Incidental Mutation 'R1835:Pum1'
ID205149
Institutional Source Beutler Lab
Gene Symbol Pum1
Ensembl Gene ENSMUSG00000028580
Gene Namepumilio RNA-binding family member 1
SynonymsPumm
MMRRC Submission 039862-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.875) question?
Stock #R1835 (G1)
Quality Score225
Status Not validated
Chromosome4
Chromosomal Location130663321-130781564 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 130701048 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 124 (S124P)
Ref Sequence ENSEMBL: ENSMUSP00000095476 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030315] [ENSMUST00000097862] [ENSMUST00000097864] [ENSMUST00000105991] [ENSMUST00000105992] [ENSMUST00000143277]
Predicted Effect possibly damaging
Transcript: ENSMUST00000030315
AA Change: S124P

PolyPhen 2 Score 0.930 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000030315
Gene: ENSMUSG00000028580
AA Change: S124P

DomainStartEndE-ValueType
low complexity region 45 58 N/A INTRINSIC
low complexity region 94 102 N/A INTRINSIC
low complexity region 393 414 N/A INTRINSIC
low complexity region 443 458 N/A INTRINSIC
low complexity region 476 503 N/A INTRINSIC
low complexity region 528 539 N/A INTRINSIC
low complexity region 584 615 N/A INTRINSIC
low complexity region 627 637 N/A INTRINSIC
low complexity region 643 666 N/A INTRINSIC
low complexity region 672 696 N/A INTRINSIC
low complexity region 731 741 N/A INTRINSIC
low complexity region 763 783 N/A INTRINSIC
low complexity region 798 816 N/A INTRINSIC
Pumilio 849 884 1.75e-6 SMART
Pumilio 885 920 4.03e-6 SMART
Pumilio 921 955 5.24e-5 SMART
Pumilio 959 994 3.37e-8 SMART
Pumilio 995 1030 6.29e-8 SMART
Pumilio 1031 1066 1.04e-8 SMART
Pumilio 1067 1102 6.2e-7 SMART
Pumilio 1110 1145 8.77e-7 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000097862
AA Change: S124P

PolyPhen 2 Score 0.930 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000095474
Gene: ENSMUSG00000028580
AA Change: S124P

DomainStartEndE-ValueType
low complexity region 45 58 N/A INTRINSIC
low complexity region 94 102 N/A INTRINSIC
low complexity region 393 414 N/A INTRINSIC
low complexity region 442 457 N/A INTRINSIC
low complexity region 475 502 N/A INTRINSIC
low complexity region 527 538 N/A INTRINSIC
low complexity region 583 614 N/A INTRINSIC
low complexity region 626 636 N/A INTRINSIC
low complexity region 642 665 N/A INTRINSIC
low complexity region 671 695 N/A INTRINSIC
low complexity region 730 740 N/A INTRINSIC
low complexity region 762 782 N/A INTRINSIC
low complexity region 797 815 N/A INTRINSIC
Pumilio 848 883 1.75e-6 SMART
Pumilio 884 919 4.03e-6 SMART
Pumilio 920 954 5.24e-5 SMART
Pumilio 958 993 3.37e-8 SMART
Pumilio 994 1029 6.29e-8 SMART
Pumilio 1030 1065 1.04e-8 SMART
Pumilio 1066 1101 6.2e-7 SMART
Pumilio 1109 1144 8.77e-7 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000097864
AA Change: S124P

PolyPhen 2 Score 0.930 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000095476
Gene: ENSMUSG00000028580
AA Change: S124P

DomainStartEndE-ValueType
low complexity region 45 58 N/A INTRINSIC
low complexity region 94 102 N/A INTRINSIC
low complexity region 393 414 N/A INTRINSIC
low complexity region 442 457 N/A INTRINSIC
low complexity region 475 502 N/A INTRINSIC
low complexity region 527 538 N/A INTRINSIC
low complexity region 583 614 N/A INTRINSIC
low complexity region 626 636 N/A INTRINSIC
low complexity region 642 665 N/A INTRINSIC
low complexity region 671 695 N/A INTRINSIC
low complexity region 730 740 N/A INTRINSIC
low complexity region 762 782 N/A INTRINSIC
low complexity region 797 815 N/A INTRINSIC
Pumilio 848 883 1.75e-6 SMART
Pumilio 884 919 4.03e-6 SMART
Pumilio 920 955 5.48e-8 SMART
Pumilio 956 991 3.37e-8 SMART
Pumilio 992 1027 6.29e-8 SMART
Pumilio 1028 1063 1.04e-8 SMART
Pumilio 1064 1099 6.2e-7 SMART
Pumilio 1107 1142 8.77e-7 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000105991
AA Change: S124P

