Incidental Mutation 'R1835:Aox2'
ID 205126
Institutional Source Beutler Lab
Gene Symbol Aox2
Ensembl Gene ENSMUSG00000079554
Gene Name aldehyde oxidase 2
Synonyms Aox3l1
MMRRC Submission 039862-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.068) question?
Stock # R1835 (G1)
Quality Score 225
Status Not validated
Chromosome 1
Chromosomal Location 58278326-58380259 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) G to A at 58308991 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Alanine to Threonine at position 623 (A623T)
Ref Sequence ENSEMBL: ENSMUSP00000110006 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000114366]
AlphaFold Q5SGK3
Predicted Effect probably benign
Transcript: ENSMUST00000114366
AA Change: A623T

PolyPhen 2 Score 0.076 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000110006
Gene: ENSMUSG00000079554
AA Change: A623T

DomainStartEndE-ValueType
Pfam:Fer2 13 83 3.4e-9 PFAM
Pfam:Fer2_2 92 166 4.2e-30 PFAM
Pfam:FAD_binding_5 241 421 5.1e-46 PFAM
CO_deh_flav_C 428 532 1.4e-23 SMART
Ald_Xan_dh_C 604 707 4.64e-47 SMART
Pfam:Ald_Xan_dh_C2 717 1251 1.3e-178 PFAM
low complexity region 1257 1271 N/A INTRINSIC
low complexity region 1285 1303 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000161126
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 97.4%
  • 3x: 96.8%
  • 10x: 94.9%
  • 20x: 91.0%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 97 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610507B11Rik G T 11: 78,287,750 V1993F probably damaging Het
4933425L06Rik C A 13: 105,082,194 A12E unknown Het
Acss2 T A 2: 155,558,630 Y530N probably damaging Het
Adam4 T C 12: 81,419,559 I763V probably benign Het
Aipl1 T G 11: 72,030,499 K190T possibly damaging Het
Alms1 T A 6: 85,678,503 S3344T possibly damaging Het
Alpi A G 1: 87,099,414 V381A possibly damaging Het
Ankfn1 A T 11: 89,447,618 S365R probably benign Het
Apc T A 18: 34,317,077 L2308Q probably damaging Het
Atp9b C T 18: 80,778,883 V501I probably benign Het
Baz2b T C 2: 59,901,819 E1994G probably benign Het
Cacna1a T C 8: 84,581,357 probably null Het
Cacna1h C A 17: 25,392,076 V583L probably benign Het
Cd55 T C 1: 130,447,609 probably benign Het
Cep192 T A 18: 67,804,424 S75T possibly damaging Het
Cfap54 T A 10: 92,962,375 D1674V probably benign Het
Churc1 T C 12: 76,773,297 F27L possibly damaging Het
Coro1c A G 5: 113,848,543 I280T probably benign Het
Creb1 C T 1: 64,550,950 Q32* probably null Het
Cyp2b9 A G 7: 26,200,783 T339A probably benign Het
Dctn3 T C 4: 41,720,813 R51G probably damaging Het
Ddb1 T C 19: 10,626,593 V888A probably damaging Het
Disp1 A G 1: 183,089,000 Y619H probably damaging Het
Dnajc9 T C 14: 20,388,334 D96G possibly damaging Het
Eepd1 A G 9: 25,482,868 T143A possibly damaging Het
Eps8 T A 6: 137,522,279 K204* probably null Het
Ercc5 T A 1: 44,180,875 S1102R probably benign Het
Ergic2 T A 6: 148,189,581 Y211F possibly damaging Het
Fam135b G T 15: 71,490,711 L274M probably damaging Het
Fat3 G A 9: 15,998,088 T2206I probably damaging Het
Fat4 A G 3: 38,983,571 I3791V probably benign Het
