Incidental Mutation 'R1834:Afm'
ID205036
Institutional Source Beutler Lab
Gene Symbol Afm
Ensembl Gene ENSMUSG00000029369
Gene Nameafamin
Synonymsalpha albumin, Alf
MMRRC Submission 039861-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.050) question?
Stock #R1834 (G1)
Quality Score225
Status Validated
Chromosome5
Chromosomal Location90518932-90553543 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 90526424 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Lysine at position 265 (M265K)
Ref Sequence ENSEMBL: ENSMUSP00000108804 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000113179] [ENSMUST00000128740]
Predicted Effect probably benign
Transcript: ENSMUST00000113179
AA Change: M265K

PolyPhen 2 Score 0.007 (Sensitivity: 0.96; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000108804
Gene: ENSMUSG00000029369
AA Change: M265K

DomainStartEndE-ValueType
ALBUMIN 20 205 3.69e-55 SMART
ALBUMIN 212 397 6.42e-64 SMART
ALBUMIN 404 593 3.07e-61 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000128740
AA Change: M265K

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000117180
Gene: ENSMUSG00000029369
AA Change: M265K

DomainStartEndE-ValueType
ALBUMIN 20 205 3.69e-55 SMART
ALBUMIN 212 397 6.42e-64 SMART
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 97.4%
  • 3x: 96.8%
  • 10x: 95.1%
  • 20x: 92.0%
Validation Efficiency 97% (116/119)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the albumin gene family, which is comprised of four genes that localize to chromosome 4 in a tandem arrangement. These four genes encode structurally-related serum transport proteins that are known to be evolutionarily related. The protein encoded by this gene is regulated developmentally, expressed in the liver and secreted into the bloodstream. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 114 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310033P09Rik A G 11: 59,208,487 D20G probably damaging Het
2310061N02Rik T A 16: 88,707,898 S4C unknown Het
4933416C03Rik T C 10: 116,112,665 R319G probably benign Het
Abca3 A T 17: 24,376,692 N340Y probably benign Het
Abcc1 A G 16: 14,423,117 I513V possibly damaging Het
Acacb C T 5: 114,235,475 T1855M probably damaging Het
Ace A G 11: 105,986,094 probably benign Het
Acss2 T A 2: 155,558,630 Y530N probably damaging Het
Adarb1 C A 10: 77,317,231 probably benign Het
Agl A G 3: 116,788,351 F293S probably benign Het
Aox2 G A 1: 58,308,991 A623T probably benign Het
Arhgap31 C A 16: 38,603,703 S667I probably benign Het
Bco1 A G 8: 117,117,437 T297A probably benign Het
Bmp1 T C 14: 70,508,831 S123G possibly damaging Het
Caps2 G A 10: 112,195,718 D283N possibly damaging Het
Ccdc57 A C 11: 120,861,219 S845R probably benign Het
Cd209f A G 8: 4,104,491 S119P probably damaging Het
Chrna6 A G 8: 27,407,214 S212P probably benign Het
Col10a1 G C 10: 34,395,015 A328P probably damaging Het
Col4a2 A G 8: 11,402,997 E188G probably benign Het
Creb1 C T 1: 64,550,950 Q32* probably null Het
Cttnbp2 C T 6: 18,501,966 V16M probably damaging Het
D430041D05Rik A G 2: 104,168,101 S1102P probably damaging Het
Ddx31 C T 2: 28,892,453 H603Y probably damaging Het
Ddx52 G A 11: 83,959,497 C568Y probably benign Het
Dgki C A 6: 37,034,701 probably benign Het
Dmrt1 A T 19: 25,509,699 Q123L probably damaging Het
