Incidental Mutation 'R1834:Robo4'
ID 205060
Institutional Source Beutler Lab
Gene Symbol Robo4
Ensembl Gene ENSMUSG00000032125
Gene Name roundabout guidance receptor 4
Synonyms Magic roundabout, 1200012D01Rik
MMRRC Submission 039861-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.217) question?
Stock # R1834 (G1)
Quality Score 225
Status Validated
Chromosome 9
Chromosomal Location 37313198-37325319 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 37324355 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Glycine at position 961 (D961G)
Ref Sequence ENSEMBL: ENSMUSP00000150722 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034643] [ENSMUST00000102895] [ENSMUST00000115038] [ENSMUST00000115046] [ENSMUST00000115048] [ENSMUST00000156972] [ENSMUST00000170512] [ENSMUST00000214185]
AlphaFold Q8C310
Predicted Effect probably benign
Transcript: ENSMUST00000034643
SMART Domains Protein: ENSMUSP00000034643
Gene: ENSMUSG00000032128

DomainStartEndE-ValueType
IGc2 54 128 9.7e-11 SMART
IGc2 156 221 1.44e-4 SMART
IGc2 248 311 1.89e-13 SMART
IGc2 337 409 9.84e-12 SMART
IGc2 441 506 2.09e-15 SMART
FN3 534 616 4.24e-14 SMART
FN3 648 731 3.06e0 SMART
FN3 747 832 1.97e-9 SMART
low complexity region 870 890 N/A INTRINSIC
low complexity region 1055 1082 N/A INTRINSIC
low complexity region 1131 1149 N/A INTRINSIC
low complexity region 1155 1169 N/A INTRINSIC
low complexity region 1193 1206 N/A INTRINSIC
low complexity region 1245 1256 N/A INTRINSIC
low complexity region 1268 1281 N/A INTRINSIC
low complexity region 1336 1376 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000102895
AA Change: D954G

PolyPhen 2 Score 0.052 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000099959
Gene: ENSMUSG00000032125
AA Change: D954G

DomainStartEndE-ValueType
signal peptide 1 37 N/A INTRINSIC
IG 48 144 2.51e0 SMART
IGc2 160 225 6.86e-11 SMART
FN3 263 343 2.05e0 SMART
FN3 358 440 1.27e-3 SMART
low complexity region 488 494 N/A INTRINSIC
low complexity region 544 562 N/A INTRINSIC
low complexity region 720 733 N/A INTRINSIC
low complexity region 748 762 N/A INTRINSIC
low complexity region 775 799 N/A INTRINSIC
low complexity region 855 866 N/A INTRINSIC
low complexity region 871 880 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000115038
SMART Domains Protein: ENSMUSP00000110690
Gene: ENSMUSG00000032128

DomainStartEndE-ValueType
low complexity region 34 47 N/A INTRINSIC
IGc2 76 150 9.7e-11 SMART
IGc2 178 243 1.44e-4 SMART
IGc2 270 333 1.89e-13 SMART
IGc2 359 431 9.84e-12 SMART
IGc2 463 528 2.09e-15 SMART
FN3 556 638 4.24e-14 SMART
FN3 670 753 3.06e0 SMART
FN3 769 854 1.97e-9 SMART
low complexity region 892 912 N/A INTRINSIC
low complexity region 1077 1104 N/A INTRINSIC
low complexity region 1153 1171 N/A INTRINSIC
low complexity region 1177 1191 N/A INTRINSIC
low complexity region 1215 1228 N/A INTRINSIC
low complexity region 1267 1278 N/A INTRINSIC
low complexity region 1290 1303 N/A INTRINSIC
low complexity region 1358 1398 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000115046
AA Change: D1013G

PolyPhen 2 Score 0.049 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000110698
Gene: ENSMUSG00000032125
AA Change: D1013G

