Mutagenetix > Incidental Mutation

Incidental Mutation 'R1834:Sptbn4'

205047

Institutional Source

Beutler Lab

Gene Symbol

Sptbn4

Ensembl Gene

ENSMUSG00000011751

Gene Name

spectrin beta, non-erythrocytic 4

Synonyms

ROSA62, 1700022P15Rik, dyn, neuroaxonal dystrophy, 5830426A08Rik, nmf261, SpbIV, Spnb4

MMRRC Submission

039861-MU

Accession Numbers

Essential gene?

Possibly non essential (E-score: 0.464) question?

Stock #

R1834 (G1)

Quality Score

198

Status

Validated

Chromosome

Chromosomal Location

27356383-27447686 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 27366646 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Glutamic Acid to Valine at position 679 (E679V)

Ref Sequence

ENSEMBL: ENSMUSP00000104001 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000011895] [ENSMUST00000108362] [ENSMUST00000108363] [ENSMUST00000108364] [ENSMUST00000172269]

AlphaFold

E9PX29

Predicted Effect

probably null
Transcript: ENSMUST00000011895
AA Change: E1999V

PolyPhen 2 Score 0.637 (Sensitivity: 0.87; Specificity: 0.91)

SMART Domains

Protein: ENSMUSP00000011895
Gene: ENSMUSG00000011751
AA Change: E1999V

Domain	Start	End	E-Value	Type
low complexity region	39	45	N/A	INTRINSIC
CH	64	164	8.03e-24	SMART
CH	183	281	7.38e-23	SMART
Pfam:Spectrin	310	420	1.4e-10	PFAM
SPEC	433	533	5.22e-26	SMART
SPEC	539	642	7.62e-19	SMART
SPEC	648	766	1.31e-8	SMART
SPEC	772	874	2.94e-11	SMART
SPEC	880	980	1.49e-21	SMART
SPEC	986	1081	1.65e0	SMART
SPEC	1087	1192	2.82e-13	SMART
SPEC	1198	1298	6.59e-14	SMART
SPEC	1304	1403	4.08e-19	SMART
SPEC	1409	1508	5.92e-7	SMART
SPEC	1514	1614	2.45e-22	SMART
SPEC	1620	1720	1.45e-24	SMART
SPEC	1726	1827	1.86e-22	SMART
SPEC	1833	1935	9.54e-11	SMART
SPEC	1941	2041	1.35e-19	SMART
SPEC	2047	2297	1.06e-8	SMART
low complexity region	2358	2412	N/A	INTRINSIC
PH	2416	2526	1.54e-14	SMART
low complexity region	2549	2560	N/A	INTRINSIC

Predicted Effect

probably null
Transcript: ENSMUST00000108362
AA Change: E679V

PolyPhen 2 Score 0.956 (Sensitivity: 0.79; Specificity: 0.95)

SMART Domains

Protein: ENSMUSP00000103999
Gene: ENSMUSG00000011751
AA Change: E679V

Domain	Start	End	E-Value	Type
SPEC	1	83	9.7e-3	SMART
SPEC	89	188	5.92e-7	SMART
SPEC	194	294	2.45e-22	SMART
SPEC	300	400	1.45e-24	SMART
SPEC	406	507	1.86e-22	SMART
SPEC	513	615	9.54e-11	SMART
SPEC	621	721	1.35e-19	SMART
SPEC	727	977	1.06e-8	SMART
low complexity region	1038	1092	N/A	INTRINSIC
PH	1096	1206	1.54e-14	SMART
low complexity region	1229	1240	N/A	INTRINSIC

Predicted Effect

probably null
Transcript: ENSMUST00000108363
AA Change: E679V

PolyPhen 2 Score 0.956 (Sensitivity: 0.79; Specificity: 0.95)

SMART Domains

Protein: ENSMUSP00000104000
Gene: ENSMUSG00000011751
AA Change: E679V

Domain	Start	End	E-Value	Type
SPEC	1	83	9.7e-3	SMART
SPEC	89	188	5.92e-7	SMART
SPEC	194	294	2.45e-22	SMART
SPEC	300	400	1.45e-24	SMART
SPEC	406	507	1.86e-22	SMART
SPEC	513	615	9.54e-11	SMART
SPEC	621	721	1.35e-19	SMART
SPEC	727	977	1.06e-8	SMART
low complexity region	1038	1092	N/A	INTRINSIC
PH	1096	1206	1.54e-14	SMART
low complexity region	1229	1240	N/A	INTRINSIC

