Incidental Mutation 'R0112:Gp6'
ID20505
Institutional Source Beutler Lab
Gene Symbol Gp6
Ensembl Gene ENSMUSG00000078810
Gene Nameglycoprotein 6 (platelet)
SynonymsGpvi, 9830166G18Rik
MMRRC Submission 038398-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0112 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location4363965-4397744 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 4370184 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Serine at position 247 (A247S)
Ref Sequence ENSEMBL: ENSMUSP00000145740 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000108590] [ENSMUST00000206928]
Predicted Effect probably benign
Transcript: ENSMUST00000108590
AA Change: A230S

PolyPhen 2 Score 0.016 (Sensitivity: 0.95; Specificity: 0.79)
SMART Domains Protein: ENSMUSP00000104231
Gene: ENSMUSG00000078810
AA Change: A230S

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
IG 34 109 7.47e-3 SMART
IG 120 204 9.86e-3 SMART
transmembrane domain 266 285 N/A INTRINSIC
low complexity region 306 312 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000206928
AA Change: A247S

PolyPhen 2 Score 0.080 (Sensitivity: 0.93; Specificity: 0.85)
Meta Mutation Damage Score 0.1049 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.1%
  • 10x: 96.0%
  • 20x: 91.8%
Validation Efficiency 100% (86/86)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a platelet membrane glycoprotein of the immunoglobulin superfamily. The encoded protein is a receptor for collagen and plays a critical role in collagen-induced platelet aggregation and thrombus formation. The encoded protein forms a complex with the Fc receptor gamma-chain that initiates the platelet activation signaling cascade upon collagen binding. Mutations in this gene are a cause of platelet-type bleeding disorder-11 (BDPLT11). Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Dec 2011]
PHENOTYPE: Mice homozygous with disruptions in this gene display functional abnormalities in their platelets including failure of the platelets to aggregate and to become activated. The effects on blood clotting are minor however. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 80 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930568D16Rik T A 2: 35,354,803 Y179F probably benign Het
Abcd4 A G 12: 84,612,899 probably benign Het
Abhd12b C T 12: 70,181,017 T191M probably benign Het
Adcy5 A G 16: 35,156,178 E27G possibly damaging Het
Adgb G A 10: 10,407,158 probably benign Het
Afdn T C 17: 13,884,637 S1186P probably damaging Het
Atf6b G T 17: 34,651,626 R351L probably damaging Het
Axin2 T C 11: 108,939,397 S348P possibly damaging Het
BC030499 T C 11: 78,291,681 probably benign Het
Bfsp1 A C 2: 143,827,643 probably null Het
Brd1 A G 15: 88,730,383 V103A probably benign Het
Ccdc13 C A 9: 121,813,481 K392N probably damaging Het
Ccdc18 A G 5: 108,173,761 K577R probably damaging Het
Csmd2 G T 4: 128,496,029 G2186C probably damaging Het
Cyp2j5 A T 4: 96,629,523 M484K probably benign Het
Defb3 T A 8: 19,293,407 L12Q probably null Het
Defb7 G T 8: 19,495,170 probably null Het
Dhx35 T A 2: 158,840,620 M491K probably damaging Het
Dnah17 T C 11: 118,074,434 S2261G possibly damaging Het
Dnah5 A C 15: 28,263,679 E853D probably benign Het
Dner C A 1: 84,583,053 A23S probably benign Het
Dock5 A C 14: 67,819,641 S539A probably benign Het
Dsg2 T A 18: 20,583,042 F317I probably benign Het
Enox1 A T 14: 77,699,198 I539F possibly damaging Het
Eogt G A 6: 97,135,284 probably benign Het
Fbxo22 A G 9: 55,223,346 T300A probably benign Het
Fes T C 7: 80,384,005 D166G probably damaging Het
Fn1 A G 1: 71,609,653 S1366P probably damaging Het
Fndc3a A T 14: 72,540,495 probably benign Het
Foxh1 T C 15: 76,669,010 H168R probably benign Het
Galnt14 T G 17: 73,574,984 probably benign Het
