Incidental Mutation 'R1834:Vmn2r26'
ID 205045
Institutional Source Beutler Lab
Gene Symbol Vmn2r26
Ensembl Gene ENSMUSG00000096630
Gene Name vomeronasal 2, receptor 26
Synonyms V2r1b
MMRRC Submission 039861-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.094) question?
Stock # R1834 (G1)
Quality Score 225
Status Validated
Chromosome 6
Chromosomal Location 124001717-124038994 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 124038369 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Methionine to Lysine at position 648 (M648K)
Ref Sequence ENSEMBL: ENSMUSP00000032238 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032238]
AlphaFold Q6TAC4
Predicted Effect possibly damaging
Transcript: ENSMUST00000032238
AA Change: M648K

PolyPhen 2 Score 0.540 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000032238
Gene: ENSMUSG00000096630
AA Change: M648K

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
Pfam:ANF_receptor 82 471 1.5e-31 PFAM
Pfam:NCD3G 519 572 4.6e-25 PFAM
Pfam:7tm_3 603 840 1.5e-55 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000158682
Meta Mutation Damage Score 0.1795 question?
Coding Region Coverage
  • 1x: 97.4%
  • 3x: 96.8%
  • 10x: 95.1%
  • 20x: 92.0%
Validation Efficiency 97% (116/119)
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele exhibit abnormal vomeronasal sensory neuron physiology and avnosmia. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 114 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310033P09Rik A G 11: 59,099,313 (GRCm39) D20G probably damaging Het
2310061N02Rik T A 16: 88,504,786 (GRCm39) S4C unknown Het
Abca3 A T 17: 24,595,666 (GRCm39) N340Y probably benign Het
Abcc1 A G 16: 14,240,981 (GRCm39) I513V possibly damaging Het
Acacb C T 5: 114,373,536 (GRCm39) T1855M probably damaging Het
Ace A G 11: 105,876,920 (GRCm39) probably benign Het
Acss2 T A 2: 155,400,550 (GRCm39) Y530N probably damaging Het
Adarb1 C A 10: 77,153,065 (GRCm39) probably benign Het
Afm T A 5: 90,674,283 (GRCm39) M265K probably benign Het
Agl A G 3: 116,582,000 (GRCm39) F293S probably benign Het
Aox1 G A 1: 58,348,150 (GRCm39) A623T probably benign Het
Arhgap31 C A 16: 38,424,065 (GRCm39) S667I probably benign Het
Bco1 A G 8: 117,844,176 (GRCm39) T297A probably benign Het
Bmp1 T C 14: 70,746,271 (GRCm39) S123G possibly damaging Het
Caps2 G A 10: 112,031,623 (GRCm39) D283N possibly damaging Het
Ccdc57 A C 11: 120,752,045 (GRCm39) S845R probably benign Het
Cd209f A G 8: 4,154,491 (GRCm39) S119P probably damaging Het
Chrna6 A G 8: 27,897,242 (GRCm39) S212P probably benign Het
Col10a1 G C 10: 34,271,011 (GRCm39) A328P probably damaging Het
Col4a2 A G 8: 11,452,997 (GRCm39) E188G probably benign Het
Creb1 C T 1: 64,590,109 (GRCm39) Q32* probably null Het
Cttnbp2 C T 6: 18,501,965 (GRCm39) V16M probably damaging Het
D430041D05Rik A G 2: 103,998,446 (GRCm39) S1102P probably damaging Het
Ddx31 C T 2: 28,782,465 (GRCm39) H603Y probably damaging Het
Ddx52 G A 11: 83,850,323 (GRCm39) C568Y probably benign Het
Dgki C A 6: 37,011,636 (GRCm39) probably benign Het
Dmrt1 A T 19: 25,487,063 (GRCm39) Q123L probably damaging Het
Dnah5 A T 15: 28,409,270 (GRCm39) M3563L probably benign Het
Dnah7b A T 1: 46,272,919 (GRCm39) N2349I possibly damaging Het
Dscaml1 T G 9: 45,594,930 (GRCm39) S678A probably benign Het
Ece1 C T 4: 137,685,312 (GRCm39) R601W probably damaging Het
