Mutagenetix > Incidental Mutation

Incidental Mutation 'R1834:Dnah5'

205102

Institutional Source

Beutler Lab

Gene Symbol

Dnah5

Ensembl Gene

ENSMUSG00000022262

Gene Name

dynein, axonemal, heavy chain 5

Synonyms

b2b1565Clo, b2b1134Clo, Mdnah5, b2b1537Clo, b2b1154Clo, Dnahc5

MMRRC Submission

039861-MU

Accession Numbers

NCBI RefSeq: NM_133365.3; MGI: 107718

Essential gene?

Probably essential (E-score: 0.751) question?

Stock #

R1834 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

28203752-28472052 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 28409124 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Methionine to Leucine at position 3563 (M3563L)

Ref Sequence

ENSEMBL: ENSMUSP00000069751 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000067048]

AlphaFold

no structure available at present

Predicted Effect

probably benign
Transcript: ENSMUST00000067048
AA Change: M3563L

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)

SMART Domains

Protein: ENSMUSP00000069751
Gene: ENSMUSG00000022262
AA Change: M3563L

Domain	Start	End	E-Value	Type
Pfam:DHC_N1	247	802	2.3e-163	PFAM
low complexity region	1077	1088	N/A	INTRINSIC
low complexity region	1113	1128	N/A	INTRINSIC
Pfam:DHC_N2	1399	1807	2.3e-134	PFAM
AAA	1972	2108	2e-3	SMART
AAA	2251	2424	4.3e-3	SMART
AAA	2579	2777	2.2e-3	SMART
low complexity region	2874	2889	N/A	INTRINSIC
Pfam:AAA_8	2914	3186	3.2e-70	PFAM
Pfam:MT	3198	3546	1e-44	PFAM
Pfam:AAA_9	3567	3792	1.4e-86	PFAM
low complexity region	3889	3899	N/A	INTRINSIC
Pfam:Dynein_heavy	3930	4618	4.4e-246	PFAM

Meta Mutation Damage Score

0.0819

Coding Region Coverage

1x: 97.4%
3x: 96.8%
10x: 95.1%
20x: 92.0%

Validation Efficiency

97% (116/119)

MGI Phenotype

Strain: 2180081
Lethality: D14-D21
FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a dynein protein, which is part of a microtubule-associated motor protein complex consisting of heavy, light, and intermediate chains. This protein is an axonemal heavy chain dynein. It functions as a force-generating protein with ATPase activity, whereby the release of ADP is thought to produce the force-producing power stroke. Mutations in this gene cause primary ciliary dyskinesia type 3, as well as Kartagener syndrome, which are both diseases due to ciliary defects. [provided by RefSeq, Oct 2009]
PHENOTYPE: Mice homozygous for a disruption in this gene display postnatal lethality, hydrocephalus, respiratory infections, situs inversus and ciliary immotility. [provided by MGI curators]

Allele List at MGI

All alleles(11) : Targeted(2) Gene trapped(1) Transgenic(1) Chemically induced(7)

