Incidental Mutation 'R0112:Fes'
ID20509
Institutional Source Beutler Lab
Gene Symbol Fes
Ensembl Gene ENSMUSG00000053158
Gene Namefeline sarcoma oncogene
Synonymsc-fes
MMRRC Submission 038398-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0112 (G1)
Quality Score225
Status Validated (trace)
Chromosome7
Chromosomal Location80377756-80387946 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 80384005 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 166 (D166G)
Ref Sequence ENSEMBL: ENSMUSP00000145612 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000080932] [ENSMUST00000205617] [ENSMUST00000206479] [ENSMUST00000206539] [ENSMUST00000206698] [ENSMUST00000206728] [ENSMUST00000206735] [ENSMUST00000206744]
Predicted Effect probably damaging
Transcript: ENSMUST00000080932
AA Change: D166G

PolyPhen 2 Score 0.978 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000079733
Gene: ENSMUSG00000053158
AA Change: D166G

DomainStartEndE-ValueType
FCH 1 94 2.22e-26 SMART
coiled coil region 133 165 N/A INTRINSIC
coiled coil region 320 344 N/A INTRINSIC
SH2 458 536 8.41e-26 SMART
TyrKc 561 814 1.57e-144 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146771
Predicted Effect probably damaging
Transcript: ENSMUST00000205617
AA Change: D166G

PolyPhen 2 Score 0.989 (Sensitivity: 0.72; Specificity: 0.97)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000206002
Predicted Effect noncoding transcript
Transcript: ENSMUST00000206271
Predicted Effect probably benign
Transcript: ENSMUST00000206479
AA Change: T150A

PolyPhen 2 Score 0.030 (Sensitivity: 0.95; Specificity: 0.82)
Predicted Effect probably benign
Transcript: ENSMUST00000206539
Predicted Effect probably benign
Transcript: ENSMUST00000206698
Predicted Effect probably damaging
Transcript: ENSMUST00000206728
AA Change: D166G