Predicted Effect

probably null
Transcript: ENSMUST00000108364
AA Change: E679V

PolyPhen 2 Score 0.956 (Sensitivity: 0.79; Specificity: 0.95)

SMART Domains

Protein: ENSMUSP00000104001
Gene: ENSMUSG00000011751
AA Change: E679V

Domain	Start	End	E-Value	Type
SPEC	1	83	9.7e-3	SMART
SPEC	89	188	5.92e-7	SMART
SPEC	194	294	2.45e-22	SMART
SPEC	300	400	1.45e-24	SMART
SPEC	406	507	1.86e-22	SMART
SPEC	513	615	9.54e-11	SMART
SPEC	621	721	1.35e-19	SMART
SPEC	727	977	1.06e-8	SMART
low complexity region	1038	1092	N/A	INTRINSIC
PH	1096	1206	1.54e-14	SMART
low complexity region	1229	1240	N/A	INTRINSIC

Predicted Effect

probably null
Transcript: ENSMUST00000172269
AA Change: E1994V

PolyPhen 2 Score 0.334 (Sensitivity: 0.90; Specificity: 0.89)

SMART Domains

Protein: ENSMUSP00000132807
Gene: ENSMUSG00000011751
AA Change: E1994V

Domain	Start	End	E-Value	Type
low complexity region	39	45	N/A	INTRINSIC
CH	64	164	8.03e-24	SMART
CH	183	281	7.38e-23	SMART
Pfam:Spectrin	310	420	1.9e-10	PFAM
SPEC	433	533	5.22e-26	SMART
SPEC	539	637	3.45e-17	SMART
SPEC	643	761	1.31e-8	SMART
SPEC	767	869	2.94e-11	SMART
SPEC	875	975	1.49e-21	SMART
SPEC	981	1076	1.65e0	SMART
SPEC	1082	1187	2.82e-13	SMART
SPEC	1193	1293	6.59e-14	SMART
SPEC	1299	1398	4.08e-19	SMART
SPEC	1404	1503	5.92e-7	SMART
SPEC	1509	1609	2.45e-22	SMART
SPEC	1615	1715	1.45e-24	SMART
SPEC	1721	1822	1.86e-22	SMART
SPEC	1828	1930	9.54e-11	SMART
SPEC	1936	2036	1.35e-19	SMART
SPEC	2042	2292	1.06e-8	SMART
low complexity region	2352	2406	N/A	INTRINSIC
PH	2410	2520	1.54e-14	SMART
low complexity region	2543	2554	N/A	INTRINSIC