Other mutations in this stock

Total: 114 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2310033P09Rik	A	G	11: 59,208,487	D20G	probably damaging	Het
2310061N02Rik	T	A	16: 88,707,898	S4C	unknown	Het
4933416C03Rik	T	C	10: 116,112,665	R319G	probably benign	Het
Abca3	A	T	17: 24,376,692	N340Y	probably benign	Het
Abcc1	A	G	16: 14,423,117	I513V	possibly damaging	Het
Acacb	C	T	5: 114,235,475	T1855M	probably damaging	Het
Ace	A	G	11: 105,986,094		probably benign	Het
Acss2	T	A	2: 155,558,630	Y530N	probably damaging	Het
Adarb1	C	A	10: 77,317,231		probably benign	Het
Afm	T	A	5: 90,526,424	M265K	probably benign	Het
Agl	A	G	3: 116,788,351	F293S	probably benign	Het
Aox2	G	A	1: 58,308,991	A623T	probably benign	Het
Arhgap31	C	A	16: 38,603,703	S667I	probably benign	Het
Bco1	A	G	8: 117,117,437	T297A	probably benign	Het
Bmp1	T	C	14: 70,508,831	S123G	possibly damaging	Het
Caps2	G	A	10: 112,195,718	D283N	possibly damaging	Het
Ccdc57	A	C	11: 120,861,219	S845R	probably benign	Het
Cd209f	A	G	8: 4,104,491	S119P	probably damaging	Het
Chrna6	A	G	8: 27,407,214	S212P	probably benign	Het
Col10a1	G	C	10: 34,395,015	A328P	probably damaging	Het
Col4a2	A	G	8: 11,402,997	E188G	probably benign	Het
Creb1	C	T	1: 64,550,950	Q32*	probably null	Het
Cttnbp2	C	T	6: 18,501,966	V16M	probably damaging	Het
D430041D05Rik	A	G	2: 104,168,101	S1102P	probably damaging	Het
Ddx31	C	T	2: 28,892,453	H603Y	probably damaging	Het
Ddx52	G	A	11: 83,959,497	C568Y	probably benign	Het
Dgki	C	A	6: 37,034,701		probably benign	Het
Dmrt1	A	T	19: 25,509,699	Q123L	probably damaging	Het
Dnah7b	A	T	1: 46,233,759	N2349I	possibly damaging	Het
Dscaml1	T	G	9: 45,683,632	S678A	probably benign	Het
Ece1	C	T	4: 137,958,001	R601W	probably damaging	Het
Ece1	A	G	4: 137,958,128	N643S	probably damaging	Het
Eno1b	A	G	18: 48,047,463	Y236C	probably damaging	Het
Esco1	T	C	18: 10,594,350	E312G	probably damaging	Het
Eya3	T	A	4: 132,707,118	V276E	probably damaging	Het
Fam161b	A	G	12: 84,348,778		probably benign	Het
Fem1c	C	T	18: 46,505,282	G551D	probably damaging	Het
Fer1l6	T	C	15: 58,557,869	I155T	possibly damaging	Het
Gbp7	A	G	3: 142,534,680	Y53C	probably damaging	Het
Gjb3	G	A	4: 127,326,431	R103W	probably damaging	Het
Gm10030	C	T	9: 111,004,879		noncoding transcript	Het
Gm1966	A	T	7: 106,603,776	V87D	possibly damaging	Het
Gm3443	T	A	19: 21,555,679	H2Q	unknown	Het
Gm5800	T	C	14: 51,716,092	E22G	possibly damaging	Het
Gsdma2	G	T	11: 98,649,079	R9L	probably damaging	Het
Ica1l	A	G	1: 60,028,236		probably benign	Het
Ice1	G	A	13: 70,615,338	T167I	probably damaging	Het
Ifi204	T	A	1: 173,747,606	R618S	unknown	Het
Itga2	C	A	13: 114,856,726	K784N	probably damaging	Het
Itga2	T	A	13: 114,856,727	K784M	probably damaging	Het
Kif3b	A	G	2: 153,317,485	E402G	probably benign	Het
Lrp2	T	C	2: 69,466,880	I3246V	probably benign	Het
Lrrn3	G	T	12: 41,453,518	L267I	probably damaging	Het
Map1s	A	G	8: 70,916,411	Y868C	probably damaging	Het
Mcm5	A	G	8: 75,119,273	T370A	possibly damaging	Het
Nat8f7	T	C	6: 85,707,811	S16G	probably benign	Het