DomainStartEndE-ValueType
signal peptide 1 37 N/A INTRINSIC
IG 48 144 2.51e0 SMART
IGc2 160 225 6.86e-11 SMART
FN3 263 343 2.05e0 SMART
FN3 358 440 1.27e-3 SMART
low complexity region 484 500 N/A INTRINSIC
low complexity region 540 546 N/A INTRINSIC
low complexity region 596 614 N/A INTRINSIC
low complexity region 747 756 N/A INTRINSIC
low complexity region 779 792 N/A INTRINSIC
low complexity region 807 821 N/A INTRINSIC
low complexity region 834 858 N/A INTRINSIC
low complexity region 914 925 N/A INTRINSIC
low complexity region 930 939 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000115048
AA Change: D850G

PolyPhen 2 Score 0.056 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000110700
Gene: ENSMUSG00000032125
AA Change: D850G

DomainStartEndE-ValueType
signal peptide 1 37 N/A INTRINSIC
IG 48 144 2.51e0 SMART
IGc2 160 225 6.86e-11 SMART
FN3 263 343 2.05e0 SMART
FN3 358 440 1.27e-3 SMART
low complexity region 488 494 N/A INTRINSIC
low complexity region 544 562 N/A INTRINSIC
low complexity region 695 704 N/A INTRINSIC
low complexity region 727 740 N/A INTRINSIC
low complexity region 755 769 N/A INTRINSIC
low complexity region 782 806 N/A INTRINSIC
low complexity region 862 873 N/A INTRINSIC
low complexity region 878 887 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000156972
Predicted Effect noncoding transcript
Transcript: ENSMUST00000167089
Predicted Effect noncoding transcript
Transcript: ENSMUST00000167216
Predicted Effect probably benign
Transcript: ENSMUST00000170512
Predicted Effect noncoding transcript
Transcript: ENSMUST00000171467
Predicted Effect probably benign
Transcript: ENSMUST00000214185
AA Change: D961G

PolyPhen 2 Score 0.086 (Sensitivity: 0.93; Specificity: 0.85)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000215777
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 97.4%
  • 3x: 96.8%
  • 10x: 95.1%
  • 20x: 92.0%
Validation Efficiency 97% (116/119)
MGI Phenotype PHENOTYPE: Mice homozygous for a reporter/null allele display enhanced VEGF-induced endothelial migration, tube formation and vascular permeability, and show increased pathologic angiogenesis and vascular leak in models of oxygen-induced retinopathy and choroidal neovascularization. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 114 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310033P09Rik A G 11: 59,099,313 (GRCm39) D20G probably damaging Het
2310061N02Rik T A 16: 88,504,786 (GRCm39) S4C unknown Het
Abca3 A T 17: 24,595,666 (GRCm39) N340Y probably benign Het
Abcc1 A G 16: 14,240,981 (GRCm39) I513V possibly damaging Het
Acacb C T 5: 114,373,536 (GRCm39) T1855M probably damaging Het
Ace A G 11: 105,876,920 (GRCm39) probably benign Het
Acss2 T A 2: 155,400,550 (GRCm39) Y530N probably damaging Het
Adarb1 C A 10: 77,153,065 (GRCm39) probably benign Het
Afm T A 5: 90,674,283 (GRCm39) M265K probably benign Het
Agl A G 3: 116,582,000 (GRCm39) F293S probably benign Het
Aox1 G A 1: 58,348,150 (GRCm39) A623T probably benign Het
Arhgap31 C A 16: 38,424,065 (GRCm39) S667I probably benign Het
Bco1 A G 8: 117,844,176 (GRCm39) T297A probably benign Het
Bmp1 T C 14: 70,746,271 (GRCm39) S123G possibly damaging Het