Gemin4 A G 11: 76,213,296 M213T possibly damaging Het
Gnai3 T C 3: 108,118,407 M119V probably benign Het
Heatr5b A T 17: 78,773,563 L1420Q probably damaging Het
Herc2 G T 7: 56,206,765 G3918* probably null Het
Ints9 A G 14: 65,032,256 Y465C probably damaging Het
Ist1 A G 8: 109,678,883 V175A probably damaging Het
Kcnj12 T C 11: 61,069,557 L227P possibly damaging Het
Kcnq5 T C 1: 21,466,387 S416G probably benign Het
Kdm3a T A 6: 71,613,956 T295S probably benign Het
Kif1c T A 11: 70,708,971 M479K probably damaging Het
Kif20b T C 19: 34,956,038 L83P probably damaging Het
Kndc1 A G 7: 139,927,711 E1194G probably damaging Het
Llgl1 A G 11: 60,704,730 M81V probably benign Het
Map4k5 C A 12: 69,824,662 M495I probably damaging Het
Mest C T 6: 30,742,791 R146C probably benign Het
Mettl24 T A 10: 40,737,816 probably null Het
Mical1 T C 10: 41,483,535 S586P probably benign Het
Mrgpra3 G T 7: 47,589,946 Y77* probably null Het
Mss51 A T 14: 20,483,178 C408* probably null Het
Myh6 T C 14: 54,957,401 T666A probably benign Het
Myo10 T C 15: 25,805,587 C1685R possibly damaging Het
Naip5 A T 13: 100,223,218 Y503* probably null Het
Neil1 A C 9: 57,146,604 F144C probably damaging Het
Nipbl T A 15: 8,343,517 I1082F possibly damaging Het
Nkiras1 T C 14: 18,276,732 V7A probably damaging Het
Ntng2 G A 2: 29,197,057 Q384* probably null Het
Ocrl T A X: 47,962,116 I74N probably damaging Het
Olfr137 A T 17: 38,305,312 S50T probably benign Het
Olfr1385 A T 11: 49,494,670 I46F probably damaging Het
Olfr1408 A G 1: 173,130,815 V134A probably benign Het
Olfr381 A C 11: 73,486,374 V150G probably benign Het
Olfr535 A G 7: 140,492,709 S24G probably benign Het
Olfr761 C T 17: 37,952,385 G213E possibly damaging Het
Patj A G 4: 98,491,590 D151G probably benign Het
Plpbp T C 8: 27,049,231 V126A probably damaging Het
Pold2 A G 11: 5,873,454 L325P possibly damaging Het
Ppp1r12c A C 7: 4,483,651 S480A probably damaging Het
Pum1 T C 4: 130,701,048 S124P possibly damaging Het
Pwp2 C G 10: 78,179,091 G353A probably damaging Het
Reln C A 5: 21,979,002 Q1666H probably damaging Het
Rnf19a T C 15: 36,265,925 I9V probably benign Het
Ryr2 T C 13: 11,769,878 H1063R probably benign Het
Samd14 C G 11: 95,023,600 D361E probably damaging Het
Samd15 A T 12: 87,201,843 N365I probably damaging Het
Sec16b A G 1: 157,531,312 H105R probably benign Het
Sez6 T C 11: 77,953,503 S51P probably benign Het
Sh3bp1 T A 15: 78,905,150 L236Q probably damaging Het
Sspo C T 6: 48,457,340 T991I probably damaging Het
Suco A T 1: 161,859,500 L97* probably null Het
Tab1 C A 15: 80,148,296 R35S probably benign Het
Tet3 C A 6: 83,404,163 S341I possibly damaging Het
Tlr1 A T 5: 64,925,700 D511E probably benign Het
Tmem132b A C 5: 125,785,899 D656A probably damaging Het
Tmtc4 T A 14: 122,941,988 probably null Het
Trmo T C 4: 46,380,158 T404A probably damaging Het
Trpm1 A G 7: 64,230,268 K790E probably damaging Het
Ulk4 C A 9: 121,168,184 R774M probably null Het
Ush2a C T 1: 188,451,818 L1440F probably benign Het
Usp16 A G 16: 87,480,907 K682E probably damaging Het
Virma T C 4: 11,540,511 S1471P probably benign Het