Nav3	T	C	10: 109,720,022	T1683A	probably damaging	Het
Nbeal2	T	C	9: 110,627,129	N2417S	probably damaging	Het
Neb	T	C	2: 52,236,895	N3605S	probably damaging	Het
Net1	A	T	13: 3,912,941		probably benign	Het
Nsd1	A	G	13: 55,313,351	T2464A	possibly damaging	Het
Nt5e	T	A	9: 88,370,187	I534N	probably damaging	Het
Nudt12	T	A	17: 59,011,076	H58L	probably damaging	Het
Ocrl	T	A	X: 47,962,116	I74N	probably damaging	Het
Olfr291	A	G	7: 84,856,482	T38A	probably damaging	Het
Olfr403	A	G	11: 74,195,653	H50R	probably benign	Het
Olfr695	A	G	7: 106,874,141	Y35H	probably damaging	Het
Olfr826	A	G	10: 130,180,832	I16T	probably benign	Het
Pef1	C	A	4: 130,121,173	C10*	probably null	Het
Phf21b	A	G	15: 84,797,346	Y256H	probably damaging	Het
Phox2a	G	T	7: 101,820,945		probably null	Het
Pi16	A	G	17: 29,327,445	E399G	possibly damaging	Het
Pipox	A	T	11: 77,882,123	Y321N	probably damaging	Het
Plin4	A	G	17: 56,103,522	S1170P	probably damaging	Het
Pnma2	C	T	14: 66,917,213	S362L	possibly damaging	Het
Ppp1r9a	T	C	6: 5,113,710	I738T	probably damaging	Het
Prkcsh	A	T	9: 22,008,338	K188M	probably damaging	Het
Rcc1l	A	T	5: 134,163,659	Y309N	probably damaging	Het
Ripk1	A	G	13: 34,015,213	T123A	probably benign	Het
Robo4	A	G	9: 37,413,059	D961G	probably benign	Het
Rps27a	A	G	11: 29,546,299	Y105H	probably benign	Het
Scaper	A	G	9: 55,816,734	Y641H	possibly damaging	Het
Scn1a	C	A	2: 66,324,616	Q666H	probably benign	Het
Scn1a	T	A	2: 66,324,617	Q666L	probably benign	Het
Sdhaf4	T	C	1: 24,003,153		probably null	Het
Sec14l3	A	G	11: 4,066,510		probably benign	Het
Selp	C	A	1: 164,128,160		probably null	Het
Sim1	A	G	10: 50,909,828	D259G	probably damaging	Het
Sptan1	T	A	2: 29,992,001		probably benign	Het
Sptbn4	T	A	7: 27,366,646	E679V	probably null	Het
Sytl3	G	A	17: 6,728,327	E169K	probably benign	Het
Taar1	T	C	10: 23,921,189	C262R	probably benign	Het
Tbc1d32	A	G	10: 56,017,604	I1291T	probably benign	Het
Tcrg-C3	A	G	13: 19,263,365	T163A	possibly damaging	Het
Tet1	G	A	10: 62,813,665	P89S	probably damaging	Het
Tgfbrap1	C	A	1: 43,071,635	G7W	probably damaging	Het
Thada	A	G	17: 84,226,004	V1673A	possibly damaging	Het
Thbs4	A	G	13: 92,761,481	V610A	probably benign	Het
Tmem163	A	G	1: 127,677,509	S41P	probably benign	Het
Tmem65	A	T	15: 58,787,113	H200Q	probably damaging	Het
Trim62	T	C	4: 128,909,225	V356A	possibly damaging	Het
Ttn	T	C	2: 76,732,158	D28781G	probably damaging	Het
Ttn	C	T	2: 76,763,260	V20679I	probably benign	Het
Unc80	A	T	1: 66,639,248	T2063S	possibly damaging	Het
Vav3	A	G	3: 109,506,426	T227A	probably benign	Het
Vmn2r118	A	T	17: 55,592,456	I816N	probably damaging	Het
Vmn2r26	T	A	6: 124,061,410	M648K	possibly damaging	Het
Vmn2r88	T	G	14: 51,413,030		probably benign	Het
Vwa3a	A	G	7: 120,790,136	T66A	probably benign	Het
Xirp2	T	A	2: 67,511,140	Y1242N	probably damaging	Het
Ywhag	G	A	5: 135,911,530	T70M	probably damaging	Het
Zcchc6	A	T	13: 59,814,935	Y339*	probably null	Het
Zfp248	T	C	6: 118,428,970	T452A	probably damaging	Het
Zfp988	A	T	4: 147,332,887	I593F	probably damaging	Het

