Incidental Mutation 'R1834:Prkcsh'
ID205059
Institutional Source Beutler Lab
Gene Symbol Prkcsh
Ensembl Gene ENSMUSG00000003402
Gene Nameprotein kinase C substrate 80K-H
Synonyms80K-H
MMRRC Submission 039861-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R1834 (G1)
Quality Score225
Status Validated
Chromosome9
Chromosomal Location22002806-22014222 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 22008338 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Methionine at position 188 (K188M)
Ref Sequence ENSEMBL: ENSMUSP00000149936 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000003493] [ENSMUST00000115331] [ENSMUST00000215795] [ENSMUST00000216344]
Predicted Effect probably damaging
Transcript: ENSMUST00000003493
AA Change: K188M

PolyPhen 2 Score 0.981 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000003493
Gene: ENSMUSG00000003402
AA Change: K188M

DomainStartEndE-ValueType
low complexity region 2 11 N/A INTRINSIC
LDLa 32 72 3.01e-2 SMART
internal_repeat_1 91 105 3.48e-7 PROSPERO
low complexity region 177 191 N/A INTRINSIC
Pfam:EF-hand_5 214 236 5.5e-5 PFAM
Pfam:EF-hand_5 239 257 4.4e-4 PFAM
low complexity region 290 341 N/A INTRINSIC
Pfam:PRKCSH_1 366 512 4.3e-23 PFAM
Pfam:PRKCSH 406 464 1.1e-12 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000115331
AA Change: K188M

PolyPhen 2 Score 0.981 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000110987
Gene: ENSMUSG00000003402
AA Change: K188M

DomainStartEndE-ValueType
low complexity region 2 11 N/A INTRINSIC
LDLa 32 72 3.01e-2 SMART
internal_repeat_1 91 105 1.7e-7 PROSPERO
low complexity region 177 191 N/A INTRINSIC
Pfam:EF-hand_5 215 236 3.2e-5 PFAM
Pfam:EF-hand_5 239 257 1.2e-3 PFAM
low complexity region 290 352 N/A INTRINSIC
Pfam:PRKCSH_1 373 519 4.4e-23 PFAM
Pfam:PRKCSH 413 471 4e-13 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000214565
Predicted Effect probably benign
Transcript: ENSMUST00000215795
Predicted Effect probably damaging
Transcript: ENSMUST00000216344
AA Change: K188M

