Mutagenetix > Incidental Mutation

Incidental Mutation 'R1835:Virma'

205143

Institutional Source

Beutler Lab

Gene Symbol

Virma

Ensembl Gene

ENSMUSG00000040720

Gene Name

vir like m6A methyltransferase associated

Synonyms

1110037F02Rik

MMRRC Submission

039862-MU

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R1835 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

11485958-11550684 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 11540511 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Serine to Proline at position 1471 (S1471P)

Ref Sequence

ENSEMBL: ENSMUSP00000058078 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000059914] [ENSMUST00000108307]

AlphaFold

A2AIV2

Predicted Effect

probably benign
Transcript: ENSMUST00000059914
AA Change: S1471P

PolyPhen 2 Score 0.022 (Sensitivity: 0.95; Specificity: 0.81)

SMART Domains

Protein: ENSMUSP00000058078
Gene: ENSMUSG00000040720
AA Change: S1471P

Domain	Start	End	E-Value	Type
low complexity region	139	153	N/A	INTRINSIC
low complexity region	172	198	N/A	INTRINSIC
low complexity region	236	267	N/A	INTRINSIC
low complexity region	276	297	N/A	INTRINSIC
low complexity region	615	625	N/A	INTRINSIC
low complexity region	1008	1020	N/A	INTRINSIC
low complexity region	1112	1124	N/A	INTRINSIC
low complexity region	1224	1232	N/A	INTRINSIC
low complexity region	1443	1458	N/A	INTRINSIC
low complexity region	1460	1474	N/A	INTRINSIC
low complexity region	1618	1634	N/A	INTRINSIC
low complexity region	1684	1697	N/A	INTRINSIC
low complexity region	1750	1757	N/A	INTRINSIC
low complexity region	1796	1808	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000108307
AA Change: S1521P

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)

SMART Domains

Protein: ENSMUSP00000103943
Gene: ENSMUSG00000040720
AA Change: S1521P

Domain	Start	End	E-Value	Type
Pfam:VIR_N	5	266	2e-110	PFAM
low complexity region	276	297	N/A	INTRINSIC
low complexity region	615	625	N/A	INTRINSIC
low complexity region	1058	1070	N/A	INTRINSIC
low complexity region	1162	1174	N/A	INTRINSIC
low complexity region	1274	1282	N/A	INTRINSIC
low complexity region	1493	1508	N/A	INTRINSIC
low complexity region	1510	1524	N/A	INTRINSIC
low complexity region	1668	1684	N/A	INTRINSIC
low complexity region	1734	1747	N/A	INTRINSIC
low complexity region	1800	1807	N/A	INTRINSIC
low complexity region	1846	1858	N/A	INTRINSIC