Caps2 G A 10: 112,031,623 (GRCm39) D283N possibly damaging Het
Ccdc57 A C 11: 120,752,045 (GRCm39) S845R probably benign Het
Cd209f A G 8: 4,154,491 (GRCm39) S119P probably damaging Het
Chrna6 A G 8: 27,897,242 (GRCm39) S212P probably benign Het
Col10a1 G C 10: 34,271,011 (GRCm39) A328P probably damaging Het
Col4a2 A G 8: 11,452,997 (GRCm39) E188G probably benign Het
Creb1 C T 1: 64,590,109 (GRCm39) Q32* probably null Het
Cttnbp2 C T 6: 18,501,965 (GRCm39) V16M probably damaging Het
D430041D05Rik A G 2: 103,998,446 (GRCm39) S1102P probably damaging Het
Ddx31 C T 2: 28,782,465 (GRCm39) H603Y probably damaging Het
Ddx52 G A 11: 83,850,323 (GRCm39) C568Y probably benign Het
Dgki C A 6: 37,011,636 (GRCm39) probably benign Het
Dmrt1 A T 19: 25,487,063 (GRCm39) Q123L probably damaging Het
Dnah5 A T 15: 28,409,270 (GRCm39) M3563L probably benign Het
Dnah7b A T 1: 46,272,919 (GRCm39) N2349I possibly damaging Het
Dscaml1 T G 9: 45,594,930 (GRCm39) S678A probably benign Het
Ece1 C T 4: 137,685,312 (GRCm39) R601W probably damaging Het
Ece1 A G 4: 137,685,439 (GRCm39) N643S probably damaging Het
Eno1b A G 18: 48,180,530 (GRCm39) Y236C probably damaging Het
Esco1 T C 18: 10,594,350 (GRCm39) E312G probably damaging Het
Eya3 T A 4: 132,434,429 (GRCm39) V276E probably damaging Het
Fam161b A G 12: 84,395,552 (GRCm39) probably benign Het
Fem1c C T 18: 46,638,349 (GRCm39) G551D probably damaging Het
Fer1l6 T C 15: 58,429,718 (GRCm39) I155T possibly damaging Het
Gbp7 A G 3: 142,240,441 (GRCm39) Y53C probably damaging Het
Gjb3 G A 4: 127,220,224 (GRCm39) R103W probably damaging Het
Gm10030 C T 9: 110,833,947 (GRCm39) noncoding transcript Het
Gm3443 T A 19: 21,533,043 (GRCm39) H2Q unknown Het
Gm5800 T C 14: 51,953,549 (GRCm39) E22G possibly damaging Het
Gsdma2 G T 11: 98,539,905 (GRCm39) R9L probably damaging Het
Gvin3 A T 7: 106,202,983 (GRCm39) V87D possibly damaging Het
Ica1l A G 1: 60,067,395 (GRCm39) probably benign Het
Ice1 G A 13: 70,763,457 (GRCm39) T167I probably damaging Het
Ifi204 T A 1: 173,575,172 (GRCm39) R618S unknown Het
Itga2 C A 13: 114,993,262 (GRCm39) K784N probably damaging Het
Itga2 T A 13: 114,993,263 (GRCm39) K784M probably damaging Het
Kif3b A G 2: 153,159,405 (GRCm39) E402G probably benign Het
Lrp2 T C 2: 69,297,224 (GRCm39) I3246V probably benign Het
Lrrn3 G T 12: 41,503,517 (GRCm39) L267I probably damaging Het
Map1s A G 8: 71,369,055 (GRCm39) Y868C probably damaging Het
Mcm5 A G 8: 75,845,901 (GRCm39) T370A possibly damaging Het
Nat8f7 T C 6: 85,684,793 (GRCm39) S16G probably benign Het
Nav3 T C 10: 109,555,883 (GRCm39) T1683A probably damaging Het
Nbeal2 T C 9: 110,456,197 (GRCm39) N2417S probably damaging Het
Neb T C 2: 52,126,907 (GRCm39) N3605S probably damaging Het
Net1 A T 13: 3,962,941 (GRCm39) probably benign Het
Nsd1 A G 13: 55,461,164 (GRCm39) T2464A possibly damaging Het
Nt5e T A 9: 88,252,240 (GRCm39) I534N probably damaging Het
Nudt12 T A 17: 59,318,071 (GRCm39) H58L probably damaging Het
Ocrl T A X: 47,050,993 (GRCm39) I74N probably damaging Het
Or1a1 A G 11: 74,086,479 (GRCm39) H50R probably benign Het
Or2ag13 A G 7: 106,473,348 (GRCm39) Y35H probably damaging Het
Or5ae2 A G 7: 84,505,690 (GRCm39) T38A probably damaging Het