PolyPhen 2 Score 0.981 (Sensitivity: 0.75; Specificity: 0.96)
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 97.4%
  • 3x: 96.8%
  • 10x: 95.1%
  • 20x: 92.0%
Validation Efficiency 97% (116/119)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes the beta-subunit of glucosidase II, an N-linked glycan-processing enzyme in the endoplasmic reticulum. The encoded protein is an acidic phosphoprotein known to be a substrate for protein kinase C. Mutations in this gene have been associated with the autosomal dominant polycystic liver disease. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jan 2014]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit embryonic lethality during organogenesis. Mice homozygous for a conditional allele activated in the kidneys or ubiquitously develop polycystic kidney and liver phenotypes, respectively. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 114 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310033P09Rik A G 11: 59,208,487 D20G probably damaging Het
2310061N02Rik T A 16: 88,707,898 S4C unknown Het
4933416C03Rik T C 10: 116,112,665 R319G probably benign Het
Abca3 A T 17: 24,376,692 N340Y probably benign Het
Abcc1 A G 16: 14,423,117 I513V possibly damaging Het
Acacb C T 5: 114,235,475 T1855M probably damaging Het
Ace A G 11: 105,986,094 probably benign Het
Acss2 T A 2: 155,558,630 Y530N probably damaging Het
Adarb1 C A 10: 77,317,231 probably benign Het
Afm T A 5: 90,526,424 M265K probably benign Het
Agl A G 3: 116,788,351 F293S probably benign Het
Aox2 G A 1: 58,308,991 A623T probably benign Het
Arhgap31 C A 16: 38,603,703 S667I probably benign Het
Bco1 A G 8: 117,117,437 T297A probably benign Het
Bmp1 T C 14: 70,508,831 S123G possibly damaging Het
Caps2 G A 10: 112,195,718 D283N possibly damaging Het
Ccdc57 A C 11: 120,861,219 S845R probably benign Het
Cd209f A G 8: 4,104,491 S119P probably damaging Het
Chrna6 A G 8: 27,407,214 S212P probably benign Het
Col10a1 G C 10: 34,395,015 A328P probably damaging Het
Col4a2 A G 8: 11,402,997 E188G probably benign Het
Creb1 C T 1: 64,550,950 Q32* probably null Het
Cttnbp2 C T 6: 18,501,966 V16M probably damaging Het
D430041D05Rik A G 2: 104,168,101 S1102P probably damaging Het
Ddx31 C T 2: 28,892,453 H603Y probably damaging Het
Ddx52 G A 11: 83,959,497 C568Y probably benign Het
Dgki C A 6: 37,034,701 probably benign Het
Dmrt1 A T 19: 25,509,699 Q123L probably damaging Het
Dnah5 A T 15: 28,409,124 M3563L probably benign Het
Dnah7b A T 1: 46,233,759 N2349I possibly damaging Het
Dscaml1 T G 9: 45,683,632 S678A probably benign Het
Ece1 C T 4: 137,958,001 R601W probably damaging Het
Ece1 A G 4: 137,958,128 N643S probably damaging Het
Eno1b A G 18: 48,047,463 Y236C probably damaging Het
Esco1 T C 18: 10,594,350 E312G probably damaging Het
Eya3 T A 4: 132,707,118 V276E probably damaging Het
Fam161b A G 12: 84,348,778 probably benign Het
Fem1c C T 18: 46,505,282 G551D probably damaging Het
Fer1l6 T C 15: 58,557,869 I155T possibly damaging Het
Gbp7 A G 3: 142,534,680 Y53C probably damaging Het
Gjb3 G A 4: 127,326,431 R103W probably damaging Het
Gm10030 C T 9: 111,004,879 noncoding transcript Het
Gm1966 A T 7: 106,603,776 V87D possibly damaging Het
Gm3443 T A 19: 21,555,679 H2Q unknown Het
Gm5800 T C 14: 51,716,092 E22G possibly damaging Het
Gsdma2 G T 11: 98,649,079 R9L probably damaging Het
Ica1l A G 1: 60,028,236 probably benign Het
Ice1 G A 13: 70,615,338 T167I probably damaging Het
Ifi204 T A 1: 173,747,606 R618S unknown Het
Itga2 C A 13: 114,856,726 K784N probably damaging Het
Itga2 T A 13: 114,856,727 K784M probably damaging Het
Kif3b A G 2: 153,317,485 E402G probably benign Het
Lrp2 T C 2: 69,466,880 I3246V probably benign Het
Lrrn3 G T 12: 41,453,518 L267I probably damaging Het
Map1s A G 8: 70,916,411 Y868C probably damaging Het
Mcm5 A G 8: 75,119,273 T370A possibly damaging Het
Nat8f7 T C 6: 85,707,811 S16G probably benign Het
Nav3 T C 10: 109,720,022 T1683A probably damaging Het