PolyPhen 2 Score 0.978 (Sensitivity: 0.76; Specificity: 0.96)
Predicted Effect probably benign
Transcript: ENSMUST00000206735
Predicted Effect probably benign
Transcript: ENSMUST00000206744
Meta Mutation Damage Score 0.1582 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.1%
  • 10x: 96.0%
  • 20x: 91.8%
Validation Efficiency 100% (86/86)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes the human cellular counterpart of a feline sarcoma retrovirus protein with transforming capabilities. The gene product has tyrosine-specific protein kinase activity and that activity is required for maintenance of cellular transformation. Its chromosomal location has linked it to a specific translocation event identified in patients with acute promyelocytic leukemia but it is also involved in normal hematopoiesis as well as growth factor and cytokine receptor signaling. Alternative splicing results in multiple variants encoding different isoforms.[provided by RefSeq, Jan 2009]
PHENOTYPE: Homozygotes for a null allele show partial in utero lethality, runting, altered hematopoietic homeostasis and macrophage function, skin lesions and susceptibility to bacterial infection. Homozygotes for another null allele show enhanced LPS sensitivity, altered hematopoiesis and larger litter size. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 81 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930568D16Rik T A 2: 35,354,803 Y179F probably benign Het
Abcd4 A G 12: 84,612,899 probably benign Het
Abhd12b C T 12: 70,181,017 T191M probably benign Het
Adcy5 A G 16: 35,156,178 E27G possibly damaging Het
Adgb G A 10: 10,407,158 probably benign Het
Afdn T C 17: 13,884,637 S1186P probably damaging Het
Atf6b G T 17: 34,651,626 R351L probably damaging Het
Axin2 T C 11: 108,939,397 S348P possibly damaging Het
BC030499 T C 11: 78,291,681 probably benign Het
Bfsp1 A C 2: 143,827,643 probably null Het
Brd1 A G 15: 88,730,383 V103A probably benign Het
Ccdc13 C A 9: 121,813,481 K392N probably damaging Het
Ccdc18 A G 5: 108,173,761 K577R probably damaging Het
Csmd2 G T 4: 128,496,029 G2186C probably damaging Het
Cyp2j5 A T 4: 96,629,523 M484K probably benign Het
Defb3 T A 8: 19,293,407 L12Q probably null Het
Defb7 G T 8: 19,495,170 probably null Het
Dhx35 T A 2: 158,840,620 M491K probably damaging Het
Dnah17 T C 11: 118,074,434 S2261G possibly damaging Het
Dnah5 A C 15: 28,263,679 E853D probably benign Het
Dner C A 1: 84,583,053 A23S probably benign Het
Dock5 A C 14: 67,819,641 S539A probably benign Het
Dsg2 T A 18: 20,583,042 F317I probably benign Het
Enox1 A T 14: 77,699,198 I539F possibly damaging Het
Eogt G A 6: 97,135,284 probably benign Het
Fbxo22 A G 9: 55,223,346 T300A probably benign Het
Fn1 A G 1: 71,609,653 S1366P probably damaging Het
Fndc3a A T 14: 72,540,495 probably benign Het
Foxh1 T C 15: 76,669,010 H168R probably benign Het
Galnt14 T G 17: 73,574,984 probably benign Het
Gdf6 A G 4: 9,844,482 D2G probably damaging Het
Gp6 C A 7: 4,370,184 A247S probably benign Het
Gp6 G C 7: 4,371,627 P232A probably benign Het
Grin2c A G 11: 115,251,134 Y820H probably damaging Het
Gtf2h4 T C 17: 35,670,448 T198A possibly damaging Het
Helz T C 11: 107,672,948 probably benign Het
Htr1d A G 4: 136,443,000 E180G probably benign Het
Igsf10 A G 3: 59,326,008 V1768A probably benign Het
Ints10 A T 8: 68,827,302 T694S probably damaging Het
Krt81 C A 15: 101,463,627 R24L possibly damaging Het
Lipc T A 9: 70,820,427 Y131F probably damaging Het
Litaf G T 16: 10,966,511 T45K probably damaging Het
Lmo7 A T 14: 101,887,193 R363* probably null Het
Lrrc37a A T 11: 103,500,913 Y1229N probably benign Het
Man2a2 C T 7: 80,358,276 A943T probably damaging Het
Mtor A G 4: 148,480,923 Y1030C probably damaging Het
Naalad2 G T 9: 18,351,447 Y384* probably null Het
Nat2 C T 8: 67,501,726 Q163* probably null Het
Nell2 A G 15: 95,431,681 probably benign Het
Nphp3 C T 9: 104,037,348 H102Y possibly damaging Het