Vmn1r177 A T 7: 23,865,686 I255N probably damaging Het
Vmn2r61 A T 7: 42,266,652 R230* probably null Het
Vps13c T A 9: 67,993,013 F3671L probably benign Het
Washc5 T C 15: 59,359,340 N358S possibly damaging Het
Wdr72 A G 9: 74,151,617 K331E probably damaging Het
Zfp986 A T 4: 145,899,235 K155I probably benign Het
Other mutations in Aox2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01014:Aox2 APN 1 58322801 missense possibly damaging 0.73
IGL01288:Aox2 APN 1 58294407 missense probably damaging 0.99
IGL01383:Aox2 APN 1 58294305 missense probably benign 0.09
IGL01734:Aox2 APN 1 58354310 missense possibly damaging 0.95
IGL01793:Aox2 APN 1 58336624 missense possibly damaging 0.79
IGL01834:Aox2 APN 1 58309024 missense possibly damaging 0.90
IGL01924:Aox2 APN 1 58287743 missense possibly damaging 0.90
IGL02591:Aox2 APN 1 58358999 nonsense probably null
IGL02645:Aox2 APN 1 58334724 missense probably damaging 1.00
IGL02710:Aox2 APN 1 58334769 critical splice donor site probably null
IGL02801:Aox2 APN 1 58354177 missense probably damaging 1.00
IGL02988:Aox2 APN 1 58337350 missense probably benign
IGL03104:Aox2 APN 1 58282759 missense probably benign
IGL03121:Aox2 APN 1 58358954 missense probably damaging 1.00
IGL03191:Aox2 APN 1 58359069 missense probably null 0.98
IGL03236:Aox2 APN 1 58309997 nonsense probably null
IGL03409:Aox2 APN 1 58354429 missense possibly damaging 0.91
PIT4362001:Aox2 UTSW 1 58282680 missense probably damaging 1.00
R0035:Aox2 UTSW 1 58354422 missense probably benign 0.00
R0035:Aox2 UTSW 1 58354422 missense probably benign 0.00
R0267:Aox2 UTSW 1 58339446 splice site probably benign
R0388:Aox2 UTSW 1 58354406 missense probably damaging 1.00
R0409:Aox2 UTSW 1 58336624 missense possibly damaging 0.90
R0547:Aox2 UTSW 1 58310042 missense probably damaging 0.96
R0630:Aox2 UTSW 1 58337321 splice site probably benign
R0726:Aox2 UTSW 1 58334782 splice site probably benign
R0734:Aox2 UTSW 1 58305341 missense probably benign 0.22
R0831:Aox2 UTSW 1 58339683 missense probably benign 0.28
R0961:Aox2 UTSW 1 58310071 missense probably benign 0.00
R1404:Aox2 UTSW 1 58346212 splice site probably benign
R1512:Aox2 UTSW 1 58307351 missense probably benign 0.00
R1573:Aox2 UTSW 1 58309027 missense probably benign 0.00
R1592:Aox2 UTSW 1 58300694 missense probably benign 0.00
R1747:Aox2 UTSW 1 58339592 missense probably benign 0.01
R1768:Aox2 UTSW 1 58354195 missense probably benign 0.00
R1809:Aox2 UTSW 1 58294325 missense probably benign
R1823:Aox2 UTSW 1 58312359 missense probably benign 0.02
R1834:Aox2 UTSW 1 58308991 missense probably benign 0.08
R1836:Aox2 UTSW 1 58308991 missense probably benign 0.08
R2219:Aox2 UTSW 1 58349130 splice site probably null
R2220:Aox2 UTSW 1 58349130 splice site probably null
R2508:Aox2 UTSW 1 58343673 missense probably benign 0.38
R2942:Aox2 UTSW 1 58337381 missense probably benign 0.03
R2967:Aox2 UTSW 1 58322834 missense probably damaging 0.96
R3082:Aox2 UTSW 1 58283600 splice site probably benign
R3161:Aox2 UTSW 1 58304438 missense possibly damaging 0.91
R3408:Aox2 UTSW 1 58343668 missense probably benign 0.32