Nbeal2 T C 9: 110,627,129 N2417S probably damaging Het
Neb T C 2: 52,236,895 N3605S probably damaging Het
Net1 A T 13: 3,912,941 probably benign Het
Nsd1 A G 13: 55,313,351 T2464A possibly damaging Het
Nt5e T A 9: 88,370,187 I534N probably damaging Het
Nudt12 T A 17: 59,011,076 H58L probably damaging Het
Ocrl T A X: 47,962,116 I74N probably damaging Het
Olfr291 A G 7: 84,856,482 T38A probably damaging Het
Olfr403 A G 11: 74,195,653 H50R probably benign Het
Olfr695 A G 7: 106,874,141 Y35H probably damaging Het
Olfr826 A G 10: 130,180,832 I16T probably benign Het
Pef1 C A 4: 130,121,173 C10* probably null Het
Phf21b A G 15: 84,797,346 Y256H probably damaging Het
Phox2a G T 7: 101,820,945 probably null Het
Pi16 A G 17: 29,327,445 E399G possibly damaging Het
Pipox A T 11: 77,882,123 Y321N probably damaging Het
Plin4 A G 17: 56,103,522 S1170P probably damaging Het
Pnma2 C T 14: 66,917,213 S362L possibly damaging Het
Ppp1r9a T C 6: 5,113,710 I738T probably damaging Het
Rcc1l A T 5: 134,163,659 Y309N probably damaging Het
Ripk1 A G 13: 34,015,213 T123A probably benign Het
Robo4 A G 9: 37,413,059 D961G probably benign Het
Rps27a A G 11: 29,546,299 Y105H probably benign Het
Scaper A G 9: 55,816,734 Y641H possibly damaging Het
Scn1a C A 2: 66,324,616 Q666H probably benign Het
Scn1a T A 2: 66,324,617 Q666L probably benign Het
Sdhaf4 T C 1: 24,003,153 probably null Het
Sec14l3 A G 11: 4,066,510 probably benign Het
Selp C A 1: 164,128,160 probably null Het
Sim1 A G 10: 50,909,828 D259G probably damaging Het
Sptan1 T A 2: 29,992,001 probably benign Het
Sptbn4 T A 7: 27,366,646 E679V probably null Het
Sytl3 G A 17: 6,728,327 E169K probably benign Het
Taar1 T C 10: 23,921,189 C262R probably benign Het
Tbc1d32 A G 10: 56,017,604 I1291T probably benign Het
Tcrg-C3 A G 13: 19,263,365 T163A possibly damaging Het
Tet1 G A 10: 62,813,665 P89S probably damaging Het
Tgfbrap1 C A 1: 43,071,635 G7W probably damaging Het
Thada A G 17: 84,226,004 V1673A possibly damaging Het
Thbs4 A G 13: 92,761,481 V610A probably benign Het
Tmem163 A G 1: 127,677,509 S41P probably benign Het
Tmem65 A T 15: 58,787,113 H200Q probably damaging Het
Trim62 T C 4: 128,909,225 V356A possibly damaging Het
Ttn T C 2: 76,732,158 D28781G probably damaging Het
Ttn C T 2: 76,763,260 V20679I probably benign Het
Unc80 A T 1: 66,639,248 T2063S possibly damaging Het
Vav3 A G 3: 109,506,426 T227A probably benign Het
Vmn2r118 A T 17: 55,592,456 I816N probably damaging Het
Vmn2r26 T A 6: 124,061,410 M648K possibly damaging Het
Vmn2r88 T G 14: 51,413,030 probably benign Het
Vwa3a A G 7: 120,790,136 T66A probably benign Het
Xirp2 T A 2: 67,511,140 Y1242N probably damaging Het
Ywhag G A 5: 135,911,530 T70M probably damaging Het
Zcchc6 A T 13: 59,814,935 Y339* probably null Het
Zfp248 T C 6: 118,428,970 T452A probably damaging Het
Zfp988 A T 4: 147,332,887 I593F probably damaging Het
Other mutations in Prkcsh
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00937:Prkcsh APN 9 22006565 missense possibly damaging 0.95
R0306:Prkcsh UTSW 9 22006526 splice site probably benign
R0376:Prkcsh UTSW 9 22010251 splice site probably benign
R1690:Prkcsh UTSW 9 22010575 missense probably damaging 1.00
R1856:Prkcsh UTSW 9 22004575 missense possibly damaging 0.55
R1980:Prkcsh UTSW 9 22012868 missense probably damaging 0.99
R1981:Prkcsh UTSW 9 22012868 missense probably damaging 0.99
R1982:Prkcsh UTSW 9 22012868 missense probably damaging 0.99
R2184:Prkcsh UTSW 9 22004732 missense probably damaging 1.00
R3625:Prkcsh UTSW 9 22011252 missense probably null 1.00
R4798:Prkcsh UTSW 9 22011738 missense probably damaging 1.00
R5059:Prkcsh UTSW 9 22012750 missense probably damaging 1.00
R5580:Prkcsh UTSW 9 22011255 critical splice donor site probably null
R7055:Prkcsh UTSW 9 22013161 makesense probably null
Predicted Primers PCR Primer
(F):5'- TTGGGGCTGGAAGACATGAC -3'
(R):5'- CACATAGAGATGAGCCATCATGAC -3'

Sequencing Primer
(F):5'- CATGACAAAGCTGAGGTAGAGCC -3'
(R):5'- TTCGTGGATATACACTGAAGGCC -3'
Posted On2014-06-23