Olfr1383 A T 11: 49,524,134 H137L possibly damaging Het
Olfr1442 C T 19: 12,674,757 T184I probably benign Het
Olfr686 A T 7: 105,203,659 M228K probably benign Het
Olr1 T C 6: 129,488,906 S46G possibly damaging Het
Parg C A 14: 32,202,433 A63E probably damaging Het
Pik3cg A G 12: 32,195,715 probably benign Het
Ripk4 A G 16: 97,743,561 C629R probably benign Het
Rnf145 A G 11: 44,564,151 T620A probably benign Het
Samd9l T G 6: 3,376,031 D410A possibly damaging Het
Serpinb9f A T 13: 33,327,951 probably benign Het
Slc19a1 T C 10: 77,042,165 I178T probably benign Het
Slco1b2 A T 6: 141,671,111 Y390F probably benign Het
Speg A G 1: 75,385,032 E230G possibly damaging Het
Tbc1d9 C A 8: 83,264,837 probably benign Het
Tmem131l G A 3: 83,940,587 Q324* probably null Het
Trf A G 9: 103,226,956 probably benign Het
Trp53 T G 11: 69,588,679 Y202D probably damaging Het
Trpv1 T A 11: 73,253,272 M618K probably damaging Het
Trrap C A 5: 144,822,761 Y2250* probably null Het
Ttc3 A G 16: 94,385,322 probably benign Het
Ubtfl1 T G 9: 18,409,787 S204A probably benign Het
Uck2 A T 1: 167,227,771 Y203N probably damaging Het
Utrn A T 10: 12,686,465 L1280* probably null Het
Vmn1r178 A T 7: 23,894,184 H146L possibly damaging Het
Vmn2r100 C A 17: 19,522,120 P252Q possibly damaging Het
Vmn2r108 T C 17: 20,471,635 M209V probably benign Het
Vmn2r9 G A 5: 108,843,125 T790I probably damaging Het
Vmn2r94 C A 17: 18,243,604 R808L probably benign Het
Zbtb7c A T 18: 76,136,891 S17C probably damaging Het
Zfp811 C T 17: 32,797,764 R434Q probably damaging Het
Zkscan6 A T 11: 65,814,863 probably benign Het
Other mutations in Fes
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01470:Fes APN 7 80383273 missense probably benign 0.01
IGL01654:Fes APN 7 80386810 critical splice donor site probably null
IGL02350:Fes APN 7 80383830 splice site probably null
IGL02357:Fes APN 7 80383830 splice site probably null
IGL02811:Fes APN 7 80379841 missense probably damaging 1.00
BB009:Fes UTSW 7 80379872 missense probably damaging 0.99
BB019:Fes UTSW 7 80379872 missense probably damaging 0.99
R0114:Fes UTSW 7 80378035 missense probably damaging 0.99
R0143:Fes UTSW 7 80383895 missense probably benign 0.00
R0786:Fes UTSW 7 80386920 missense probably damaging 1.00
R0863:Fes UTSW 7 80380886 missense probably damaging 1.00
R0918:Fes UTSW 7 80381205 missense probably damaging 1.00
R1167:Fes UTSW 7 80383109 missense probably damaging 1.00
R1174:Fes UTSW 7 80377951 missense probably damaging 1.00
R1674:Fes UTSW 7 80377938 missense probably benign 0.04
R1898:Fes UTSW 7 80379911 missense probably damaging 1.00
R1908:Fes UTSW 7 80386861 missense probably damaging 0.98
R1909:Fes UTSW 7 80386861 missense probably damaging 0.98
R1922:Fes UTSW 7 80383986 nonsense probably null
R2209:Fes UTSW 7 80380283 missense probably damaging 1.00
R2242:Fes UTSW 7 80381725 missense probably damaging 1.00
R3012:Fes UTSW 7 80387167 missense possibly damaging 0.81
R4607:Fes UTSW 7 80387211 missense probably damaging 1.00
R4608:Fes UTSW 7 80387211 missense probably damaging 1.00
R4982:Fes UTSW 7 80387204 missense probably damaging 1.00
R5516:Fes UTSW 7 80387183 missense probably damaging 1.00
R6120:Fes UTSW 7 80380867 missense probably damaging 1.00
R6148:Fes UTSW 7 80380296 missense probably damaging 1.00
R7161:Fes UTSW 7 80380861 missense probably damaging 0.98
R7401:Fes UTSW 7 80378776 critical splice donor site probably null
R7408:Fes UTSW 7 80378662 missense probably damaging 1.00
R7761:Fes UTSW 7 80380867 missense probably damaging 1.00
R7932:Fes UTSW 7 80379872 missense probably damaging 0.99
R8261:Fes UTSW 7 80383154 missense probably null 1.00
Z1177:Fes UTSW 7 80378030 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AAACCCTGTCTCCCCAAGGCTTAG -3'
(R):5'- GCCAGCAAAGGTTCGCTCTTCTTC -3'

Sequencing Primer
(F):5'- ACTGTTGGTTAGACAGCACC -3'
(R):5'- TTCCTGGCAGGGAGAAAACC -3'
Posted On2013-04-11