Other mutations in Dnah5

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00226:Dnah5	APN	15	28272342	missense	probably benign
IGL00331:Dnah5	APN	15	28421620	missense	probably damaging	1.00
IGL00519:Dnah5	APN	15	28444218	missense	probably benign	0.10
IGL00537:Dnah5	APN	15	28458702	critical splice donor site	probably null
IGL01102:Dnah5	APN	15	28410003	critical splice donor site	probably null
IGL01126:Dnah5	APN	15	28302399	missense	possibly damaging	0.85
IGL01154:Dnah5	APN	15	28458656	missense	possibly damaging	0.75
IGL01349:Dnah5	APN	15	28294913	splice site	probably benign
IGL01353:Dnah5	APN	15	28233272	missense	probably benign	0.00
IGL01372:Dnah5	APN	15	28230490	missense	probably benign	0.00
IGL01390:Dnah5	APN	15	28411540	missense	probably benign	0.00
IGL01446:Dnah5	APN	15	28326669	missense	probably damaging	1.00
IGL01472:Dnah5	APN	15	28331726	missense	probably damaging	1.00
IGL01485:Dnah5	APN	15	28331726	missense	probably damaging	1.00
IGL01568:Dnah5	APN	15	28229652	missense	probably benign	0.01
IGL01592:Dnah5	APN	15	28236637	missense	probably benign	0.01
IGL01594:Dnah5	APN	15	28311334	missense	possibly damaging	0.87
IGL01677:Dnah5	APN	15	28367782	missense	probably damaging	1.00
IGL01845:Dnah5	APN	15	28449169	missense	probably benign	0.06
IGL01904:Dnah5	APN	15	28307364	missense	probably benign	0.09
IGL01913:Dnah5	APN	15	28313753	missense	possibly damaging	0.50
IGL01950:Dnah5	APN	15	28290289	missense	probably null	1.00
IGL01963:Dnah5	APN	15	28370536	missense	probably benign	0.12
IGL02008:Dnah5	APN	15	28343552	missense	probably damaging	0.98
IGL02088:Dnah5	APN	15	28459118	critical splice acceptor site	probably null
IGL02090:Dnah5	APN	15	28240041	splice site	probably benign
IGL02114:Dnah5	APN	15	28397124	missense	probably damaging	0.97
IGL02135:Dnah5	APN	15	28247885	missense	possibly damaging	0.50
IGL02232:Dnah5	APN	15	28299240	missense	probably damaging	1.00
IGL02386:Dnah5	APN	15	28340381	missense	probably damaging	1.00
IGL02475:Dnah5	APN	15	28219150	missense	probably benign	0.09
IGL02626:Dnah5	APN	15	28307276	missense	possibly damaging	0.94
IGL02650:Dnah5	APN	15	28289047	splice site	probably benign
IGL02651:Dnah5	APN	15	28350622	missense	probably benign	0.05
IGL02652:Dnah5	APN	15	28366187	missense	probably damaging	0.99
IGL02670:Dnah5	APN	15	28409296	missense	probably damaging	1.00
IGL02697:Dnah5	APN	15	28445143	missense	probably benign	0.00
IGL02721:Dnah5	APN	15	28234243	critical splice acceptor site	probably null
IGL02858:Dnah5	APN	15	28453212	missense	possibly damaging	0.65
IGL02859:Dnah5	APN	15	28383625	missense	probably benign	0.01
IGL02945:Dnah5	APN	15	28270426	missense	probably benign	0.00
IGL02949:Dnah5	APN	15	28272185	missense	probably benign	0.32
IGL02971:Dnah5	APN	15	28384461	missense	probably damaging	1.00
IGL03017:Dnah5	APN	15	28340325	missense	possibly damaging	0.93
IGL03177:Dnah5	APN	15	28295399	missense	probably damaging	0.97
IGL03212:Dnah5	APN	15	28290163	missense	probably benign	0.08
IGL03224:Dnah5	APN	15	28459154	missense	probably damaging	1.00
IGL03231:Dnah5	APN	15	28311148	missense	probably damaging	1.00
IGL03273:Dnah5	APN	15	28458649	missense	probably damaging	0.98
IGL03294:Dnah5	APN	15	28233295	critical splice donor site	probably null
IGL03331:Dnah5	APN	15	28419940	missense	probably damaging	1.00
IGL03337:Dnah5	APN	15	28290141	missense	probably benign	0.10
IGL03367:Dnah5	APN	15	28234327	missense	possibly damaging	0.95
Firtel	UTSW	15	28448367	missense	possibly damaging	0.95
lowbar	UTSW	15	28311133	splice site	probably null
notherone	UTSW	15	28340406	missense	probably benign	0.13
scheffler	UTSW	15	28438091	splice site	probably benign
IGL02837:Dnah5	UTSW	15	28269400	missense	probably benign
P0008:Dnah5	UTSW	15	28302387	missense	probably damaging	1.00
P0014:Dnah5	UTSW	15	28403473	missense	probably damaging	1.00
PIT4687001:Dnah5	UTSW	15	28383577	missense	probably damaging	0.98
R0030:Dnah5	UTSW	15	28451517	missense	probably benign	0.34