Coding Region Coverage

1x: 97.4%
3x: 96.8%
10x: 94.9%
20x: 91.0%

Validation Efficiency

Allele List at MGI

Other mutations in this stock

Total: 97 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2610507B11Rik	G	T	11: 78,287,750	V1993F	probably damaging	Het
4933425L06Rik	C	A	13: 105,082,194	A12E	unknown	Het
Acss2	T	A	2: 155,558,630	Y530N	probably damaging	Het
Adam4	T	C	12: 81,419,559	I763V	probably benign	Het
Aipl1	T	G	11: 72,030,499	K190T	possibly damaging	Het
Alms1	T	A	6: 85,678,503	S3344T	possibly damaging	Het
Alpi	A	G	1: 87,099,414	V381A	possibly damaging	Het
Ankfn1	A	T	11: 89,447,618	S365R	probably benign	Het
Aox2	G	A	1: 58,308,991	A623T	probably benign	Het
Apc	T	A	18: 34,317,077	L2308Q	probably damaging	Het
Atp9b	C	T	18: 80,778,883	V501I	probably benign	Het
Baz2b	T	C	2: 59,901,819	E1994G	probably benign	Het
Cacna1a	T	C	8: 84,581,357		probably null	Het
Cacna1h	C	A	17: 25,392,076	V583L	probably benign	Het
Cd55	T	C	1: 130,447,609		probably benign	Het
Cep192	T	A	18: 67,804,424	S75T	possibly damaging	Het
Cfap54	T	A	10: 92,962,375	D1674V	probably benign	Het
Churc1	T	C	12: 76,773,297	F27L	possibly damaging	Het
Coro1c	A	G	5: 113,848,543	I280T	probably benign	Het
Creb1	C	T	1: 64,550,950	Q32*	probably null	Het
Cyp2b9	A	G	7: 26,200,783	T339A	probably benign	Het
Dctn3	T	C	4: 41,720,813	R51G	probably damaging	Het
Ddb1	T	C	19: 10,626,593	V888A	probably damaging	Het
Disp1	A	G	1: 183,089,000	Y619H	probably damaging	Het
Dnajc9	T	C	14: 20,388,334	D96G	possibly damaging	Het
Eepd1	A	G	9: 25,482,868	T143A	possibly damaging	Het
Eps8	T	A	6: 137,522,279	K204*	probably null	Het
Ercc5	T	A	1: 44,180,875	S1102R	probably benign	Het
Ergic2	T	A	6: 148,189,581	Y211F	possibly damaging	Het
Fam135b	G	T	15: 71,490,711	L274M	probably damaging	Het
Fat3	G	A	9: 15,998,088	T2206I	probably damaging	Het
Fat4	A	G	3: 38,983,571	I3791V	probably benign	Het
Gemin4	A	G	11: 76,213,296	M213T	possibly damaging	Het
Gnai3	T	C	3: 108,118,407	M119V	probably benign	Het
Heatr5b	A	T	17: 78,773,563	L1420Q	probably damaging	Het
Herc2	G	T	7: 56,206,765	G3918*	probably null	Het
Ints9	A	G	14: 65,032,256	Y465C	probably damaging	Het
Ist1	A	G	8: 109,678,883	V175A	probably damaging	Het
Kcnj12	T	C	11: 61,069,557	L227P	possibly damaging	Het
Kcnq5	T	C	1: 21,466,387	S416G	probably benign	Het
Kdm3a	T	A	6: 71,613,956	T295S	probably benign	Het
Kif1c	T	A	11: 70,708,971	M479K	probably damaging	Het
Kif20b	T	C	19: 34,956,038	L83P	probably damaging	Het
Kndc1	A	G	7: 139,927,711	E1194G	probably damaging	Het
Llgl1	A	G	11: 60,704,730	M81V	probably benign	Het
Map4k5	C	A	12: 69,824,662	M495I	probably damaging	Het