Or9k2b A G 10: 130,016,701 (GRCm39) I16T probably benign Het
Pef1 C A 4: 130,014,966 (GRCm39) C10* probably null Het
Phf21b A G 15: 84,681,547 (GRCm39) Y256H probably damaging Het
Phox2a G T 7: 101,470,152 (GRCm39) probably null Het
Pi16 A G 17: 29,546,419 (GRCm39) E399G possibly damaging Het
Pipox A T 11: 77,772,949 (GRCm39) Y321N probably damaging Het
Plin4 A G 17: 56,410,522 (GRCm39) S1170P probably damaging Het
Pnma2 C T 14: 67,154,662 (GRCm39) S362L possibly damaging Het
Ppp1r9a T C 6: 5,113,710 (GRCm39) I738T probably damaging Het
Prkcsh A T 9: 21,919,634 (GRCm39) K188M probably damaging Het
Rcc1l A T 5: 134,192,498 (GRCm39) Y309N probably damaging Het
Ripk1 A G 13: 34,199,196 (GRCm39) T123A probably benign Het
Rps27a A G 11: 29,496,299 (GRCm39) Y105H probably benign Het
Scaper A G 9: 55,724,018 (GRCm39) Y641H possibly damaging Het
Scn1a C A 2: 66,154,960 (GRCm39) Q666H probably benign Het
Scn1a T A 2: 66,154,961 (GRCm39) Q666L probably benign Het
Sdhaf4 T C 1: 24,042,234 (GRCm39) probably null Het
Sec14l3 A G 11: 4,016,510 (GRCm39) probably benign Het
Selp C A 1: 163,955,729 (GRCm39) probably null Het
Sim1 A G 10: 50,785,924 (GRCm39) D259G probably damaging Het
Sptan1 T A 2: 29,882,013 (GRCm39) probably benign Het
Sptbn4 T A 7: 27,066,071 (GRCm39) E679V probably null Het
Sytl3 G A 17: 6,995,726 (GRCm39) E169K probably benign Het
Taar1 T C 10: 23,797,087 (GRCm39) C262R probably benign Het
Taf7l2 T C 10: 115,948,570 (GRCm39) R319G probably benign Het
Tbc1d32 A G 10: 55,893,700 (GRCm39) I1291T probably benign Het
Tet1 G A 10: 62,649,444 (GRCm39) P89S probably damaging Het
Tgfbrap1 C A 1: 43,110,795 (GRCm39) G7W probably damaging Het
Thada A G 17: 84,533,432 (GRCm39) V1673A possibly damaging Het
Thbs4 A G 13: 92,897,989 (GRCm39) V610A probably benign Het
Tmem163 A G 1: 127,605,246 (GRCm39) S41P probably benign Het
Tmem65 A T 15: 58,658,962 (GRCm39) H200Q probably damaging Het
Trgc3 A G 13: 19,447,535 (GRCm39) T163A possibly damaging Het
Trim62 T C 4: 128,803,018 (GRCm39) V356A possibly damaging Het
Ttn T C 2: 76,562,502 (GRCm39) D28781G probably damaging Het
Ttn C T 2: 76,593,604 (GRCm39) V20679I probably benign Het
Tut7 A T 13: 59,962,749 (GRCm39) Y339* probably null Het
Unc80 A T 1: 66,678,407 (GRCm39) T2063S possibly damaging Het
Vav3 A G 3: 109,413,742 (GRCm39) T227A probably benign Het
Vmn2r118 A T 17: 55,899,456 (GRCm39) I816N probably damaging Het
Vmn2r26 T A 6: 124,038,369 (GRCm39) M648K possibly damaging Het
Vmn2r88 T G 14: 51,650,487 (GRCm39) probably benign Het
Vwa3a A G 7: 120,389,359 (GRCm39) T66A probably benign Het
Xirp2 T A 2: 67,341,484 (GRCm39) Y1242N probably damaging Het
Ywhag G A 5: 135,940,384 (GRCm39) T70M probably damaging Het
Zfp248 T C 6: 118,405,931 (GRCm39) T452A probably damaging Het
Zfp988 A T 4: 147,417,344 (GRCm39) I593F probably damaging Het
Other mutations in Robo4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00090:Robo4 APN 9 37,322,400 (GRCm39) missense probably damaging 1.00
IGL00392:Robo4 APN 9 37,319,525 (GRCm39) missense probably damaging 1.00
IGL00491:Robo4 APN 9 37,317,231 (GRCm39) missense possibly damaging 0.52
IGL00792:Robo4 APN 9 37,319,507 (GRCm39) missense probably damaging 1.00