Ece1 A G 4: 137,685,439 (GRCm39) N643S probably damaging Het
Eno1b A G 18: 48,180,530 (GRCm39) Y236C probably damaging Het
Esco1 T C 18: 10,594,350 (GRCm39) E312G probably damaging Het
Eya3 T A 4: 132,434,429 (GRCm39) V276E probably damaging Het
Fam161b A G 12: 84,395,552 (GRCm39) probably benign Het
Fem1c C T 18: 46,638,349 (GRCm39) G551D probably damaging Het
Fer1l6 T C 15: 58,429,718 (GRCm39) I155T possibly damaging Het
Gbp7 A G 3: 142,240,441 (GRCm39) Y53C probably damaging Het
Gjb3 G A 4: 127,220,224 (GRCm39) R103W probably damaging Het
Gm10030 C T 9: 110,833,947 (GRCm39) noncoding transcript Het
Gm3443 T A 19: 21,533,043 (GRCm39) H2Q unknown Het
Gm5800 T C 14: 51,953,549 (GRCm39) E22G possibly damaging Het
Gsdma2 G T 11: 98,539,905 (GRCm39) R9L probably damaging Het
Gvin3 A T 7: 106,202,983 (GRCm39) V87D possibly damaging Het
Ica1l A G 1: 60,067,395 (GRCm39) probably benign Het
Ice1 G A 13: 70,763,457 (GRCm39) T167I probably damaging Het
Ifi204 T A 1: 173,575,172 (GRCm39) R618S unknown Het
Itga2 C A 13: 114,993,262 (GRCm39) K784N probably damaging Het
Itga2 T A 13: 114,993,263 (GRCm39) K784M probably damaging Het
Kif3b A G 2: 153,159,405 (GRCm39) E402G probably benign Het
Lrp2 T C 2: 69,297,224 (GRCm39) I3246V probably benign Het
Lrrn3 G T 12: 41,503,517 (GRCm39) L267I probably damaging Het
Map1s A G 8: 71,369,055 (GRCm39) Y868C probably damaging Het
Mcm5 A G 8: 75,845,901 (GRCm39) T370A possibly damaging Het
Nat8f7 T C 6: 85,684,793 (GRCm39) S16G probably benign Het
Nav3 T C 10: 109,555,883 (GRCm39) T1683A probably damaging Het
Nbeal2 T C 9: 110,456,197 (GRCm39) N2417S probably damaging Het
Neb T C 2: 52,126,907 (GRCm39) N3605S probably damaging Het
Net1 A T 13: 3,962,941 (GRCm39) probably benign Het
Nsd1 A G 13: 55,461,164 (GRCm39) T2464A possibly damaging Het
Nt5e T A 9: 88,252,240 (GRCm39) I534N probably damaging Het
Nudt12 T A 17: 59,318,071 (GRCm39) H58L probably damaging Het
Ocrl T A X: 47,050,993 (GRCm39) I74N probably damaging Het
Or1a1 A G 11: 74,086,479 (GRCm39) H50R probably benign Het
Or2ag13 A G 7: 106,473,348 (GRCm39) Y35H probably damaging Het
Or5ae2 A G 7: 84,505,690 (GRCm39) T38A probably damaging Het
Or9k2b A G 10: 130,016,701 (GRCm39) I16T probably benign Het
Pef1 C A 4: 130,014,966 (GRCm39) C10* probably null Het
Phf21b A G 15: 84,681,547 (GRCm39) Y256H probably damaging Het
Phox2a G T 7: 101,470,152 (GRCm39) probably null Het
Pi16 A G 17: 29,546,419 (GRCm39) E399G possibly damaging Het
Pipox A T 11: 77,772,949 (GRCm39) Y321N probably damaging Het
Plin4 A G 17: 56,410,522 (GRCm39) S1170P probably damaging Het
Pnma2 C T 14: 67,154,662 (GRCm39) S362L possibly damaging Het
Ppp1r9a T C 6: 5,113,710 (GRCm39) I738T probably damaging Het
Prkcsh A T 9: 21,919,634 (GRCm39) K188M probably damaging Het
Rcc1l A T 5: 134,192,498 (GRCm39) Y309N probably damaging Het
Ripk1 A G 13: 34,199,196 (GRCm39) T123A probably benign Het
Robo4 A G 9: 37,324,355 (GRCm39) D961G probably benign Het
Rps27a A G 11: 29,496,299 (GRCm39) Y105H probably benign Het
Scaper A G 9: 55,724,018 (GRCm39) Y641H possibly damaging Het
Scn1a C A 2: 66,154,960 (GRCm39) Q666H probably benign Het
Scn1a T A 2: 66,154,961 (GRCm39) Q666L probably benign Het
Sdhaf4 T C 1: 24,042,234 (GRCm39) probably null Het
Sec14l3 A G 11: 4,016,510 (GRCm39) probably benign Het
Selp C A 1: 163,955,729 (GRCm39) probably null Het
Sim1 A G 10: 50,785,924 (GRCm39) D259G probably damaging Het