Mest	C	T	6: 30,742,791	R146C	probably benign	Het
Mettl24	T	A	10: 40,737,816		probably null	Het
Mical1	T	C	10: 41,483,535	S586P	probably benign	Het
Mrgpra3	G	T	7: 47,589,946	Y77*	probably null	Het
Mss51	A	T	14: 20,483,178	C408*	probably null	Het
Myh6	T	C	14: 54,957,401	T666A	probably benign	Het
Myo10	T	C	15: 25,805,587	C1685R	possibly damaging	Het
Naip5	A	T	13: 100,223,218	Y503*	probably null	Het
Neil1	A	C	9: 57,146,604	F144C	probably damaging	Het
Nipbl	T	A	15: 8,343,517	I1082F	possibly damaging	Het
Nkiras1	T	C	14: 18,276,732	V7A	probably damaging	Het
Ntng2	G	A	2: 29,197,057	Q384*	probably null	Het
Ocrl	T	A	X: 47,962,116	I74N	probably damaging	Het
Olfr137	A	T	17: 38,305,312	S50T	probably benign	Het
Olfr1385	A	T	11: 49,494,670	I46F	probably damaging	Het
Olfr1408	A	G	1: 173,130,815	V134A	probably benign	Het
Olfr381	A	C	11: 73,486,374	V150G	probably benign	Het
Olfr535	A	G	7: 140,492,709	S24G	probably benign	Het
Olfr761	C	T	17: 37,952,385	G213E	possibly damaging	Het
Patj	A	G	4: 98,491,590	D151G	probably benign	Het
Plpbp	T	C	8: 27,049,231	V126A	probably damaging	Het
Pold2	A	G	11: 5,873,454	L325P	possibly damaging	Het
Ppp1r12c	A	C	7: 4,483,651	S480A	probably damaging	Het
Pum1	T	C	4: 130,701,048	S124P	possibly damaging	Het
Pwp2	C	G	10: 78,179,091	G353A	probably damaging	Het
Reln	C	A	5: 21,979,002	Q1666H	probably damaging	Het
Rnf19a	T	C	15: 36,265,925	I9V	probably benign	Het
Ryr2	T	C	13: 11,769,878	H1063R	probably benign	Het
Samd14	C	G	11: 95,023,600	D361E	probably damaging	Het
Samd15	A	T	12: 87,201,843	N365I	probably damaging	Het
Sec16b	A	G	1: 157,531,312	H105R	probably benign	Het
Sez6	T	C	11: 77,953,503	S51P	probably benign	Het
Sh3bp1	T	A	15: 78,905,150	L236Q	probably damaging	Het
Sspo	C	T	6: 48,457,340	T991I	probably damaging	Het
Suco	A	T	1: 161,859,500	L97*	probably null	Het
Tab1	C	A	15: 80,148,296	R35S	probably benign	Het
Tet3	C	A	6: 83,404,163	S341I	possibly damaging	Het
Tlr1	A	T	5: 64,925,700	D511E	probably benign	Het
Tmem132b	A	C	5: 125,785,899	D656A	probably damaging	Het
Tmtc4	T	A	14: 122,941,988		probably null	Het
Trmo	T	C	4: 46,380,158	T404A	probably damaging	Het
Trpm1	A	G	7: 64,230,268	K790E	probably damaging	Het
Ulk4	C	A	9: 121,168,184	R774M	probably null	Het
Ush2a	C	T	1: 188,451,818	L1440F	probably benign	Het
Usp16	A	G	16: 87,480,907	K682E	probably damaging	Het
Vmn1r177	A	T	7: 23,865,686	I255N	probably damaging	Het
Vmn2r61	A	T	7: 42,266,652	R230*	probably null	Het
Vps13c	T	A	9: 67,993,013	F3671L	probably benign	Het
Washc5	T	C	15: 59,359,340	N358S	possibly damaging	Het
Wdr72	A	G	9: 74,151,617	K331E	probably damaging	Het
Zfp986	A	T	4: 145,899,235	K155I	probably benign	Het