IGL01062:Robo4 APN 9 37,317,296 (GRCm39) missense probably benign 0.08
IGL01287:Robo4 APN 9 37,324,336 (GRCm39) missense possibly damaging 0.96
IGL02289:Robo4 APN 9 37,319,496 (GRCm39) missense probably damaging 1.00
IGL02486:Robo4 APN 9 37,319,670 (GRCm39) missense probably damaging 1.00
IGL02851:Robo4 APN 9 37,324,678 (GRCm39) missense probably damaging 0.96
IGL02898:Robo4 APN 9 37,319,472 (GRCm39) missense probably damaging 0.99
IGL02965:Robo4 APN 9 37,321,765 (GRCm39) missense possibly damaging 0.82
IGL03071:Robo4 APN 9 37,315,580 (GRCm39) splice site probably benign
IGL03102:Robo4 APN 9 37,315,481 (GRCm39) missense probably damaging 1.00
H8562:Robo4 UTSW 9 37,317,106 (GRCm39) intron probably benign
PIT4305001:Robo4 UTSW 9 37,322,687 (GRCm39) missense probably damaging 1.00
R0056:Robo4 UTSW 9 37,315,773 (GRCm39) missense probably benign 0.03
R0068:Robo4 UTSW 9 37,315,773 (GRCm39) missense probably benign 0.03
R0233:Robo4 UTSW 9 37,313,977 (GRCm39) missense probably damaging 1.00
R0233:Robo4 UTSW 9 37,313,977 (GRCm39) missense probably damaging 1.00
R0416:Robo4 UTSW 9 37,316,062 (GRCm39) splice site probably benign
R1005:Robo4 UTSW 9 37,319,547 (GRCm39) missense probably damaging 1.00
R1174:Robo4 UTSW 9 37,324,348 (GRCm39) missense probably damaging 1.00
R1183:Robo4 UTSW 9 37,319,348 (GRCm39) missense probably damaging 1.00
R1254:Robo4 UTSW 9 37,322,136 (GRCm39) critical splice donor site probably null
R1398:Robo4 UTSW 9 37,319,372 (GRCm39) critical splice donor site probably null
R1505:Robo4 UTSW 9 37,314,523 (GRCm39) missense probably damaging 0.98
R1701:Robo4 UTSW 9 37,314,739 (GRCm39) missense probably benign 0.44
R1899:Robo4 UTSW 9 37,315,366 (GRCm39) splice site probably benign
R2203:Robo4 UTSW 9 37,322,786 (GRCm39) frame shift probably null
R2204:Robo4 UTSW 9 37,322,786 (GRCm39) frame shift probably null
R2351:Robo4 UTSW 9 37,322,956 (GRCm39) missense probably benign 0.01
R2448:Robo4 UTSW 9 37,313,958 (GRCm39) missense possibly damaging 0.96
R2847:Robo4 UTSW 9 37,315,772 (GRCm39) nonsense probably null
R2851:Robo4 UTSW 9 37,322,786 (GRCm39) frame shift probably null
R2852:Robo4 UTSW 9 37,322,786 (GRCm39) frame shift probably null
R2877:Robo4 UTSW 9 37,322,786 (GRCm39) frame shift probably null
R3123:Robo4 UTSW 9 37,322,786 (GRCm39) frame shift probably null
R3124:Robo4 UTSW 9 37,322,786 (GRCm39) frame shift probably null
R3125:Robo4 UTSW 9 37,322,786 (GRCm39) frame shift probably null
R3805:Robo4 UTSW 9 37,315,734 (GRCm39) missense possibly damaging 0.73
R3806:Robo4 UTSW 9 37,315,734 (GRCm39) missense possibly damaging 0.73
R3892:Robo4 UTSW 9 37,322,786 (GRCm39) frame shift probably null
R3905:Robo4 UTSW 9 37,314,801 (GRCm39) nonsense probably null
R3938:Robo4 UTSW 9 37,313,313 (GRCm39) start gained probably benign
R4261:Robo4 UTSW 9 37,316,877 (GRCm39) missense probably benign 0.04
R4434:Robo4 UTSW 9 37,322,786 (GRCm39) frame shift probably null
R4435:Robo4 UTSW 9 37,322,786 (GRCm39) frame shift probably null
R4561:Robo4 UTSW 9 37,322,786 (GRCm39) frame shift probably null
R4562:Robo4 UTSW 9 37,322,786 (GRCm39) frame shift probably null
R4568:Robo4 UTSW 9 37,316,118 (GRCm39) missense possibly damaging 0.59
R4695:Robo4 UTSW 9 37,314,495 (GRCm39) missense probably damaging 1.00