Sptan1 T A 2: 29,882,013 (GRCm39) probably benign Het
Sptbn4 T A 7: 27,066,071 (GRCm39) E679V probably null Het
Sytl3 G A 17: 6,995,726 (GRCm39) E169K probably benign Het
Taar1 T C 10: 23,797,087 (GRCm39) C262R probably benign Het
Taf7l2 T C 10: 115,948,570 (GRCm39) R319G probably benign Het
Tbc1d32 A G 10: 55,893,700 (GRCm39) I1291T probably benign Het
Tet1 G A 10: 62,649,444 (GRCm39) P89S probably damaging Het
Tgfbrap1 C A 1: 43,110,795 (GRCm39) G7W probably damaging Het
Thada A G 17: 84,533,432 (GRCm39) V1673A possibly damaging Het
Thbs4 A G 13: 92,897,989 (GRCm39) V610A probably benign Het
Tmem163 A G 1: 127,605,246 (GRCm39) S41P probably benign Het
Tmem65 A T 15: 58,658,962 (GRCm39) H200Q probably damaging Het
Trgc3 A G 13: 19,447,535 (GRCm39) T163A possibly damaging Het
Trim62 T C 4: 128,803,018 (GRCm39) V356A possibly damaging Het
Ttn T C 2: 76,562,502 (GRCm39) D28781G probably damaging Het
Ttn C T 2: 76,593,604 (GRCm39) V20679I probably benign Het
Tut7 A T 13: 59,962,749 (GRCm39) Y339* probably null Het
Unc80 A T 1: 66,678,407 (GRCm39) T2063S possibly damaging Het
Vav3 A G 3: 109,413,742 (GRCm39) T227A probably benign Het
Vmn2r118 A T 17: 55,899,456 (GRCm39) I816N probably damaging Het
Vmn2r88 T G 14: 51,650,487 (GRCm39) probably benign Het
Vwa3a A G 7: 120,389,359 (GRCm39) T66A probably benign Het
Xirp2 T A 2: 67,341,484 (GRCm39) Y1242N probably damaging Het
Ywhag G A 5: 135,940,384 (GRCm39) T70M probably damaging Het
Zfp248 T C 6: 118,405,931 (GRCm39) T452A probably damaging Het
Zfp988 A T 4: 147,417,344 (GRCm39) I593F probably damaging Het
Other mutations in Vmn2r26
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01070:Vmn2r26 APN 6 124,038,566 (GRCm39) missense probably benign 0.00
IGL01370:Vmn2r26 APN 6 124,038,715 (GRCm39) missense probably benign 0.08
IGL01603:Vmn2r26 APN 6 124,030,833 (GRCm39) missense probably damaging 1.00
IGL01651:Vmn2r26 APN 6 124,027,632 (GRCm39) missense probably benign 0.01
IGL02282:Vmn2r26 APN 6 124,038,584 (GRCm39) missense probably damaging 1.00
IGL02425:Vmn2r26 APN 6 124,038,777 (GRCm39) missense probably damaging 1.00
IGL02551:Vmn2r26 APN 6 124,003,100 (GRCm39) missense probably benign 0.11
IGL02690:Vmn2r26 APN 6 124,003,091 (GRCm39) missense probably benign 0.14
IGL03002:Vmn2r26 APN 6 124,016,754 (GRCm39) missense possibly damaging 0.78
IGL03270:Vmn2r26 APN 6 124,027,778 (GRCm39) missense probably benign 0.16
R0032:Vmn2r26 UTSW 6 124,016,858 (GRCm39) missense possibly damaging 0.72
R0052:Vmn2r26 UTSW 6 124,038,992 (GRCm39) makesense probably null
R0083:Vmn2r26 UTSW 6 124,030,940 (GRCm39) splice site probably null
R0682:Vmn2r26 UTSW 6 124,038,129 (GRCm39) missense probably damaging 0.97
R1061:Vmn2r26 UTSW 6 124,038,603 (GRCm39) missense probably benign 0.12
R1077:Vmn2r26 UTSW 6 124,030,872 (GRCm39) missense probably benign 0.00
R1263:Vmn2r26 UTSW 6 124,027,667 (GRCm39) missense probably benign
R1579:Vmn2r26 UTSW 6 124,016,706 (GRCm39) missense probably benign 0.00
R1741:Vmn2r26 UTSW 6 124,038,431 (GRCm39) missense probably damaging 1.00
R1838:Vmn2r26 UTSW 6 124,001,730 (GRCm39) missense probably benign
R1956:Vmn2r26 UTSW 6 124,030,846 (GRCm39) missense probably damaging 1.00
R1996:Vmn2r26 UTSW 6 124,038,144 (GRCm39) missense probably damaging 1.00
R2140:Vmn2r26 UTSW 6 124,038,196 (GRCm39) missense probably benign 0.01