Gdf6 A G 4: 9,844,482 D2G probably damaging Het
Grin2c A G 11: 115,251,134 Y820H probably damaging Het
Gtf2h4 T C 17: 35,670,448 T198A possibly damaging Het
Helz T C 11: 107,672,948 probably benign Het
Htr1d A G 4: 136,443,000 E180G probably benign Het
Igsf10 A G 3: 59,326,008 V1768A probably benign Het
Ints10 A T 8: 68,827,302 T694S probably damaging Het
Krt81 C A 15: 101,463,627 R24L possibly damaging Het
Lipc T A 9: 70,820,427 Y131F probably damaging Het
Litaf G T 16: 10,966,511 T45K probably damaging Het
Lmo7 A T 14: 101,887,193 R363* probably null Het
Lrrc37a A T 11: 103,500,913 Y1229N probably benign Het
Man2a2 C T 7: 80,358,276 A943T probably damaging Het
Mtor A G 4: 148,480,923 Y1030C probably damaging Het
Naalad2 G T 9: 18,351,447 Y384* probably null Het
Nat2 C T 8: 67,501,726 Q163* probably null Het
Nell2 A G 15: 95,431,681 probably benign Het
Nphp3 C T 9: 104,037,348 H102Y possibly damaging Het
Olfr1383 A T 11: 49,524,134 H137L possibly damaging Het
Olfr1442 C T 19: 12,674,757 T184I probably benign Het
Olfr686 A T 7: 105,203,659 M228K probably benign Het
Olr1 T C 6: 129,488,906 S46G possibly damaging Het
Parg C A 14: 32,202,433 A63E probably damaging Het
Pik3cg A G 12: 32,195,715 probably benign Het
Ripk4 A G 16: 97,743,561 C629R probably benign Het
Rnf145 A G 11: 44,564,151 T620A probably benign Het
Samd9l T G 6: 3,376,031 D410A possibly damaging Het
Serpinb9f A T 13: 33,327,951 probably benign Het
Slc19a1 T C 10: 77,042,165 I178T probably benign Het
Slco1b2 A T 6: 141,671,111 Y390F probably benign Het
Speg A G 1: 75,385,032 E230G possibly damaging Het
Tbc1d9 C A 8: 83,264,837 probably benign Het
Tmem131l G A 3: 83,940,587 Q324* probably null Het
Trf A G 9: 103,226,956 probably benign Het
Trp53 T G 11: 69,588,679 Y202D probably damaging Het
Trpv1 T A 11: 73,253,272 M618K probably damaging Het
Trrap C A 5: 144,822,761 Y2250* probably null Het
Ttc3 A G 16: 94,385,322 probably benign Het
Ubtfl1 T G 9: 18,409,787 S204A probably benign Het
Uck2 A T 1: 167,227,771 Y203N probably damaging Het
Utrn A T 10: 12,686,465 L1280* probably null Het
Vmn1r178 A T 7: 23,894,184 H146L possibly damaging Het
Vmn2r100 C A 17: 19,522,120 P252Q possibly damaging Het
Vmn2r108 T C 17: 20,471,635 M209V probably benign Het
Vmn2r9 G A 5: 108,843,125 T790I probably damaging Het
Vmn2r94 C A 17: 18,243,604 R808L probably benign Het
Zbtb7c A T 18: 76,136,891 S17C probably damaging Het
Zfp811 C T 17: 32,797,764 R434Q probably damaging Het
Zkscan6 A T 11: 65,814,863 probably benign Het
Other mutations in Gp6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02141:Gp6 APN 7 4394104 splice site probably benign
IGL02351:Gp6 APN 7 4394508 missense probably benign 0.03
IGL02358:Gp6 APN 7 4394508 missense probably benign 0.03
IGL02660:Gp6 APN 7 4384998 missense probably benign 0.01
IGL03081:Gp6 APN 7 4371648 missense probably benign 0.01
R0112:Gp6 UTSW 7 4371627 missense probably benign 0.12
R0211:Gp6 UTSW 7 4373209 critical splice donor site probably null
R0356:Gp6 UTSW 7 4370142 splice site probably benign
R2006:Gp6 UTSW 7 4384989 missense probably benign 0.33
R2047:Gp6 UTSW 7 4373271 splice site probably benign
R5219:Gp6 UTSW 7 4368999 missense possibly damaging 0.70
R5571:Gp6 UTSW 7 4368900 missense probably damaging 1.00
R5639:Gp6 UTSW 7 4394131 missense probably damaging 1.00
R6224:Gp6 UTSW 7 4394212 missense probably benign 0.03
R6555:Gp6 UTSW 7 4384930 missense probably damaging 0.99
R7625:Gp6 UTSW 7 4370174 missense probably benign 0.37
R8113:Gp6 UTSW 7 4394115 missense probably benign 0.13
Predicted Primers PCR Primer
(F):5'- CCCTTGACATTTTATGCACAAGGCTTC -3'
(R):5'- CCACTGGACAGATGTGAAAATGGACTC -3'

Sequencing Primer
(F):5'- GCACAAGGCTTCAAAATTATAGCTC -3'
(R):5'- aataaaccctttcctccccac -3'
Posted On2013-04-11