R0087:Dnah5	UTSW	15	28350613	missense	probably damaging	1.00
R0099:Dnah5	UTSW	15	28239934	missense	probably damaging	1.00
R0102:Dnah5	UTSW	15	28245751	splice site	probably benign
R0102:Dnah5	UTSW	15	28245751	splice site	probably benign
R0104:Dnah5	UTSW	15	28453353	missense	possibly damaging	0.88
R0112:Dnah5	UTSW	15	28263679	missense	probably benign	0.00
R0122:Dnah5	UTSW	15	28378363	missense	probably damaging	1.00
R0126:Dnah5	UTSW	15	28246319	missense	probably benign	0.00
R0127:Dnah5	UTSW	15	28294925	missense	probably damaging	1.00
R0233:Dnah5	UTSW	15	28333070	missense	probably damaging	1.00
R0310:Dnah5	UTSW	15	28299110	missense	probably benign	0.19
R0386:Dnah5	UTSW	15	28383581	missense	probably damaging	1.00
R0421:Dnah5	UTSW	15	28229541	missense	possibly damaging	0.79
R0481:Dnah5	UTSW	15	28383599	missense	probably benign	0.31
R0514:Dnah5	UTSW	15	28366321	missense	probably damaging	1.00
R0609:Dnah5	UTSW	15	28327779	missense	probably benign
R0720:Dnah5	UTSW	15	28313861	missense	probably null	0.98
R0731:Dnah5	UTSW	15	28311143	missense	possibly damaging	0.78
R0747:Dnah5	UTSW	15	28444186	missense	probably damaging	0.99
R0747:Dnah5	UTSW	15	28444187	missense	possibly damaging	0.64
R0766:Dnah5	UTSW	15	28448487	missense	probably null	0.89
R0849:Dnah5	UTSW	15	28263599	missense	probably damaging	0.96
R1034:Dnah5	UTSW	15	28302471	missense	probably damaging	1.00
R1084:Dnah5	UTSW	15	28343452	missense	probably benign	0.01
R1148:Dnah5	UTSW	15	28421690	missense	probably damaging	1.00
R1148:Dnah5	UTSW	15	28421690	missense	probably damaging	1.00
R1200:Dnah5	UTSW	15	28246257	missense	possibly damaging	0.88
R1208:Dnah5	UTSW	15	28327731	missense	probably damaging	1.00
R1208:Dnah5	UTSW	15	28327731	missense	probably damaging	1.00
R1269:Dnah5	UTSW	15	28238511	missense	probably damaging	1.00
R1373:Dnah5	UTSW	15	28313918	splice site	probably benign
R1401:Dnah5	UTSW	15	28401913	missense	probably damaging	1.00
R1413:Dnah5	UTSW	15	28370409	missense	probably benign
R1430:Dnah5	UTSW	15	28345857	missense	probably benign	0.37
R1457:Dnah5	UTSW	15	28403542	critical splice donor site	probably null
R1468:Dnah5	UTSW	15	28230463	nonsense	probably null
R1468:Dnah5	UTSW	15	28230463	nonsense	probably null
R1560:Dnah5	UTSW	15	28420003	missense	probably damaging	1.00
R1568:Dnah5	UTSW	15	28409177	missense	probably damaging	0.98
R1574:Dnah5	UTSW	15	28252423	missense	probably benign	0.00
R1574:Dnah5	UTSW	15	28252423	missense	probably benign	0.00
R1603:Dnah5	UTSW	15	28294985	splice site	probably benign
R1603:Dnah5	UTSW	15	28449180	missense	probably benign	0.09
R1673:Dnah5	UTSW	15	28290148	missense	probably benign
R1755:Dnah5	UTSW	15	28326636	missense	probably damaging	0.99
R1785:Dnah5	UTSW	15	28313786	missense	probably damaging	1.00
R1786:Dnah5	UTSW	15	28313786	missense	probably damaging	1.00
R1789:Dnah5	UTSW	15	28270426	missense	probably benign	0.00
R1817:Dnah5	UTSW	15	28246400	nonsense	probably null
R1819:Dnah5	UTSW	15	28246400	nonsense	probably null
R1855:Dnah5	UTSW	15	28411669	missense	possibly damaging	0.88
R1870:Dnah5	UTSW	15	28331713	nonsense	probably null
R1871:Dnah5	UTSW	15	28331713	nonsense	probably null
R1987:Dnah5	UTSW	15	28343591	missense	probably damaging	0.99
R1988:Dnah5	UTSW	15	28343591	missense	probably damaging	0.99
R1989:Dnah5	UTSW	15	28343591	missense	probably damaging	0.99
R2062:Dnah5	UTSW	15	28366270	missense	probably damaging	1.00
R2069:Dnah5	UTSW	15	28312388	splice site	probably null
R2121:Dnah5	UTSW	15	28297005	splice site	probably benign
R2128:Dnah5	UTSW	15	28408321	missense	probably benign	0.00
R2129:Dnah5	UTSW	15	28408321	missense	probably benign	0.00
R2151:Dnah5	UTSW	15	28444091	missense	probably damaging	1.00
R2159:Dnah5	UTSW	15	28252545	missense	probably benign	0.00
R2207:Dnah5	UTSW	15	28343671	missense	probably benign	0.11
R2231:Dnah5	UTSW	15	28408417	critical splice donor site	probably null
R2232:Dnah5	UTSW	15	28408417	critical splice donor site	probably null