R2327:Vmn2r26 UTSW 6 124,016,708 (GRCm39) missense probably benign 0.07
R2417:Vmn2r26 UTSW 6 124,038,309 (GRCm39) missense probably damaging 1.00
R3930:Vmn2r26 UTSW 6 124,002,938 (GRCm39) missense probably benign
R4490:Vmn2r26 UTSW 6 124,027,697 (GRCm39) missense possibly damaging 0.47
R4629:Vmn2r26 UTSW 6 124,038,150 (GRCm39) missense possibly damaging 0.50
R4655:Vmn2r26 UTSW 6 124,038,375 (GRCm39) missense probably damaging 1.00
R4709:Vmn2r26 UTSW 6 124,030,924 (GRCm39) missense probably damaging 1.00
R4992:Vmn2r26 UTSW 6 124,003,070 (GRCm39) missense probably benign 0.00
R5297:Vmn2r26 UTSW 6 124,038,832 (GRCm39) missense probably damaging 1.00
R5482:Vmn2r26 UTSW 6 124,038,285 (GRCm39) missense possibly damaging 0.88
R5517:Vmn2r26 UTSW 6 124,027,676 (GRCm39) missense probably damaging 1.00
R5737:Vmn2r26 UTSW 6 124,016,408 (GRCm39) missense probably benign 0.00
R5739:Vmn2r26 UTSW 6 124,002,925 (GRCm39) missense probably benign 0.00
R5873:Vmn2r26 UTSW 6 124,038,633 (GRCm39) missense probably benign 0.01
R5907:Vmn2r26 UTSW 6 124,016,830 (GRCm39) missense probably benign 0.00
R6086:Vmn2r26 UTSW 6 124,016,519 (GRCm39) missense possibly damaging 0.48
R6134:Vmn2r26 UTSW 6 124,038,444 (GRCm39) missense probably damaging 0.97
R6391:Vmn2r26 UTSW 6 124,038,348 (GRCm39) missense probably damaging 1.00
R6428:Vmn2r26 UTSW 6 124,003,039 (GRCm39) missense probably benign 0.17
R6637:Vmn2r26 UTSW 6 124,038,650 (GRCm39) missense probably damaging 1.00
R6927:Vmn2r26 UTSW 6 124,016,057 (GRCm39) missense possibly damaging 0.93
R6953:Vmn2r26 UTSW 6 124,016,741 (GRCm39) missense probably benign 0.00
R7173:Vmn2r26 UTSW 6 124,038,255 (GRCm39) missense probably benign 0.16
R7206:Vmn2r26 UTSW 6 124,016,727 (GRCm39) missense probably benign 0.17
R7208:Vmn2r26 UTSW 6 124,038,948 (GRCm39) missense probably damaging 1.00
R7283:Vmn2r26 UTSW 6 124,002,914 (GRCm39) missense probably damaging 0.97
R7506:Vmn2r26 UTSW 6 124,016,700 (GRCm39) missense probably benign 0.00
R7672:Vmn2r26 UTSW 6 124,016,606 (GRCm39) missense probably benign 0.25
R7674:Vmn2r26 UTSW 6 124,016,321 (GRCm39) missense probably benign
R7696:Vmn2r26 UTSW 6 124,038,494 (GRCm39) missense possibly damaging 0.94
R7716:Vmn2r26 UTSW 6 124,038,704 (GRCm39) missense probably damaging 1.00
R7831:Vmn2r26 UTSW 6 124,016,758 (GRCm39) nonsense probably null
R8063:Vmn2r26 UTSW 6 124,001,914 (GRCm39) missense probably benign 0.00
R8331:Vmn2r26 UTSW 6 124,038,887 (GRCm39) missense probably benign 0.22
R8352:Vmn2r26 UTSW 6 124,016,577 (GRCm39) missense probably benign 0.09
R8445:Vmn2r26 UTSW 6 124,002,995 (GRCm39) missense probably damaging 0.97
R8452:Vmn2r26 UTSW 6 124,016,577 (GRCm39) missense probably benign 0.09
R8681:Vmn2r26 UTSW 6 124,001,877 (GRCm39) missense probably benign 0.00
R8914:Vmn2r26 UTSW 6 124,038,983 (GRCm39) missense probably benign
R9333:Vmn2r26 UTSW 6 124,003,009 (GRCm39) missense probably benign 0.13
R9351:Vmn2r26 UTSW 6 124,016,333 (GRCm39) missense probably benign
R9436:Vmn2r26 UTSW 6 124,002,826 (GRCm39) missense probably damaging 1.00
R9515:Vmn2r26 UTSW 6 124,038,137 (GRCm39) missense probably damaging 1.00
RF010:Vmn2r26 UTSW 6 124,016,448 (GRCm39) missense possibly damaging 0.90
Predicted Primers PCR Primer
(F):5'- ATAAACAGAGGAATCAGTGTCTCCC -3'
(R):5'- TTTGAGAGTCGGGTCACCATC -3'

Sequencing Primer
(F):5'- TTGGCCCATGAAGATCCACTG -3'
(R):5'- GGGTCACCATCCCCATTTTTAAGATG -3'
Posted On 2014-06-23