1 UTSW 1 58,349,201 (GRCm39) missense probably damaging 0.96
R0630:Aox1 UTSW 1 58,376,480 (GRCm39) splice site probably benign
R0726:Aox1 UTSW 1 58,373,941 (GRCm39) splice site probably benign
R0734:Aox1 UTSW 1 58,344,500 (GRCm39) missense probably benign 0.22
R0831:Aox1 UTSW 1 58,378,842 (GRCm39) missense probably benign 0.28
R0961:Aox1 UTSW 1 58,349,230 (GRCm39) missense probably benign 0.00
R1005:Aox1 UTSW 1 58,104,511 (GRCm39) missense probably benign 0.00
R1404:Aox1 UTSW 1 58,385,371 (GRCm39) splice site probably benign
R1507:Aox1 UTSW 1 58,143,610 (GRCm39) missense probably benign 0.01
R1512:Aox1 UTSW 1 58,346,510 (GRCm39) missense probably benign 0.00
R1573:Aox1 UTSW 1 58,348,186 (GRCm39) missense probably benign 0.00
R1592:Aox1 UTSW 1 58,339,853 (GRCm39) missense probably benign 0.00
R1597:Aox1 UTSW 1 58,086,326 (GRCm39) missense probably damaging 1.00
R1693:Aox1 UTSW 1 58,124,701 (GRCm39) missense probably damaging 1.00
R1709:Aox1 UTSW 1 58,116,633 (GRCm39) missense probably benign
R1747:Aox1 UTSW 1 58,378,751 (GRCm39) missense probably benign 0.01
R1768:Aox1 UTSW 1 58,393,354 (GRCm39) missense probably benign 0.00
R1809:Aox1 UTSW 1 58,333,484 (GRCm39) missense probably benign
R1823:Aox1 UTSW 1 58,351,518 (GRCm39) missense probably benign 0.02
R1835:Aox1 UTSW 1 58,348,150 (GRCm39) missense probably benign 0.08
R1836:Aox1 UTSW 1 58,348,150 (GRCm39) missense probably benign 0.08
R1869:Aox1 UTSW 1 58,115,262 (GRCm39) missense probably damaging 1.00
R1870:Aox1 UTSW 1 58,115,262 (GRCm39) missense probably damaging 1.00
R1898:Aox1 UTSW 1 58,117,601 (GRCm39) missense probably damaging 1.00
R1908:Aox1 UTSW 1 58,141,783 (GRCm39) missense probably damaging 1.00
R2002:Aox1 UTSW 1 58,086,300 (GRCm39) missense possibly damaging 0.69
R2062:Aox1 UTSW 1 58,098,351 (GRCm39) splice site probably null
R2065:Aox1 UTSW 1 58,098,351 (GRCm39) splice site probably null
R2219:Aox1 UTSW 1 58,388,289 (GRCm39) splice site probably null
R2220:Aox1 UTSW 1 58,388,289 (GRCm39) splice site probably null
R2265:Aox1 UTSW 1 58,120,679 (GRCm39) missense probably damaging 0.99
R2508:Aox1 UTSW 1 58,382,832 (GRCm39) missense probably benign 0.38
R2942:Aox1 UTSW 1 58,376,540 (GRCm39) missense probably benign 0.03
R2967:Aox1 UTSW 1 58,361,993 (GRCm39) missense probably damaging 0.96
R3082:Aox1 UTSW 1 58,322,759 (GRCm39) splice site probably benign
R3161:Aox1 UTSW 1 58,343,597 (GRCm39) missense possibly damaging 0.91
R3408:Aox1 UTSW 1 58,382,827 (GRCm39) missense probably benign 0.32
R3713:Aox1 UTSW 1 58,095,374 (GRCm39) missense probably benign 0.01
R3778:Aox1 UTSW 1 58,092,862 (GRCm39) missense possibly damaging 0.89
R3803:Aox1 UTSW 1 58,329,058 (GRCm39) splice site probably null
R3894:Aox1 UTSW 1 58,373,837 (GRCm39) critical splice acceptor site probably null
R4198:Aox1 UTSW 1 58,124,766 (GRCm39) missense probably benign
R4214:Aox1 UTSW 1 58,346,603 (GRCm39) critical splice donor site probably null
R4249:Aox1 UTSW 1 58,338,978 (GRCm39) missense probably benign 0.01
R4296:Aox1 UTSW 1 58,096,559 (GRCm39) splice site probably null
R4562:Aox1 UTSW 1 58,098,215 (GRCm39) missense probably damaging 0.99
R4666:Aox1 UTSW 1 58,343,756 (GRCm39) nonsense probably null