R2282:Dnah5	UTSW	15	28327302	missense	probably damaging	0.99
R2305:Dnah5	UTSW	15	28387767	missense	probably benign	0.25
R2339:Dnah5	UTSW	15	28313882	missense	probably benign	0.00
R2437:Dnah5	UTSW	15	28307391	critical splice donor site	probably null
R2696:Dnah5	UTSW	15	28278576	missense	probably benign	0.00
R3156:Dnah5	UTSW	15	28438091	splice site	probably benign
R3431:Dnah5	UTSW	15	28295267	missense	probably benign	0.20
R3700:Dnah5	UTSW	15	28387791	missense	possibly damaging	0.72
R3724:Dnah5	UTSW	15	28270420	missense	probably benign	0.08
R3732:Dnah5	UTSW	15	28409122	missense	possibly damaging	0.64
R3872:Dnah5	UTSW	15	28411510	missense	possibly damaging	0.50
R4063:Dnah5	UTSW	15	28420998	missense	probably damaging	0.98
R4072:Dnah5	UTSW	15	28340298	nonsense	probably null
R4075:Dnah5	UTSW	15	28293791	missense	probably benign
R4245:Dnah5	UTSW	15	28219189	missense	probably benign
R4254:Dnah5	UTSW	15	28438102	missense	probably benign	0.07
R4255:Dnah5	UTSW	15	28438102	missense	probably benign	0.07
R4392:Dnah5	UTSW	15	28289229	missense	probably benign	0.19
R4552:Dnah5	UTSW	15	28397154	missense	probably benign	0.19
R4574:Dnah5	UTSW	15	28367763	missense	probably benign	0.05
R4577:Dnah5	UTSW	15	28289250	missense	probably benign	0.06
R4587:Dnah5	UTSW	15	28304599	missense	probably damaging	1.00
R4631:Dnah5	UTSW	15	28401953	missense	probably damaging	1.00
R4631:Dnah5	UTSW	15	28419994	missense	probably damaging	1.00
R4676:Dnah5	UTSW	15	28295260	missense	possibly damaging	0.65
R4707:Dnah5	UTSW	15	28372375	missense	probably damaging	0.97
R4754:Dnah5	UTSW	15	28420955	splice site	probably null
R4767:Dnah5	UTSW	15	28270474	missense	probably benign	0.02
R4857:Dnah5	UTSW	15	28345807	missense	probably benign	0.00
R4883:Dnah5	UTSW	15	28343638	missense	probably benign	0.00
R4889:Dnah5	UTSW	15	28235792	missense	probably benign	0.01
R4946:Dnah5	UTSW	15	28326557	missense	probably damaging	0.96
R4946:Dnah5	UTSW	15	28387904	missense	probably damaging	1.00
R4947:Dnah5	UTSW	15	28272372	missense	probably benign
R5033:Dnah5	UTSW	15	28421678	missense	probably damaging	0.96
R5164:Dnah5	UTSW	15	28408292	missense	probably benign	0.00
R5175:Dnah5	UTSW	15	28448404	missense	probably damaging	1.00
R5182:Dnah5	UTSW	15	28311278	missense	probably damaging	0.99
R5187:Dnah5	UTSW	15	28272172	missense	probably benign	0.41
R5272:Dnah5	UTSW	15	28350665	missense	probably benign
R5308:Dnah5	UTSW	15	28229651	missense	possibly damaging	0.80
R5310:Dnah5	UTSW	15	28311328	missense	probably damaging	1.00
R5322:Dnah5	UTSW	15	28384244	missense	probably benign	0.41
R5398:Dnah5	UTSW	15	28293726	missense	probably benign
R5596:Dnah5	UTSW	15	28343608	missense	probably damaging	1.00
R5603:Dnah5	UTSW	15	28419932	missense	probably damaging	1.00
R5619:Dnah5	UTSW	15	28302435	missense	probably damaging	1.00
R5656:Dnah5	UTSW	15	28421064	missense	probably benign	0.03
R5741:Dnah5	UTSW	15	28246367	missense	probably benign	0.11
R5754:Dnah5	UTSW	15	28401868	missense	probably benign	0.01
R5763:Dnah5	UTSW	15	28311152	missense	probably damaging	1.00
R5824:Dnah5	UTSW	15	28313821	missense	probably benign	0.00
R5836:Dnah5	UTSW	15	28383592	missense	probably damaging	1.00
R5838:Dnah5	UTSW	15	28290195	missense	probably benign	0.00
R5864:Dnah5	UTSW	15	28297013	missense	possibly damaging	0.83
R5895:Dnah5	UTSW	15	28234453	splice site	probably null
R5896:Dnah5	UTSW	15	28272060	missense	probably benign
R5899:Dnah5	UTSW	15	28448367	missense	possibly damaging	0.95
R5905:Dnah5	UTSW	15	28387833	missense	probably damaging	1.00
R5924:Dnah5	UTSW	15	28307327	missense	probably benign	0.41
R5927:Dnah5	UTSW	15	28335718	missense	probably benign	0.00
R5929:Dnah5	UTSW	15	28311207	missense	probably benign	0.01
R5929:Dnah5	UTSW	15	28311208	missense	probably damaging	1.00
R5931:Dnah5	UTSW	15	28453279	missense	probably damaging	0.99
R5964:Dnah5	UTSW	15	28458584	missense	possibly damaging	0.49
R5975:Dnah5	UTSW	15	28234282	missense	probably damaging	1.00
R5993:Dnah5	UTSW	15	28299226	missense	probably benign	0.09