Meta Mutation Damage Score

0.8329

Coding Region Coverage

1x: 97.4%
3x: 96.8%
10x: 95.1%
20x: 92.0%

Validation Efficiency

97% (116/119)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Spectrin is an actin crosslinking and molecular scaffold protein that links the plasma membrane to the actin cytoskeleton, and functions in the determination of cell shape, arrangement of transmembrane proteins, and organization of organelles. It is composed of two antiparallel dimers of alpha- and beta- subunits. This gene is one member of a family of beta-spectrin genes. The encoded protein localizes to the nuclear matrix, PML nuclear bodies, and cytoplasmic vesicles. A highly similar gene in the mouse is required for localization of specific membrane proteins in polarized regions of neurons. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for spontaneous mutations exhibit tremors, progressive ataxia with hind limb paralysis, central deafness, reduced body weight, and shortened lifespan. Males are sterile, but females may breed. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 114 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2310033P09Rik	A	G	11: 59,208,487	D20G	probably damaging	Het
2310061N02Rik	T	A	16: 88,707,898	S4C	unknown	Het
4933416C03Rik	T	C	10: 116,112,665	R319G	probably benign	Het
Abca3	A	T	17: 24,376,692	N340Y	probably benign	Het
Abcc1	A	G	16: 14,423,117	I513V	possibly damaging	Het
Acacb	C	T	5: 114,235,475	T1855M	probably damaging	Het
Ace	A	G	11: 105,986,094		probably benign	Het
Acss2	T	A	2: 155,558,630	Y530N	probably damaging	Het
Adarb1	C	A	10: 77,317,231		probably benign	Het
Afm	T	A	5: 90,526,424	M265K	probably benign	Het
Agl	A	G	3: 116,788,351	F293S	probably benign	Het
Aox2	G	A	1: 58,308,991	A623T	probably benign	Het
Arhgap31	C	A	16: 38,603,703	S667I	probably benign	Het
Bco1	A	G	8: 117,117,437	T297A	probably benign	Het
Bmp1	T	C	14: 70,508,831	S123G	possibly damaging	Het
Caps2	G	A	10: 112,195,718	D283N	possibly damaging	Het
Ccdc57	A	C	11: 120,861,219	S845R	probably benign	Het
Cd209f	A	G	8: 4,104,491	S119P	probably damaging	Het
Chrna6	A	G	8: 27,407,214	S212P	probably benign	Het
Col10a1	G	C	10: 34,395,015	A328P	probably damaging	Het
Col4a2	A	G	8: 11,402,997	E188G	probably benign	Het
Creb1	C	T	1: 64,550,950	Q32*	probably null	Het
Cttnbp2	C	T	6: 18,501,966	V16M	probably damaging	Het
D430041D05Rik	A	G	2: 104,168,101	S1102P	probably damaging	Het
Ddx31	C	T	2: 28,892,453	H603Y	probably damaging	Het
Ddx52	G	A	11: 83,959,497	C568Y	probably benign	Het
Dgki	C	A	6: 37,034,701		probably benign	Het
Dmrt1	A	T	19: 25,509,699	Q123L	probably damaging	Het
Dnah5	A	T	15: 28,409,124	M3563L	probably benign	Het
Dnah7b	A	T	1: 46,233,759	N2349I	possibly damaging	Het
Dscaml1	T	G	9: 45,683,632	S678A	probably benign	Het
Ece1	C	T	4: 137,958,001	R601W	probably damaging	Het
Ece1	A	G	4: 137,958,128	N643S	probably damaging	Het
Eno1b	A	G	18: 48,047,463	Y236C	probably damaging	Het
Esco1	T	C	18: 10,594,350	E312G	probably damaging	Het
Eya3	T	A	4: 132,707,118	V276E	probably damaging	Het
Fam161b	A	G	12: 84,348,778		probably benign	Het
Fem1c	C	T	18: 46,505,282	G551D	probably damaging	Het
Fer1l6	T	C	15: 58,557,869	I155T	possibly damaging	Het
Gbp7	A	G	3: 142,534,680	Y53C	probably damaging	Het
Gjb3	G	A	4: 127,326,431	R103W	probably damaging	Het
Gm10030	C	T	9: 111,004,879		noncoding transcript	Het
Gm1966	A	T	7: 106,603,776	V87D	possibly damaging	Het
Gm3443	T	A	19: 21,555,679	H2Q	unknown	Het
Gm5800	T	C	14: 51,716,092	E22G	possibly damaging	Het
Gsdma2	G	T	11: 98,649,079	R9L	probably damaging	Het