R4668:Aox1 UTSW 1 58,373,853 (GRCm39) missense possibly damaging 0.63
R4703:Aox1 UTSW 1 58,398,116 (GRCm39) missense possibly damaging 0.78
R4758:Aox1 UTSW 1 58,371,741 (GRCm39) missense probably benign 0.00
R4858:Aox1 UTSW 1 58,143,640 (GRCm39) missense probably benign
R4862:Aox1 UTSW 1 58,134,316 (GRCm39) missense probably damaging 0.98
R4890:Aox1 UTSW 1 58,373,862 (GRCm39) missense probably benign 0.11
R4900:Aox1 UTSW 1 58,344,544 (GRCm39) missense probably benign
R4924:Aox1 UTSW 1 58,344,503 (GRCm39) missense probably damaging 1.00
R4970:Aox1 UTSW 1 58,349,254 (GRCm39) splice site probably null
R5048:Aox1 UTSW 1 58,098,641 (GRCm39) splice site probably benign
R5112:Aox1 UTSW 1 58,349,254 (GRCm39) splice site probably null
R5127:Aox1 UTSW 1 58,069,185 (GRCm39) missense probably benign 0.00
R5139:Aox1 UTSW 1 58,100,456 (GRCm39) missense probably benign 0.03
R5157:Aox1 UTSW 1 58,109,222 (GRCm39) missense probably damaging 1.00
R5168:Aox1 UTSW 1 58,088,561 (GRCm39) missense probably damaging 1.00
R5186:Aox1 UTSW 1 58,107,529 (GRCm39) missense probably damaging 1.00
R5235:Aox1 UTSW 1 58,096,714 (GRCm39) missense possibly damaging 0.77
R5289:Aox1 UTSW 1 58,131,717 (GRCm39) missense probably damaging 0.99
R5466:Aox1 UTSW 1 58,080,619 (GRCm39) missense probably damaging 1.00
R5540:Aox1 UTSW 1 58,143,569 (GRCm39) missense probably benign 0.03
R5615:Aox1 UTSW 1 58,136,125 (GRCm39) missense probably benign
R5652:Aox1 UTSW 1 58,134,356 (GRCm39) missense probably damaging 1.00
R5920:Aox1 UTSW 1 58,088,631 (GRCm39) missense probably damaging 1.00
R5987:Aox1 UTSW 1 58,346,518 (GRCm39) missense probably benign 0.00
R6008:Aox1 UTSW 1 58,116,672 (GRCm39) missense probably damaging 1.00
R6073:Aox1 UTSW 1 58,143,668 (GRCm39) critical splice donor site probably null
R6215:Aox1 UTSW 1 58,124,620 (GRCm39) missense probably benign
R6239:Aox1 UTSW 1 58,344,550 (GRCm39) critical splice donor site probably null
R6273:Aox1 UTSW 1 58,378,831 (GRCm39) missense probably benign 0.00
R6291:Aox1 UTSW 1 58,369,965 (GRCm39) missense probably damaging 0.98
R6334:Aox1 UTSW 1 58,346,566 (GRCm39) nonsense probably null
R6403:Aox1 UTSW 1 58,107,594 (GRCm39) missense probably damaging 1.00
R6440:Aox1 UTSW 1 58,133,631 (GRCm39) missense probably damaging 1.00
R6601:Aox1 UTSW 1 58,102,665 (GRCm39) missense probably damaging 1.00
R6608:Aox1 UTSW 1 58,096,705 (GRCm39) missense probably benign 0.40
R6752:Aox1 UTSW 1 58,086,398 (GRCm39) missense probably benign 0.00
R6764:Aox1 UTSW 1 58,389,441 (GRCm39) missense probably damaging 0.97
R6766:Aox1 UTSW 1 58,388,227 (GRCm39) missense possibly damaging 0.95
R6789:Aox1 UTSW 1 58,343,644 (GRCm39) missense probably benign 0.01
R6804:Aox1 UTSW 1 58,343,757 (GRCm39) missense probably benign 0.04
R6989:Aox1 UTSW 1 58,124,611 (GRCm39) missense probably damaging 1.00
R7007:Aox1 UTSW 1 58,370,051 (GRCm39) missense probably damaging 1.00
R7015:Aox1 UTSW 1 58,321,917 (GRCm39) missense probably benign 0.00
R7042:Aox1 UTSW 1 58,141,759 (GRCm39) missense probably damaging 0.99
R7055:Aox1 UTSW 1 58,338,927 (GRCm39) missense probably benign 0.08
R7089:Aox1 UTSW 1 58,375,808 (GRCm39) missense probably benign 0.01
R7157:Aox1 UTSW 1 58,322,651 (GRCm39) missense probably benign 0.00
