Incidental Mutation 'R1835:Sec16b'
ID205131
Institutional Source Beutler Lab
Gene Symbol Sec16b
Ensembl Gene ENSMUSG00000026589
Gene NameSEC16 homolog B (S. cerevisiae)
SynonymsRgpr, Lztr2, Rgpr-p117
MMRRC Submission 039862-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1835 (G1)
Quality Score225
Status Not validated
Chromosome1
Chromosomal Location157506728-157568425 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 157531312 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Arginine at position 105 (H105R)
Ref Sequence ENSEMBL: ENSMUSP00000107329 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027881] [ENSMUST00000086130] [ENSMUST00000111700] [ENSMUST00000146873]
Predicted Effect probably benign
Transcript: ENSMUST00000027881
AA Change: H105R

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000027881
Gene: ENSMUSG00000026589
AA Change: H105R

DomainStartEndE-ValueType
low complexity region 212 232 N/A INTRINSIC
Pfam:Sec16 270 371 1.7e-19 PFAM
Pfam:Sec16_C 436 681 1e-38 PFAM
low complexity region 795 810 N/A INTRINSIC
low complexity region 858 876 N/A INTRINSIC
low complexity region 900 909 N/A INTRINSIC
low complexity region 915 963 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000086130
AA Change: H105R

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000083300
Gene: ENSMUSG00000026589
AA Change: H105R

DomainStartEndE-ValueType
low complexity region 212 232 N/A INTRINSIC
Pfam:Sec16 271 370 4.8e-8 PFAM
Pfam:Sec16_C 437 677 2.2e-45 PFAM
low complexity region 795 810 N/A INTRINSIC
low complexity region 858 876 N/A INTRINSIC
low complexity region 900 909 N/A INTRINSIC
low complexity region 915 963 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000111700
AA Change: H105R

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000107329
Gene: ENSMUSG00000026589
AA Change: H105R

DomainStartEndE-ValueType
low complexity region 212 232 N/A INTRINSIC
Pfam:Sec16 270 371 1.7e-19 PFAM
Pfam:Sec16_C 436 681 1e-38 PFAM
low complexity region 795 810 N/A INTRINSIC
low complexity region 858 876 N/A INTRINSIC
low complexity region 900 909 N/A INTRINSIC
low complexity region 915 963 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000146873
SMART Domains Protein: ENSMUSP00000119359
Gene: ENSMUSG00000026589