R6016:Dnah5	UTSW	15	28327884	missense	probably damaging	1.00
R6028:Dnah5	UTSW	15	28387833	missense	probably damaging	1.00
R6065:Dnah5	UTSW	15	28230468	missense	possibly damaging	0.47
R6117:Dnah5	UTSW	15	28270420	missense	probably damaging	0.99
R6143:Dnah5	UTSW	15	28233231	missense	probably benign	0.05
R6146:Dnah5	UTSW	15	28459185	missense	probably benign
R6154:Dnah5	UTSW	15	28204031	missense	probably benign	0.15
R6164:Dnah5	UTSW	15	28378343	missense	probably benign	0.08
R6266:Dnah5	UTSW	15	28335627	missense	possibly damaging	0.67
R6321:Dnah5	UTSW	15	28372411	missense	probably damaging	0.99
R6349:Dnah5	UTSW	15	28238511	missense	probably damaging	1.00
R6431:Dnah5	UTSW	15	28349824	missense	possibly damaging	0.52
R6467:Dnah5	UTSW	15	28438183	missense	probably benign	0.10
R6564:Dnah5	UTSW	15	28367745	missense	probably benign
R6607:Dnah5	UTSW	15	28445200	missense	possibly damaging	0.95
R6619:Dnah5	UTSW	15	28409120	missense	probably benign	0.03
R6633:Dnah5	UTSW	15	28293787	missense	probably benign	0.27
R6647:Dnah5	UTSW	15	28403487	missense	probably benign	0.02
R6782:Dnah5	UTSW	15	28449156	missense	possibly damaging	0.89
R6797:Dnah5	UTSW	15	28233238	nonsense	probably null
R6797:Dnah5	UTSW	15	28451463	missense	probably damaging	1.00
R6831:Dnah5	UTSW	15	28411515	missense	possibly damaging	0.88
R6849:Dnah5	UTSW	15	28278624	missense	probably benign	0.14
R6871:Dnah5	UTSW	15	28229640	missense	probably benign	0.32
R6936:Dnah5	UTSW	15	28409268	missense	probably damaging	1.00
R6943:Dnah5	UTSW	15	28235720	missense	probably damaging	1.00
R7030:Dnah5	UTSW	15	28238592	missense	probably benign
R7030:Dnah5	UTSW	15	28333062	missense	probably benign	0.00
R7032:Dnah5	UTSW	15	28326650	missense	probably damaging	1.00
R7063:Dnah5	UTSW	15	28233248	missense	probably benign	0.00
R7094:Dnah5	UTSW	15	28453336	missense	probably damaging	0.98
R7097:Dnah5	UTSW	15	28453264	missense	probably benign	0.00
R7126:Dnah5	UTSW	15	28349837	missense	probably benign	0.03
R7153:Dnah5	UTSW	15	28365522	splice site	probably null
R7209:Dnah5	UTSW	15	28459225	missense	possibly damaging	0.71
R7276:Dnah5	UTSW	15	28367838	missense	probably damaging	1.00
R7320:Dnah5	UTSW	15	28270470	missense	probably null	0.33
R7350:Dnah5	UTSW	15	28235819	critical splice donor site	probably null
R7380:Dnah5	UTSW	15	28370378	missense	probably damaging	1.00
R7438:Dnah5	UTSW	15	28346952	missense	probably damaging	0.99
R7499:Dnah5	UTSW	15	28302450	missense	probably damaging	1.00
R7513:Dnah5	UTSW	15	28370415	missense	probably benign
R7519:Dnah5	UTSW	15	28390483	missense	probably damaging	0.98
R7524:Dnah5	UTSW	15	28297066	missense	possibly damaging	0.50
R7556:Dnah5	UTSW	15	28290243	missense	probably null	0.43
R7570:Dnah5	UTSW	15	28346952	missense	probably damaging	1.00
R7585:Dnah5	UTSW	15	28401868	missense	probably benign	0.09
R7642:Dnah5	UTSW	15	28247979	critical splice donor site	probably null
R7670:Dnah5	UTSW	15	28246232	splice site	probably null
R7763:Dnah5	UTSW	15	28313855	missense	probably damaging	1.00
R7821:Dnah5	UTSW	15	28411532	missense	possibly damaging	0.89
R7826:Dnah5	UTSW	15	28367812	missense	probably damaging	1.00
R7872:Dnah5	UTSW	15	28245684	missense	probably damaging	0.99
R7889:Dnah5	UTSW	15	28448414	nonsense	probably null
R7919:Dnah5	UTSW	15	28350596	missense	probably damaging	1.00
R7920:Dnah5	UTSW	15	28453222	missense	probably benign	0.00
R7936:Dnah5	UTSW	15	28345837	missense	possibly damaging	0.64
R7996:Dnah5	UTSW	15	28409177	missense	probably damaging	0.98
R8063:Dnah5	UTSW	15	28230583	missense	probably benign
R8084:Dnah5	UTSW	15	28387953	missense	probably damaging	1.00
R8105:Dnah5	UTSW	15	28372402	missense	probably benign
R8114:Dnah5	UTSW	15	28239976	missense	probably benign	0.01
R8142:Dnah5	UTSW	15	28384373	missense	probably benign	0.36
R8153:Dnah5	UTSW	15	28384430	missense	probably damaging	1.00
R8161:Dnah5	UTSW	15	28350704	missense	possibly damaging	0.79
R8174:Dnah5	UTSW	15	28311133	splice site	probably null