Ica1l	A	G	1: 60,028,236		probably benign	Het
Ice1	G	A	13: 70,615,338	T167I	probably damaging	Het
Ifi204	T	A	1: 173,747,606	R618S	unknown	Het
Itga2	C	A	13: 114,856,726	K784N	probably damaging	Het
Itga2	T	A	13: 114,856,727	K784M	probably damaging	Het
Kif3b	A	G	2: 153,317,485	E402G	probably benign	Het
Lrp2	T	C	2: 69,466,880	I3246V	probably benign	Het
Lrrn3	G	T	12: 41,453,518	L267I	probably damaging	Het
Map1s	A	G	8: 70,916,411	Y868C	probably damaging	Het
Mcm5	A	G	8: 75,119,273	T370A	possibly damaging	Het
Nat8f7	T	C	6: 85,707,811	S16G	probably benign	Het
Nav3	T	C	10: 109,720,022	T1683A	probably damaging	Het
Nbeal2	T	C	9: 110,627,129	N2417S	probably damaging	Het
Neb	T	C	2: 52,236,895	N3605S	probably damaging	Het
Net1	A	T	13: 3,912,941		probably benign	Het
Nsd1	A	G	13: 55,313,351	T2464A	possibly damaging	Het
Nt5e	T	A	9: 88,370,187	I534N	probably damaging	Het
Nudt12	T	A	17: 59,011,076	H58L	probably damaging	Het
Ocrl	T	A	X: 47,962,116	I74N	probably damaging	Het
Olfr291	A	G	7: 84,856,482	T38A	probably damaging	Het
Olfr403	A	G	11: 74,195,653	H50R	probably benign	Het
Olfr695	A	G	7: 106,874,141	Y35H	probably damaging	Het
Olfr826	A	G	10: 130,180,832	I16T	probably benign	Het
Pef1	C	A	4: 130,121,173	C10*	probably null	Het
Phf21b	A	G	15: 84,797,346	Y256H	probably damaging	Het
Phox2a	G	T	7: 101,820,945		probably null	Het
Pi16	A	G	17: 29,327,445	E399G	possibly damaging	Het
Pipox	A	T	11: 77,882,123	Y321N	probably damaging	Het
Plin4	A	G	17: 56,103,522	S1170P	probably damaging	Het
Pnma2	C	T	14: 66,917,213	S362L	possibly damaging	Het
Ppp1r9a	T	C	6: 5,113,710	I738T	probably damaging	Het
Prkcsh	A	T	9: 22,008,338	K188M	probably damaging	Het
Rcc1l	A	T	5: 134,163,659	Y309N	probably damaging	Het
Ripk1	A	G	13: 34,015,213	T123A	probably benign	Het
Robo4	A	G	9: 37,413,059	D961G	probably benign	Het
Rps27a	A	G	11: 29,546,299	Y105H	probably benign	Het
Scaper	A	G	9: 55,816,734	Y641H	possibly damaging	Het
Scn1a	C	A	2: 66,324,616	Q666H	probably benign	Het
Scn1a	T	A	2: 66,324,617	Q666L	probably benign	Het
Sdhaf4	T	C	1: 24,003,153		probably null	Het
Sec14l3	A	G	11: 4,066,510		probably benign	Het
Selp	C	A	1: 164,128,160		probably null	Het
Sim1	A	G	10: 50,909,828	D259G	probably damaging	Het
Sptan1	T	A	2: 29,992,001		probably benign	Het
Sytl3	G	A	17: 6,728,327	E169K	probably benign	Het
Taar1	T	C	10: 23,921,189	C262R	probably benign	Het
Tbc1d32	A	G	10: 56,017,604	I1291T	probably benign	Het
Tcrg-C3	A	G	13: 19,263,365	T163A	possibly damaging	Het
Tet1	G	A	10: 62,813,665	P89S	probably damaging	Het
Tgfbrap1	C	A	1: 43,071,635	G7W	probably damaging	Het
Thada	A	G	17: 84,226,004	V1673A	possibly damaging	Het
Thbs4	A	G	13: 92,761,481	V610A	probably benign	Het
Tmem163	A	G	1: 127,677,509	S41P	probably benign	Het
Tmem65	A	T	15: 58,787,113	H200Q	probably damaging	Het
Trim62	T	C	4: 128,909,225	V356A	possibly damaging	Het
Ttn	T	C	2: 76,732,158	D28781G	probably damaging	Het
Ttn	C	T	2: 76,763,260	V20679I	probably benign	Het
Unc80	A	T	1: 66,639,248	T2063S	possibly damaging	Het
Vav3	A	G	3: 109,506,426	T227A	probably benign	Het
Vmn2r118	A	T	17: 55,592,456	I816N	probably damaging	Het
Vmn2r26	T	A	6: 124,061,410	M648K	possibly damaging	Het
Vmn2r88	T	G	14: 51,413,030		probably benign	Het
Vwa3a	A	G	7: 120,790,136	T66A	probably benign	Het
Xirp2	T	A	2: 67,511,140	Y1242N	probably damaging	Het
Ywhag	G	A	5: 135,911,530	T70M	probably damaging	Het
Zcchc6	A	T	13: 59,814,935	Y339*	probably null	Het
Zfp248	T	C	6: 118,428,970	T452A	probably damaging	Het
Zfp988	A	T	4: 147,332,887	I593F	probably damaging	Het