Other mutations in Virma

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00428:Virma	APN	4	11519424	splice site	probably benign
IGL00477:Virma	APN	4	11519006	missense	probably damaging	0.99
IGL01293:Virma	APN	4	11521114	missense	probably damaging	1.00
IGL01410:Virma	APN	4	11518929	nonsense	probably null
IGL01531:Virma	APN	4	11528753	missense	probably damaging	1.00
IGL01672:Virma	APN	4	11527792	missense	probably damaging	1.00
IGL01724:Virma	APN	4	11528672	missense	probably damaging	1.00
IGL01747:Virma	APN	4	11526877	missense	probably damaging	1.00
IGL01776:Virma	APN	4	11527792	missense	probably damaging	1.00
IGL02064:Virma	APN	4	11513163	missense	possibly damaging	0.87
IGL02243:Virma	APN	4	11546031	missense	probably damaging	1.00
IGL02244:Virma	APN	4	11546031	missense	probably damaging	1.00
IGL02445:Virma	APN	4	11527029	missense	probably damaging	0.97
IGL02546:Virma	APN	4	11494804	missense	probably damaging	0.99
IGL02807:Virma	APN	4	11507079	splice site	probably benign
IGL02967:Virma	APN	4	11514096	missense	probably benign	0.01
IGL03211:Virma	APN	4	11548770	nonsense	probably null
IGL03242:Virma	APN	4	11527669	missense	possibly damaging	0.70
IGL03256:Virma	APN	4	11542207	splice site	probably benign
IGL03327:Virma	APN	4	11518984	missense	probably benign	0.00
IGL03346:Virma	APN	4	11518984	missense	probably benign	0.00
PIT4802001:Virma	UTSW	4	11546008	missense	probably damaging	0.99
R0142:Virma	UTSW	4	11548783	missense	probably benign	0.04
R0355:Virma	UTSW	4	11528626	nonsense	probably null
R0522:Virma	UTSW	4	11519416	critical splice donor site	probably null
R0600:Virma	UTSW	4	11498769	missense	probably damaging	0.99
R1435:Virma	UTSW	4	11528621	missense	probably damaging	1.00
R1489:Virma	UTSW	4	11521164	missense	probably damaging	1.00
R1568:Virma	UTSW	4	11528776	missense	probably damaging	0.99
R1616:Virma	UTSW	4	11544954	missense	probably damaging	1.00
R1655:Virma	UTSW	4	11494786	missense	probably damaging	1.00
R1695:Virma	UTSW	4	11494814	missense	probably damaging	0.98
R1951:Virma	UTSW	4	11513907	missense	probably benign	0.00
R1991:Virma	UTSW	4	11519242	missense	probably benign	0.06
R2145:Virma	UTSW	4	11548726	splice site	probably benign
R2172:Virma	UTSW	4	11527843	missense	possibly damaging	0.82
R2217:Virma	UTSW	4	11544924	missense	probably damaging	1.00
R2218:Virma	UTSW	4	11544924	missense	probably damaging	1.00
R2248:Virma	UTSW	4	11518927	missense	probably damaging	1.00
R2342:Virma	UTSW	4	11501316	missense	probably damaging	1.00
R3424:Virma	UTSW	4	11513177	nonsense	probably null
R4397:Virma	UTSW	4	11513901	missense	possibly damaging	0.81
R4449:Virma	UTSW	4	11498828	critical splice donor site	probably null
R4660:Virma	UTSW	4	11513505	missense	probably damaging	1.00
R4698:Virma	UTSW	4	11528636	missense	probably damaging	0.99
R4878:Virma	UTSW	4	11544971	missense	probably damaging	1.00
R4937:Virma	UTSW	4	11521147	nonsense	probably null
R5031:Virma	UTSW	4	11542116	nonsense	probably null
R5040:Virma	UTSW	4	11528746	missense	probably benign	0.01
R5061:Virma	UTSW	4	11494840	missense	possibly damaging	0.95
R5091:Virma	UTSW	4	11519392	missense	probably benign	0.00
R5137:Virma	UTSW	4	11546297	missense	probably damaging	1.00
R5262:Virma	UTSW	4	11539926	missense	probably benign	0.01
R5297:Virma	UTSW	4	11494819	missense	probably damaging	1.00
R5730:Virma	UTSW	4	11542154	missense	probably benign	0.44
R5818:Virma	UTSW	4	11513319	missense	possibly damaging	0.92
R5835:Virma	UTSW	4	11514036	missense	probably damaging	1.00
R6125:Virma	UTSW	4	11521172	missense	probably damaging	0.98
R6197:Virma	UTSW	4	11505498	missense	probably damaging	0.96
R6222:Virma	UTSW	4	11527820	missense	probably damaging	1.00
R6793:Virma	UTSW	4	11539968	missense	probably damaging	1.00
R7028:Virma	UTSW	4	11519249	missense	possibly damaging	0.50
R7356:Virma	UTSW	4	11513595	missense	probably damaging	0.99
R7383:Virma	UTSW	4	11514026	missense	probably damaging	0.98
R7391:Virma	UTSW	4	11508099	missense	probably damaging	0.99
R7425:Virma	UTSW	4	11546211	missense	possibly damaging	0.95
R7556:Virma	UTSW	4	11518927	missense	probably damaging	1.00
R7715:Virma	UTSW	4	11549682	missense	probably damaging	1.00
R7715:Virma	UTSW	4	11513016	splice site	probably null
R7986:Virma	UTSW	4	11540023	missense	probably benign	0.01
R7990:Virma	UTSW	4	11513983	missense	probably benign	0.00
R8048:Virma	UTSW	4	11539918	nonsense	probably null
R8050:Virma	UTSW	4	11528643	missense	probably benign	0.22
R8165:Virma	UTSW	4	11542128	missense	probably benign	0.00
R8412:Virma	UTSW	4	11521261	critical splice donor site	probably null
R8544:Virma	UTSW	4	11516949	missense	probably benign
R8551:Virma	UTSW	4	11513397	missense	probably damaging	1.00
R8699:Virma	UTSW	4	11528678	missense	probably benign	0.04
R8739:Virma	UTSW	4	11540643	critical splice donor site	probably null
R8950:Virma	UTSW	4	11519047	nonsense	probably null
R9015:Virma	UTSW	4	11540494	missense	probably benign	0.27
R9038:Virma	UTSW	4	11526922	missense	possibly damaging	0.93
R9115:Virma	UTSW	4	11498744	missense	probably benign	0.15
R9294:Virma	UTSW	4	11513507	nonsense	probably null
R9404:Virma	UTSW	4	11513626	missense	probably benign	0.17
R9477:Virma	UTSW	4	11528753	missense	probably damaging	1.00
R9532:Virma	UTSW	4	11507078	critical splice donor site	probably null
R9649:Virma	UTSW	4	11486045	start codon destroyed	probably null	0.08
R9657:Virma	UTSW	4	11544898	missense	probably damaging	0.99
R9780:Virma	UTSW	4	11513442	missense	possibly damaging	0.75
R9800:Virma	UTSW	4	11546007	missense	probably damaging	0.99
X0020:Virma	UTSW	4	11486055	missense	probably benign	0.00

Predicted Primers

PCR Primer
(F):5'- AACTTGGTGACTGGATGCTG -3'
(R):5'- GGAGAATCACAAGTTCTAAACCAGC -3'

Sequencing Primer
(F):5'- GGATGCTGTTCCAGAGTTGTAG -3'
(R):5'- CAAAGCTTGGGTCAGTCAACCTTG -3'

Posted On

2014-06-23