R8187:Dnah5	UTSW	15	28384209	missense	probably damaging	1.00
R8194:Dnah5	UTSW	15	28453268	missense	probably damaging	0.99
R8280:Dnah5	UTSW	15	28408392	missense	probably benign	0.01
R8291:Dnah5	UTSW	15	28263597	missense	probably benign	0.03
R8324:Dnah5	UTSW	15	28346865	missense	probably damaging	1.00
R8347:Dnah5	UTSW	15	28236666	missense	possibly damaging	0.90
R8356:Dnah5	UTSW	15	28444167	missense	probably benign	0.03
R8356:Dnah5	UTSW	15	28444323	missense	probably null	0.02
R8361:Dnah5	UTSW	15	28331810	missense	probably damaging	0.98
R8375:Dnah5	UTSW	15	28327343	missense	probably benign	0.00
R8474:Dnah5	UTSW	15	28247832	missense	probably benign	0.00
R8481:Dnah5	UTSW	15	28419795	missense	probably benign	0.00
R8494:Dnah5	UTSW	15	28345831	missense	probably benign	0.32
R8495:Dnah5	UTSW	15	28409268	missense	probably damaging	0.97
R8519:Dnah5	UTSW	15	28299099	missense	probably benign	0.07
R8683:Dnah5	UTSW	15	28289221	missense	probably benign	0.00
R8739:Dnah5	UTSW	15	28345860	missense	probably benign	0.01
R8752:Dnah5	UTSW	15	28290219	missense	probably benign	0.00
R8784:Dnah5	UTSW	15	28387951	missense	probably benign	0.16
R8813:Dnah5	UTSW	15	28229573	missense	probably damaging	1.00
R8862:Dnah5	UTSW	15	28459356	splice site	probably benign
R8873:Dnah5	UTSW	15	28219188	missense	probably benign
R8885:Dnah5	UTSW	15	28327740	missense	probably damaging	1.00
R8901:Dnah5	UTSW	15	28365569	missense	possibly damaging	0.76
R9025:Dnah5	UTSW	15	28409266	missense	probably damaging	1.00
R9037:Dnah5	UTSW	15	28247958	missense	probably benign	0.05
R9057:Dnah5	UTSW	15	28390868	missense	probably damaging	1.00
R9059:Dnah5	UTSW	15	28245666	missense	probably benign
R9065:Dnah5	UTSW	15	28293790	missense	probably benign	0.09
R9098:Dnah5	UTSW	15	28419961	missense
R9118:Dnah5	UTSW	15	28401848	frame shift	probably null
R9149:Dnah5	UTSW	15	28387768	missense	probably benign	0.00
R9184:Dnah5	UTSW	15	28340406	missense	probably benign	0.13
R9205:Dnah5	UTSW	15	28448334	missense	possibly damaging	0.88
R9297:Dnah5	UTSW	15	28203908	start gained	probably benign
R9302:Dnah5	UTSW	15	28239886	missense	probably benign	0.03
R9310:Dnah5	UTSW	15	28448433	missense	probably damaging	1.00
R9318:Dnah5	UTSW	15	28203908	start gained	probably benign
R9405:Dnah5	UTSW	15	28272160	missense	probably benign
R9424:Dnah5	UTSW	15	28272140	missense	probably benign	0.01
R9467:Dnah5	UTSW	15	28366147	missense	possibly damaging	0.94
R9469:Dnah5	UTSW	15	28421000	missense	probably benign	0.06
R9548:Dnah5	UTSW	15	28327879	missense	possibly damaging	0.79
R9564:Dnah5	UTSW	15	28290276	missense	probably benign	0.04
R9576:Dnah5	UTSW	15	28272140	missense	probably benign	0.01
R9593:Dnah5	UTSW	15	28236628	missense	probably benign
R9644:Dnah5	UTSW	15	28230504	missense	probably damaging	0.98
R9655:Dnah5	UTSW	15	28242754	missense	probably benign
R9657:Dnah5	UTSW	15	28409943	missense	probably damaging	1.00
R9704:Dnah5	UTSW	15	28247819	missense	probably benign	0.00
R9797:Dnah5	UTSW	15	28233170	missense	probably benign	0.34
RF009:Dnah5	UTSW	15	28204019	missense	probably benign	0.00
X0011:Dnah5	UTSW	15	28408381	missense	probably benign	0.16
X0018:Dnah5	UTSW	15	28269354	missense	probably benign	0.00
X0022:Dnah5	UTSW	15	28270411	missense	probably benign	0.01
X0023:Dnah5	UTSW	15	28384308	missense	probably damaging	0.99
X0028:Dnah5	UTSW	15	28470477	missense	probably damaging	1.00
Z1088:Dnah5	UTSW	15	28366357	missense	probably null	0.10
Z1088:Dnah5	UTSW	15	28384230	missense	probably damaging	1.00
Z1177:Dnah5	UTSW	15	28270354	missense	probably benign	0.32
Z1177:Dnah5	UTSW	15	28270403	missense	probably benign	0.00
Z1177:Dnah5	UTSW	15	28295311	missense	probably damaging	0.98
Z1177:Dnah5	UTSW	15	28387763	missense	possibly damaging	0.72

Predicted Primers

PCR Primer
(F):5'- CACAAAATATTTTCGGGGTGCTTG -3'
(R):5'- ATGAGAGGGCCCTACAAAAC -3'

Sequencing Primer
(F):5'- AAAATATTTTCGGGGTGCTTGCTTTC -3'
(R):5'- GAAATCACCTGGAGTTCATTTTGGC -3'

Posted On

2014-06-23