Other mutations in Sptbn4

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00096:Sptbn4	APN	7	27369434	missense	probably damaging	1.00
IGL00468:Sptbn4	APN	7	27417965	missense	probably damaging	1.00
IGL01396:Sptbn4	APN	7	27414771	missense	probably benign	0.06
IGL01700:Sptbn4	APN	7	27404268	missense	probably damaging	1.00
IGL01878:Sptbn4	APN	7	27364146	missense	probably damaging	0.99
IGL02066:Sptbn4	APN	7	27364515	missense	possibly damaging	0.68
IGL02116:Sptbn4	APN	7	27364357	missense	probably benign
IGL02226:Sptbn4	APN	7	27365707	missense	probably damaging	1.00
IGL02333:Sptbn4	APN	7	27364299	missense	probably damaging	1.00
IGL02337:Sptbn4	APN	7	27428247	missense	probably benign	0.03
IGL02451:Sptbn4	APN	7	27365589	missense	probably null	0.15
IGL02487:Sptbn4	APN	7	27419097	missense	probably damaging	1.00
IGL02530:Sptbn4	APN	7	27391551	missense	probably damaging	1.00
IGL02724:Sptbn4	APN	7	27367679	missense	probably damaging	1.00
IGL02850:Sptbn4	APN	7	27426833	missense	possibly damaging	0.95
IGL02851:Sptbn4	APN	7	27426833	missense	possibly damaging	0.95
IGL02869:Sptbn4	APN	7	27394148	splice site	probably benign
IGL02961:Sptbn4	APN	7	27397967	missense	probably damaging	1.00
ANU22:Sptbn4	UTSW	7	27357387	nonsense	probably null
R0194:Sptbn4	UTSW	7	27404911	missense	probably benign	0.00
R0328:Sptbn4	UTSW	7	27364170	missense	probably damaging	1.00
R0379:Sptbn4	UTSW	7	27359736	splice site	probably benign
R0510:Sptbn4	UTSW	7	27361566	critical splice donor site	probably null
R0550:Sptbn4	UTSW	7	27364378	missense	probably benign	0.16
R0557:Sptbn4	UTSW	7	27408328	nonsense	probably null
R1336:Sptbn4	UTSW	7	27417963	missense	probably damaging	1.00
R1494:Sptbn4	UTSW	7	27434294	missense	probably damaging	1.00
R1630:Sptbn4	UTSW	7	27418739	missense	probably benign	0.09
R1803:Sptbn4	UTSW	7	27418583	missense	probably damaging	1.00
R1906:Sptbn4	UTSW	7	27391431	critical splice donor site	probably null
R1924:Sptbn4	UTSW	7	27407138	missense	probably damaging	1.00
R1951:Sptbn4	UTSW	7	27366443	missense	possibly damaging	0.64
R1989:Sptbn4	UTSW	7	27367702	missense	probably damaging	1.00
R1990:Sptbn4	UTSW	7	27423810	missense	probably benign	0.19
R2005:Sptbn4	UTSW	7	27366419	nonsense	probably null
R2083:Sptbn4	UTSW	7	27428256	missense	probably benign	0.29
R2176:Sptbn4	UTSW	7	27364162	missense	probably benign	0.21
R2211:Sptbn4	UTSW	7	27367609	missense	probably damaging	1.00
R2262:Sptbn4	UTSW	7	27434357	missense	probably damaging	1.00
R2263:Sptbn4	UTSW	7	27434357	missense	probably damaging	1.00
R2374:Sptbn4	UTSW	7	27360092	missense	probably damaging	0.99
R2407:Sptbn4	UTSW	7	27418098	nonsense	probably null
R4115:Sptbn4	UTSW	7	27391570	missense	probably damaging	1.00
R4116:Sptbn4	UTSW	7	27391570	missense	probably damaging	1.00
R4392:Sptbn4	UTSW	7	27418471	missense	probably damaging	0.97
R4426:Sptbn4	UTSW	7	27423798	missense	probably damaging	1.00
R4535:Sptbn4	UTSW	7	27367702	missense	probably damaging	1.00
R4684:Sptbn4	UTSW	7	27364419	missense	probably damaging	0.96
R4684:Sptbn4	UTSW	7	27366735	missense	possibly damaging	0.60
R4707:Sptbn4	UTSW	7	27417006	missense	probably benign	0.12
R4876:Sptbn4	UTSW	7	27372152	missense	probably damaging	1.00
R5091:Sptbn4	UTSW	7	27369391	missense	probably damaging	1.00