DomainStartEndE-ValueType
low complexity region 23 43 N/A INTRINSIC
Pfam:Sec16 81 182 9.4e-20 PFAM
Pfam:Sec16_C 247 492 4.8e-39 PFAM
low complexity region 606 621 N/A INTRINSIC
Coding Region Coverage
  • 1x: 97.4%
  • 3x: 96.8%
  • 10x: 94.9%
  • 20x: 91.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] SEC16B is a mammalian homolog of S. cerevisiae Sec16 that is required for organization of transitional endoplasmic reticulum (ER) sites and protein export (Bhattacharyya and Glick, 2007 [PubMed 17192411]).[supplied by OMIM, Jun 2009]
Allele List at MGI
Other mutations in this stock
Total: 97 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610507B11Rik G T 11: 78,287,750 V1993F probably damaging Het
4933425L06Rik C A 13: 105,082,194 A12E unknown Het
Acss2 T A 2: 155,558,630 Y530N probably damaging Het
Adam4 T C 12: 81,419,559 I763V probably benign Het
Aipl1 T G 11: 72,030,499 K190T possibly damaging Het
Alms1 T A 6: 85,678,503 S3344T possibly damaging Het
Alpi A G 1: 87,099,414 V381A possibly damaging Het
Ankfn1 A T 11: 89,447,618 S365R probably benign Het
Aox2 G A 1: 58,308,991 A623T probably benign Het
Apc T A 18: 34,317,077 L2308Q probably damaging Het
Atp9b C T 18: 80,778,883 V501I probably benign Het
Baz2b T C 2: 59,901,819 E1994G probably benign Het
Cacna1a T C 8: 84,581,357 probably null Het
Cacna1h C A 17: 25,392,076 V583L probably benign Het
Cd55 T C 1: 130,447,609 probably benign Het
Cep192 T A 18: 67,804,424 S75T possibly damaging Het
Cfap54 T A 10: 92,962,375 D1674V probably benign Het
Churc1 T C 12: 76,773,297 F27L possibly damaging Het
Coro1c A G 5: 113,848,543 I280T probably benign Het
Creb1 C T 1: 64,550,950 Q32* probably null Het
Cyp2b9 A G 7: 26,200,783 T339A probably benign Het
Dctn3 T C 4: 41,720,813 R51G probably damaging Het
Ddb1 T C 19: 10,626,593 V888A probably damaging Het
Disp1 A G 1: 183,089,000 Y619H probably damaging Het
Dnajc9 T C 14: 20,388,334 D96G possibly damaging Het
Eepd1 A G 9: 25,482,868 T143A possibly damaging Het
Eps8 T A 6: 137,522,279 K204* probably null Het
Ercc5 T A 1: 44,180,875 S1102R probably benign Het
Ergic2 T A 6: 148,189,581 Y211F possibly damaging Het
Fam135b G T 15: 71,490,711 L274M probably damaging Het
Fat3 G A 9: 15,998,088 T2206I probably damaging Het
Fat4 A G 3: 38,983,571 I3791V probably benign Het
Gemin4 A G 11: 76,213,296 M213T possibly damaging Het
Gnai3 T C 3: 108,118,407 M119V probably benign Het
Heatr5b A T 17: 78,773,563 L1420Q probably damaging Het
Herc2 G T 7: 56,206,765 G3918* probably null Het
Ints9 A G 14: 65,032,256 Y465C probably damaging Het
Ist1 A G 8: 109,678,883 V175A probably damaging Het
Kcnj12 T C 11: 61,069,557 L227P possibly damaging Het
Kcnq5 T C 1: 21,466,387 S416G probably benign Het
Kdm3a T A 6: 71,613,956 T295S probably benign Het
Kif1c T A 11: 70,708,971 M479K probably damaging Het
Kif20b T C 19: 34,956,038 L83P probably damaging Het
Kndc1 A G 7: 139,927,711 E1194G probably damaging Het
Llgl1 A G 11: 60,704,730 M81V probably benign Het
Map4k5 C A 12: 69,824,662 M495I probably damaging Het
Mest C T 6: 30,742,791 R146C probably benign Het
Mettl24 T A 10: 40,737,816 probably null Het
Mical1 T C 10: 41,483,535 S586P probably benign Het
Mrgpra3 G T 7: 47,589,946 Y77* probably null Het
Mss51 A T 14: 20,483,178 C408* probably null Het
Myh6 T C 14: 54,957,401 T666A probably benign Het
Myo10 T C 15: 25,805,587 C1685R possibly damaging Het
Naip5 A T 13: 100,223,218 Y503* probably null Het
Neil1 A C 9: 57,146,604 F144C probably damaging Het
Nipbl T A 15: 8,343,517 I1082F possibly damaging Het
Nkiras1 T C 14: 18,276,732 V7A probably damaging Het
Ntng2 G A 2: 29,197,057 Q384* probably null Het
Ocrl T A X: 47,962,116 I74N probably damaging Het
Olfr137 A T 17: 38,305,312 S50T probably benign Het
Olfr1385 A T 11: 49,494,670 I46F probably damaging Het
Olfr1408 A G 1: 173,130,815 V134A probably benign Het
Olfr381 A C 11: 73,486,374 V150G probably benign Het
Olfr535 A G 7: 140,492,709 S24G probably benign Het
Olfr761 C T 17: 37,952,385 G213E possibly damaging Het
Patj A G 4: 98,491,590 D151G probably benign Het
Plpbp T C 8: 27,049,231 V126A probably damaging Het
Pold2 A G 11: 5,873,454 L325P possibly damaging Het
Ppp1r12c A C 7: 4,483,651 S480A probably damaging Het
Pum1 T C 4: 130,701,048 S124P possibly damaging Het