R4921:Robo4 UTSW 9 37,313,856 (GRCm39) missense probably benign
R5000:Robo4 UTSW 9 37,319,664 (GRCm39) missense probably benign 0.02
R5056:Robo4 UTSW 9 37,316,102 (GRCm39) missense probably benign 0.00
R5125:Robo4 UTSW 9 37,319,256 (GRCm39) missense probably damaging 1.00
R5178:Robo4 UTSW 9 37,319,256 (GRCm39) missense probably damaging 1.00
R5278:Robo4 UTSW 9 37,322,786 (GRCm39) frame shift probably null
R5279:Robo4 UTSW 9 37,322,786 (GRCm39) frame shift probably null
R5285:Robo4 UTSW 9 37,322,786 (GRCm39) frame shift probably null
R5347:Robo4 UTSW 9 37,322,786 (GRCm39) frame shift probably null
R5348:Robo4 UTSW 9 37,322,786 (GRCm39) frame shift probably null
R5361:Robo4 UTSW 9 37,324,674 (GRCm39) missense probably benign 0.01
R5403:Robo4 UTSW 9 37,322,786 (GRCm39) frame shift probably null
R5404:Robo4 UTSW 9 37,322,786 (GRCm39) frame shift probably null
R5488:Robo4 UTSW 9 37,322,786 (GRCm39) frame shift probably null
R5489:Robo4 UTSW 9 37,322,786 (GRCm39) frame shift probably null
R5490:Robo4 UTSW 9 37,322,786 (GRCm39) frame shift probably null
R5494:Robo4 UTSW 9 37,322,786 (GRCm39) frame shift probably null
R5629:Robo4 UTSW 9 37,319,658 (GRCm39) missense probably damaging 1.00
R5736:Robo4 UTSW 9 37,316,093 (GRCm39) missense possibly damaging 0.63
R5796:Robo4 UTSW 9 37,322,970 (GRCm39) missense probably benign 0.00
R5987:Robo4 UTSW 9 37,322,696 (GRCm39) missense probably damaging 1.00
R6178:Robo4 UTSW 9 37,316,926 (GRCm39) nonsense probably null
R6189:Robo4 UTSW 9 37,314,829 (GRCm39) missense probably benign 0.35
R6365:Robo4 UTSW 9 37,322,008 (GRCm39) missense probably benign 0.34
R6528:Robo4 UTSW 9 37,315,664 (GRCm39) missense possibly damaging 0.92
R6887:Robo4 UTSW 9 37,313,363 (GRCm39) missense possibly damaging 0.82
R7196:Robo4 UTSW 9 37,314,001 (GRCm39) missense possibly damaging 0.92
R7408:Robo4 UTSW 9 37,322,277 (GRCm39) missense probably benign 0.09
R7419:Robo4 UTSW 9 37,314,105 (GRCm39) missense probably benign 0.18
R7486:Robo4 UTSW 9 37,316,870 (GRCm39) missense probably damaging 0.99
R7707:Robo4 UTSW 9 37,324,418 (GRCm39) missense probably damaging 1.00
R7839:Robo4 UTSW 9 37,322,055 (GRCm39) missense probably damaging 1.00
R8079:Robo4 UTSW 9 37,313,931 (GRCm39) missense possibly damaging 0.82
R8081:Robo4 UTSW 9 37,316,936 (GRCm39) missense probably damaging 0.99
R8280:Robo4 UTSW 9 37,315,372 (GRCm39) missense probably benign 0.00
R8526:Robo4 UTSW 9 37,314,801 (GRCm39) nonsense probably null
R8547:Robo4 UTSW 9 37,315,674 (GRCm39) missense possibly damaging 0.69
R8735:Robo4 UTSW 9 37,319,577 (GRCm39) missense possibly damaging 0.92
R8836:Robo4 UTSW 9 37,317,130 (GRCm39) missense unknown
R8889:Robo4 UTSW 9 37,314,601 (GRCm39) missense probably benign 0.00
R9018:Robo4 UTSW 9 37,315,520 (GRCm39) missense probably benign 0.00
R9182:Robo4 UTSW 9 37,313,206 (GRCm39) start gained probably benign
R9375:Robo4 UTSW 9 37,316,158 (GRCm39) missense probably damaging 1.00
R9621:Robo4 UTSW 9 37,317,509 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTAGGTCCCAGGAGCCATTG -3'
(R):5'- TTAATGTTAGCCAGTCAGCCAGATAC -3'

Sequencing Primer
(F):5'- CAGGAGCCATTGGAGCTG -3'
(R):5'- GTTAGCCAGTCAGCCAGATACTTACC -3'
Posted On 2014-06-23