R3803:Aox2 UTSW 1 58289899 splice site probably null
R3894:Aox2 UTSW 1 58334678 critical splice acceptor site probably null
R4214:Aox2 UTSW 1 58307444 critical splice donor site probably null
R4249:Aox2 UTSW 1 58299819 missense probably benign 0.01
R4666:Aox2 UTSW 1 58304597 nonsense probably null
R4668:Aox2 UTSW 1 58334694 missense possibly damaging 0.63
R4703:Aox2 UTSW 1 58358957 missense possibly damaging 0.78
R4758:Aox2 UTSW 1 58332582 missense probably benign 0.00
R4890:Aox2 UTSW 1 58334703 missense probably benign 0.11
R4900:Aox2 UTSW 1 58305385 missense probably benign
R4924:Aox2 UTSW 1 58305344 missense probably damaging 1.00
R4970:Aox2 UTSW 1 58310095 splice site probably null
R5112:Aox2 UTSW 1 58310095 splice site probably null
R5987:Aox2 UTSW 1 58307359 missense probably benign 0.00
R6239:Aox2 UTSW 1 58305391 critical splice donor site probably null
R6273:Aox2 UTSW 1 58339672 missense probably benign 0.00
R6291:Aox2 UTSW 1 58330806 missense probably damaging 0.98
R6334:Aox2 UTSW 1 58307407 nonsense probably null
R6764:Aox2 UTSW 1 58350282 missense probably damaging 0.97
R6766:Aox2 UTSW 1 58349068 missense possibly damaging 0.95
R6789:Aox2 UTSW 1 58304485 missense probably benign 0.01
R6804:Aox2 UTSW 1 58304598 missense probably benign 0.04
R7007:Aox2 UTSW 1 58330892 missense probably damaging 1.00
R7015:Aox2 UTSW 1 58282758 missense probably benign 0.00
R7055:Aox2 UTSW 1 58299768 missense probably benign 0.08
R7089:Aox2 UTSW 1 58336649 missense probably benign 0.01
R7157:Aox2 UTSW 1 58283492 missense probably benign 0.00
R7303:Aox2 UTSW 1 58334765 nonsense probably null
R7426:Aox2 UTSW 1 58289983 nonsense probably null
R7762:Aox2 UTSW 1 58349104 missense probably damaging 1.00
R7899:Aox2 UTSW 1 58281237 splice site probably null
R7942:Aox2 UTSW 1 58337431 missense probably damaging 1.00
R7975:Aox2 UTSW 1 58309028 missense probably benign 0.02
R8029:Aox2 UTSW 1 58343668 missense probably benign 0.32
R8032:Aox2 UTSW 1 58350283 missense probably benign 0.01
R8147:Aox2 UTSW 1 58300662 missense probably benign 0.02
R8165:Aox2 UTSW 1 58308929 missense probably benign 0.08
R8326:Aox2 UTSW 1 58295887 missense probably benign
R8770:Aox2 UTSW 1 58339604 missense probably benign 0.10
R8973:Aox2 UTSW 1 58289954 missense probably benign 0.34
R9015:Aox2 UTSW 1 58343692 missense probably damaging 1.00
R9097:Aox2 UTSW 1 58287728 missense possibly damaging 0.82
R9101:Aox2 UTSW 1 58332637 missense probably benign 0.03
R9108:Aox2 UTSW 1 58282692 missense probably damaging 1.00
R9180:Aox2 UTSW 1 58339618 nonsense probably null
R9258:Aox2 UTSW 1 58312356 missense probably damaging 1.00
R9293:Aox2 UTSW 1 58322794 missense possibly damaging 0.86
R9519:Aox2 UTSW 1 58334767 missense probably damaging 0.98
R9581:Aox2 UTSW 1 58330896 critical splice donor site probably null
Z1177:Aox2 UTSW 1 58354397 missense possibly damaging 0.69
Predicted Primers PCR Primer
(F):5'- TCCGATGTTTGTGACCCACG -3'
(R):5'- AAAGTCCATCTCTTGGTCGGC -3'

Sequencing Primer
(F):5'- TCAGAAGGCCACCTGAGG -3'
(R):5'- ATCTCTTGGTCGGCATTTAAAGC -3'
Posted On 2014-06-23