R5371:Sptbn4	UTSW	7	27359741	critical splice donor site	probably null
R5790:Sptbn4	UTSW	7	27366428	missense	probably damaging	0.99
R5857:Sptbn4	UTSW	7	27418713	missense	possibly damaging	0.89
R5908:Sptbn4	UTSW	7	27404253	missense	probably benign	0.00
R5980:Sptbn4	UTSW	7	27372171	missense	probably damaging	1.00
R6005:Sptbn4	UTSW	7	27418599	missense	probably damaging	1.00
R6013:Sptbn4	UTSW	7	27364479	missense	probably damaging	0.99
R6037:Sptbn4	UTSW	7	27364170	missense	probably damaging	0.97
R6037:Sptbn4	UTSW	7	27364170	missense	probably damaging	0.97
R6129:Sptbn4	UTSW	7	27360088	missense	probably damaging	0.98
R6146:Sptbn4	UTSW	7	27364587	nonsense	probably null
R6762:Sptbn4	UTSW	7	27394208	missense	probably damaging	1.00
R6897:Sptbn4	UTSW	7	27371950	missense	possibly damaging	0.96
R7178:Sptbn4	UTSW	7	27418056	missense	probably damaging	1.00
R7212:Sptbn4	UTSW	7	27416785	missense	probably benign	0.44
R7465:Sptbn4	UTSW	7	27366689	missense	probably benign	0.00
R7471:Sptbn4	UTSW	7	27409014	missense	possibly damaging	0.64
R7510:Sptbn4	UTSW	7	27428268	missense	probably benign	0.13
R7527:Sptbn4	UTSW	7	27375590	missense	possibly damaging	0.94
R7528:Sptbn4	UTSW	7	27442535	missense	probably benign	0.00
R7572:Sptbn4	UTSW	7	27372272	missense	probably damaging	0.99
R7649:Sptbn4	UTSW	7	27361577	missense	possibly damaging	0.80
R7714:Sptbn4	UTSW	7	27364336	missense	probably benign	0.02
R7780:Sptbn4	UTSW	7	27361634	missense	possibly damaging	0.70
R7854:Sptbn4	UTSW	7	27362410	missense	probably benign
R8002:Sptbn4	UTSW	7	27417992	missense	possibly damaging	0.91
R8058:Sptbn4	UTSW	7	27364269	missense	possibly damaging	0.92
R8181:Sptbn4	UTSW	7	27375383	missense	possibly damaging	0.79
R8195:Sptbn4	UTSW	7	27408889	nonsense	probably null
R8353:Sptbn4	UTSW	7	27404238	missense	probably damaging	1.00
R8392:Sptbn4	UTSW	7	27372296	missense	probably damaging	1.00
R8453:Sptbn4	UTSW	7	27404238	missense	probably damaging	1.00
R8815:Sptbn4	UTSW	7	27407232	nonsense	probably null
R8818:Sptbn4	UTSW	7	27364167	missense	possibly damaging	0.71
R9171:Sptbn4	UTSW	7	27442419	missense	possibly damaging	0.95
R9259:Sptbn4	UTSW	7	27367699	missense	possibly damaging	0.74
R9477:Sptbn4	UTSW	7	27433199	missense	possibly damaging	0.79
R9564:Sptbn4	UTSW	7	27418079	missense	probably damaging	0.98
R9572:Sptbn4	UTSW	7	27366670	missense	probably benign	0.16
R9623:Sptbn4	UTSW	7	27408382	missense	probably damaging	1.00
R9715:Sptbn4	UTSW	7	27391575	missense	probably damaging	1.00
R9782:Sptbn4	UTSW	7	27408568	missense	probably benign	0.02
R9790:Sptbn4	UTSW	7	27372237	missense	probably damaging	0.99
R9791:Sptbn4	UTSW	7	27372237	missense	probably damaging	0.99
R9798:Sptbn4	UTSW	7	27357292	makesense	probably null
X0020:Sptbn4	UTSW	7	27402734	critical splice donor site	probably null
X0066:Sptbn4	UTSW	7	27357311	unclassified	probably benign
Z1176:Sptbn4	UTSW	7	27360025	missense	probably damaging	0.99
Z1177:Sptbn4	UTSW	7	27404582	missense	probably damaging	1.00
Z1177:Sptbn4	UTSW	7	27409102	missense	probably benign	0.41

Predicted Primers

PCR Primer
(F):5'- AAATATGCCTCCTGTGTCCC -3'
(R):5'- TGTAGAACGGCAGTGTCGAG -3'

Sequencing Primer
(F):5'- CAGTGACGGTCCCACTTC -3'
(R):5'- AACGGCAGTGTCGAGGATTTG -3'

Posted On

2014-06-23