Dnah5 A T 15: 28,409,124 M3563L probably benign Het
Dnah7b A T 1: 46,233,759 N2349I possibly damaging Het
Dscaml1 T G 9: 45,683,632 S678A probably benign Het
Ece1 C T 4: 137,958,001 R601W probably damaging Het
Ece1 A G 4: 137,958,128 N643S probably damaging Het
Eno1b A G 18: 48,047,463 Y236C probably damaging Het
Esco1 T C 18: 10,594,350 E312G probably damaging Het
Eya3 T A 4: 132,707,118 V276E probably damaging Het
Fam161b A G 12: 84,348,778 probably benign Het
Fem1c C T 18: 46,505,282 G551D probably damaging Het
Fer1l6 T C 15: 58,557,869 I155T possibly damaging Het
Gbp7 A G 3: 142,534,680 Y53C probably damaging Het
Gjb3 G A 4: 127,326,431 R103W probably damaging Het
Gm10030 C T 9: 111,004,879 noncoding transcript Het
Gm1966 A T 7: 106,603,776 V87D possibly damaging Het
Gm3443 T A 19: 21,555,679 H2Q unknown Het
Gm5800 T C 14: 51,716,092 E22G possibly damaging Het
Gsdma2 G T 11: 98,649,079 R9L probably damaging Het
Ica1l A G 1: 60,028,236 probably benign Het
Ice1 G A 13: 70,615,338 T167I probably damaging Het
Ifi204 T A 1: 173,747,606 R618S unknown Het
Itga2 C A 13: 114,856,726 K784N probably damaging Het
Itga2 T A 13: 114,856,727 K784M probably damaging Het
Kif3b A G 2: 153,317,485 E402G probably benign Het
Lrp2 T C 2: 69,466,880 I3246V probably benign Het
Lrrn3 G T 12: 41,453,518 L267I probably damaging Het
Map1s A G 8: 70,916,411 Y868C probably damaging Het
Mcm5 A G 8: 75,119,273 T370A possibly damaging Het
Nat8f7 T C 6: 85,707,811 S16G probably benign Het
Nav3 T C 10: 109,720,022 T1683A probably damaging Het
Nbeal2 T C 9: 110,627,129 N2417S probably damaging Het
Neb T C 2: 52,236,895 N3605S probably damaging Het
Net1 A T 13: 3,912,941 probably benign Het
Nsd1 A G 13: 55,313,351 T2464A possibly damaging Het
Nt5e T A 9: 88,370,187 I534N probably damaging Het
Nudt12 T A 17: 59,011,076 H58L probably damaging Het
Ocrl T A X: 47,962,116 I74N probably damaging Het
Olfr291 A G 7: 84,856,482 T38A probably damaging Het
Olfr403 A G 11: 74,195,653 H50R probably benign Het
Olfr695 A G 7: 106,874,141 Y35H probably damaging Het
Olfr826 A G 10: 130,180,832 I16T probably benign Het
Pef1 C A 4: 130,121,173 C10* probably null Het
Phf21b A G 15: 84,797,346 Y256H probably damaging Het
Phox2a G T 7: 101,820,945 probably null Het
Pi16 A G 17: 29,327,445 E399G possibly damaging Het
Pipox A T 11: 77,882,123 Y321N probably damaging Het
Plin4 A G 17: 56,103,522 S1170P probably damaging Het
Pnma2 C T 14: 66,917,213 S362L possibly damaging Het
Ppp1r9a T C 6: 5,113,710 I738T probably damaging Het
Prkcsh A T 9: 22,008,338 K188M probably damaging Het
Rcc1l A T 5: 134,163,659 Y309N probably damaging Het
Ripk1 A G 13: 34,015,213 T123A probably benign Het
Robo4 A G 9: 37,413,059 D961G probably benign Het
Rps27a A G 11: 29,546,299 Y105H probably benign Het
Scaper A G 9: 55,816,734 Y641H possibly damaging Het
Scn1a C A 2: 66,324,616 Q666H probably benign Het
Scn1a T A 2: 66,324,617 Q666L probably benign Het
Sdhaf4 T C 1: 24,003,153 probably null Het
Sec14l3 A G 11: 4,066,510 probably benign Het
Selp C A 1: 164,128,160 probably null Het
Sim1 A G 10: 50,909,828 D259G probably damaging Het
Sptan1 T A 2: 29,992,001 probably benign Het
Sptbn4 T A 7: 27,366,646 E679V probably null Het
Sytl3 G A 17: 6,728,327 E169K probably benign Het
Taar1 T C 10: 23,921,189 C262R probably benign Het