Pwp2 C G 10: 78,179,091 G353A probably damaging Het
Reln C A 5: 21,979,002 Q1666H probably damaging Het
Rnf19a T C 15: 36,265,925 I9V probably benign Het
Ryr2 T C 13: 11,769,878 H1063R probably benign Het
Samd14 C G 11: 95,023,600 D361E probably damaging Het
Samd15 A T 12: 87,201,843 N365I probably damaging Het
Sez6 T C 11: 77,953,503 S51P probably benign Het
Sh3bp1 T A 15: 78,905,150 L236Q probably damaging Het
Sspo C T 6: 48,457,340 T991I probably damaging Het
Suco A T 1: 161,859,500 L97* probably null Het
Tab1 C A 15: 80,148,296 R35S probably benign Het
Tet3 C A 6: 83,404,163 S341I possibly damaging Het
Tlr1 A T 5: 64,925,700 D511E probably benign Het
Tmem132b A C 5: 125,785,899 D656A probably damaging Het
Tmtc4 T A 14: 122,941,988 probably null Het
Trmo T C 4: 46,380,158 T404A probably damaging Het
Trpm1 A G 7: 64,230,268 K790E probably damaging Het
Ulk4 C A 9: 121,168,184 R774M probably null Het
Ush2a C T 1: 188,451,818 L1440F probably benign Het
Usp16 A G 16: 87,480,907 K682E probably damaging Het
Virma T C 4: 11,540,511 S1471P probably benign Het
Vmn1r177 A T 7: 23,865,686 I255N probably damaging Het
Vmn2r61 A T 7: 42,266,652 R230* probably null Het
Vps13c T A 9: 67,993,013 F3671L probably benign Het
Washc5 T C 15: 59,359,340 N358S possibly damaging Het
Wdr72 A G 9: 74,151,617 K331E probably damaging Het
Zfp986 A T 4: 145,899,235 K155I probably benign Het
Other mutations in Sec16b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00226:Sec16b APN 1 157538330 missense probably damaging 1.00
IGL00645:Sec16b APN 1 157566719 missense probably damaging 1.00
IGL00763:Sec16b APN 1 157529257 missense probably benign 0.00
IGL00822:Sec16b APN 1 157564555 missense probably benign 0.05
IGL02225:Sec16b APN 1 157532044 unclassified probably benign
IGL02746:Sec16b APN 1 157546289 splice site probably benign
IGL03031:Sec16b APN 1 157560799 missense probably benign
IGL03117:Sec16b APN 1 157535400 missense probably damaging 1.00
IGL03193:Sec16b APN 1 157535393 missense probably benign 0.01
R0206:Sec16b UTSW 1 157552935 nonsense probably null
R0208:Sec16b UTSW 1 157552935 nonsense probably null
R0349:Sec16b UTSW 1 157532176 splice site probably null
R0433:Sec16b UTSW 1 157534709 nonsense probably null
R0537:Sec16b UTSW 1 157537546 missense possibly damaging 0.91
R0593:Sec16b UTSW 1 157532148 missense probably benign 0.03
R0629:Sec16b UTSW 1 157564863 unclassified probably benign
R1028:Sec16b UTSW 1 157560917 missense probably benign 0.03
R1119:Sec16b UTSW 1 157564834 missense possibly damaging 0.93
R1894:Sec16b UTSW 1 157552975 missense possibly damaging 0.90
R2307:Sec16b UTSW 1 157535492 missense probably damaging 1.00
R3438:Sec16b UTSW 1 157556758 splice site probably benign
R4788:Sec16b UTSW 1 157561524 missense possibly damaging 0.77
R5109:Sec16b UTSW 1 157564791 nonsense probably null
R5235:Sec16b UTSW 1 157534764 missense probably benign 0.00
R5942:Sec16b UTSW 1 157531350 missense probably damaging 1.00
R6034:Sec16b UTSW 1 157552939 missense probably damaging 1.00
R6034:Sec16b UTSW 1 157552939 missense probably damaging 1.00
R6081:Sec16b UTSW 1 157560754 missense probably benign
R7026:Sec16b UTSW 1 157534711 missense possibly damaging 0.80
R7192:Sec16b UTSW 1 157529443 missense probably benign 0.00
R7270:Sec16b UTSW 1 157564462 missense probably damaging 1.00
R7270:Sec16b UTSW 1 157564463 missense probably damaging 1.00
R7404:Sec16b UTSW 1 157531357 missense probably damaging 1.00
R7494:Sec16b UTSW 1 157560799 missense probably benign
R7570:Sec16b UTSW 1 157531395 splice site probably null
R7747:Sec16b UTSW 1 157565472 missense possibly damaging 0.69
R7751:Sec16b UTSW 1 157558060 missense probably damaging 1.00
R7797:Sec16b UTSW 1 157561675 missense unknown
R7913:Sec16b UTSW 1 157529329 missense probably benign 0.00
R7943:Sec16b UTSW 1 157554757 missense probably benign
R8176:Sec16b UTSW 1 157535411 missense probably damaging 1.00
R8891:Sec16b UTSW 1 157554839 missense probably damaging 1.00
Z1088:Sec16b UTSW 1 157558024 splice site probably null
Z1176:Sec16b UTSW 1 157551069 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTGTAGAGCAAAGGGCCACC -3'
(R):5'- AAGCATCATAGGGGTAGTCTCAG -3'

Sequencing Primer
(F):5'- AGGGCCACCTCTGTTCTG -3'
(R):5'- TATTATCAAAGGGCAGGGTCTCC -3'
Posted On2014-06-23