R7303:Aox1 UTSW 1 58,373,924 (GRCm39) nonsense probably null
R7426:Aox1 UTSW 1 58,329,142 (GRCm39) nonsense probably null
R7442:Aox1 UTSW 1 58,121,172 (GRCm39) missense probably damaging 1.00
R7506:Aox1 UTSW 1 58,088,562 (GRCm39) missense probably damaging 1.00
R7563:Aox1 UTSW 1 58,086,304 (GRCm39) missense probably benign 0.32
R7589:Aox1 UTSW 1 58,080,643 (GRCm39) missense probably damaging 1.00
R7735:Aox1 UTSW 1 58,107,451 (GRCm39) missense probably benign 0.01
R7762:Aox1 UTSW 1 58,388,263 (GRCm39) missense probably damaging 1.00
R7814:Aox1 UTSW 1 58,124,626 (GRCm39) missense probably benign
R7876:Aox1 UTSW 1 58,101,330 (GRCm39) nonsense probably null
R7899:Aox1 UTSW 1 58,320,396 (GRCm39) splice site probably null
R7905:Aox1 UTSW 1 58,143,557 (GRCm39) missense possibly damaging 0.72
R7908:Aox1 UTSW 1 58,145,227 (GRCm39) missense possibly damaging 0.68
R7942:Aox1 UTSW 1 58,376,590 (GRCm39) missense probably damaging 1.00
R7975:Aox1 UTSW 1 58,348,187 (GRCm39) missense probably benign 0.02
R8029:Aox1 UTSW 1 58,382,827 (GRCm39) missense probably benign 0.32
R8032:Aox1 UTSW 1 58,389,442 (GRCm39) missense probably benign 0.01
R8116:Aox1 UTSW 1 58,115,283 (GRCm39) missense probably damaging 1.00
R8147:Aox1 UTSW 1 58,339,821 (GRCm39) missense probably benign 0.02
R8165:Aox1 UTSW 1 58,348,088 (GRCm39) missense probably benign 0.08
R8179:Aox1 UTSW 1 58,137,117 (GRCm39) missense probably damaging 1.00
R8264:Aox1 UTSW 1 58,092,873 (GRCm39) missense possibly damaging 0.92
R8284:Aox1 UTSW 1 58,115,250 (GRCm39) missense probably damaging 1.00
R8326:Aox1 UTSW 1 58,335,046 (GRCm39) missense probably benign
R8415:Aox1 UTSW 1 58,080,638 (GRCm39) missense probably damaging 1.00
R8770:Aox1 UTSW 1 58,378,763 (GRCm39) missense probably benign 0.10
R8946:Aox1 UTSW 1 58,145,227 (GRCm39) missense possibly damaging 0.68
R8973:Aox1 UTSW 1 58,329,113 (GRCm39) missense probably benign 0.34
R8988:Aox1 UTSW 1 58,088,625 (GRCm39) missense possibly damaging 0.48
R9015:Aox1 UTSW 1 58,382,851 (GRCm39) missense probably damaging 1.00
R9097:Aox1 UTSW 1 58,326,887 (GRCm39) missense possibly damaging 0.82
R9101:Aox1 UTSW 1 58,371,796 (GRCm39) missense probably benign 0.03
R9108:Aox1 UTSW 1 58,321,851 (GRCm39) missense probably damaging 1.00
R9180:Aox1 UTSW 1 58,378,777 (GRCm39) nonsense probably null
R9258:Aox1 UTSW 1 58,351,515 (GRCm39) missense probably damaging 1.00
R9293:Aox1 UTSW 1 58,361,953 (GRCm39) missense possibly damaging 0.86
R9296:Aox1 UTSW 1 58,124,612 (GRCm39) missense probably damaging 1.00
R9382:Aox1 UTSW 1 58,104,501 (GRCm39) missense possibly damaging 0.48
R9461:Aox1 UTSW 1 58,116,736 (GRCm39) critical splice donor site probably null
R9519:Aox1 UTSW 1 58,373,926 (GRCm39) missense probably damaging 0.98
R9581:Aox1 UTSW 1 58,370,055 (GRCm39) critical splice donor site probably null
Z1088:Aox1 UTSW 1 58,120,701 (GRCm39) missense probably benign 0.01
Z1177:Aox1 UTSW 1 58,393,556 (GRCm39) missense possibly damaging 0.69
Predicted Primers PCR Primer
(F):5'- CACTCCGATGTTTGTGACCCAC -3'
(R):5'- CAAAGTCCATCTCTTGGTCGG -3'

Sequencing Primer
(F):5'- TCAGAAGGCCACCTGAGG -3'
(R):5'- ATCTCTTGGTCGGCATTTAAAGC -3'
Posted On 2014-06-23