Tbc1d32 A G 10: 56,017,604 I1291T probably benign Het
Tcrg-C3 A G 13: 19,263,365 T163A possibly damaging Het
Tet1 G A 10: 62,813,665 P89S probably damaging Het
Tgfbrap1 C A 1: 43,071,635 G7W probably damaging Het
Thada A G 17: 84,226,004 V1673A possibly damaging Het
Thbs4 A G 13: 92,761,481 V610A probably benign Het
Tmem163 A G 1: 127,677,509 S41P probably benign Het
Tmem65 A T 15: 58,787,113 H200Q probably damaging Het
Trim62 T C 4: 128,909,225 V356A possibly damaging Het
Ttn T C 2: 76,732,158 D28781G probably damaging Het
Ttn C T 2: 76,763,260 V20679I probably benign Het
Unc80 A T 1: 66,639,248 T2063S possibly damaging Het
Vav3 A G 3: 109,506,426 T227A probably benign Het
Vmn2r118 A T 17: 55,592,456 I816N probably damaging Het
Vmn2r26 T A 6: 124,061,410 M648K possibly damaging Het
Vmn2r88 T G 14: 51,413,030 probably benign Het
Vwa3a A G 7: 120,790,136 T66A probably benign Het
Xirp2 T A 2: 67,511,140 Y1242N probably damaging Het
Ywhag G A 5: 135,911,530 T70M probably damaging Het
Zcchc6 A T 13: 59,814,935 Y339* probably null Het
Zfp248 T C 6: 118,428,970 T452A probably damaging Het
Zfp988 A T 4: 147,332,887 I593F probably damaging Het
Other mutations in Afm
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00911:Afm APN 5 90525591 missense probably benign 0.01
IGL01140:Afm APN 5 90524867 missense probably damaging 1.00
IGL01789:Afm APN 5 90525584 missense probably benign 0.32
IGL01819:Afm APN 5 90524906 missense probably benign 0.01
IGL01826:Afm APN 5 90524928 splice site probably benign
IGL01875:Afm APN 5 90548883 utr 3 prime probably benign
IGL02337:Afm APN 5 90547911 missense probably benign
IGL02902:Afm APN 5 90526363 missense possibly damaging 0.58
IGL02950:Afm APN 5 90531607 missense probably damaging 1.00
R0009:Afm UTSW 5 90545384 splice site probably benign
R0009:Afm UTSW 5 90545384 splice site probably benign
R0135:Afm UTSW 5 90550322 missense probably benign 0.00
R0582:Afm UTSW 5 90524780 splice site probably benign
R1416:Afm UTSW 5 90526379 missense possibly damaging 0.74
R1465:Afm UTSW 5 90550341 missense probably damaging 1.00
R1465:Afm UTSW 5 90550341 missense probably damaging 1.00
R1919:Afm UTSW 5 90524920 nonsense probably null
R2071:Afm UTSW 5 90523735 missense probably benign 0.17
R2843:Afm UTSW 5 90526465 nonsense probably null
R2979:Afm UTSW 5 90522163 missense probably benign 0.19
R4853:Afm UTSW 5 90551467 missense probably damaging 1.00
R5400:Afm UTSW 5 90551398 missense possibly damaging 0.86
R5551:Afm UTSW 5 90531652 missense probably null 0.97
R5583:Afm UTSW 5 90547881 missense probably damaging 1.00
R5780:Afm UTSW 5 90551431 missense possibly damaging 0.87
R7378:Afm UTSW 5 90551400 missense probably benign 0.00
R7470:Afm UTSW 5 90531627 missense probably damaging 0.99
R7785:Afm UTSW 5 90550173 missense possibly damaging 0.93
R7799:Afm UTSW 5 90523854 missense probably benign 0.00
R7809:Afm UTSW 5 90524816 missense probably damaging 1.00
R7897:Afm UTSW 5 90547868 missense probably benign 0.00
R7980:Afm UTSW 5 90547868 missense probably benign 0.00
X0022:Afm UTSW 5 90545414 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGTATGAATTGCCCTTGCTCC -3'
(R):5'- AAGCTGATCACTATGCATTGTGC -3'

Sequencing Primer
(F):5'- GCTCCTTCTACAATGCGTGTAAC -3'
(R):5'- GCATTGTGCACATAAAGGTATCAC -3'
Posted On2014-06-23