PolyPhen 2 Score 0.117 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000101612
Gene: ENSMUSG00000028580
AA Change: S124P

DomainStartEndE-ValueType
low complexity region 45 58 N/A INTRINSIC
low complexity region 94 102 N/A INTRINSIC
low complexity region 151 172 N/A INTRINSIC
low complexity region 200 215 N/A INTRINSIC
low complexity region 233 260 N/A INTRINSIC
low complexity region 285 296 N/A INTRINSIC
low complexity region 341 372 N/A INTRINSIC
low complexity region 384 394 N/A INTRINSIC
low complexity region 400 423 N/A INTRINSIC
low complexity region 429 453 N/A INTRINSIC
low complexity region 488 498 N/A INTRINSIC
low complexity region 520 540 N/A INTRINSIC
low complexity region 555 573 N/A INTRINSIC
Pumilio 606 641 1.75e-6 SMART
Pumilio 642 677 4.03e-6 SMART
Pumilio 678 713 5.48e-8 SMART
Pumilio 714 749 3.37e-8 SMART
Pumilio 750 785 6.29e-8 SMART
Pumilio 786 821 1.04e-8 SMART
Pumilio 822 857 6.2e-7 SMART
Pumilio 865 900 8.77e-7 SMART
Predicted Effect unknown
Transcript: ENSMUST00000105992
AA Change: S124P
SMART Domains Protein: ENSMUSP00000101613
Gene: ENSMUSG00000028580
AA Change: S124P

DomainStartEndE-ValueType
low complexity region 45 58 N/A INTRINSIC
low complexity region 94 102 N/A INTRINSIC
low complexity region 297 318 N/A INTRINSIC
low complexity region 346 361 N/A INTRINSIC
low complexity region 379 406 N/A INTRINSIC
low complexity region 431 442 N/A INTRINSIC
low complexity region 487 518 N/A INTRINSIC
low complexity region 530 540 N/A INTRINSIC
low complexity region 546 569 N/A INTRINSIC
low complexity region 575 599 N/A INTRINSIC
low complexity region 634 644 N/A INTRINSIC
low complexity region 666 686 N/A INTRINSIC
low complexity region 701 719 N/A INTRINSIC
Pumilio 752 787 1.75e-6 SMART
Pumilio 788 823 4.03e-6 SMART
Pumilio 824 858 5.24e-5 SMART
Pumilio 862 897 3.37e-8 SMART
Pumilio 898 933 6.29e-8 SMART
Pumilio 934 969 1.04e-8 SMART
Pumilio 970 1005 6.2e-7 SMART
Pumilio 1013 1048 8.77e-7 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000122847
Predicted Effect unknown
Transcript: ENSMUST00000143277
AA Change: S124P
SMART Domains Protein: ENSMUSP00000114629
Gene: ENSMUSG00000028580
AA Change: S124P

DomainStartEndE-ValueType
low complexity region 45 58 N/A INTRINSIC
low complexity region 94 102 N/A INTRINSIC
low complexity region 151 172 N/A INTRINSIC
low complexity region 200 215 N/A INTRINSIC
Coding Region Coverage
  • 1x: 97.4%
  • 3x: 96.8%
  • 10x: 94.9%
  • 20x: 91.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the PUF family, evolutionarily conserved RNA-binding proteins related to the Pumilio proteins of Drosophila and the fem-3 mRNA binding factor proteins of C. elegans. The encoded protein contains a sequence-specific RNA binding domain comprised of eight repeats and N- and C-terminal flanking regions, and serves as a translational regulator of specific mRNAs by binding to their 3' untranslated regions. The evolutionarily conserved function of the encoded protein in invertebrates and lower vertebrates suggests that the human protein may be involved in translational regulation of embryogenesis, and cell development and differentiation. Alternatively spliced transcript variants encoding different isoforms have been described. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit decreased testes weight and size, decreased body weight, oligozoospermia, reduced male fertility, increased male germ cell apoptosis and small seminiferous tubules. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 97 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610507B11Rik G T 11: 78,287,750 V1993F probably damaging Het
4933425L06Rik C A 13: 105,082,194 A12E unknown Het
Acss2 T A 2: 155,558,630 Y530N probably damaging Het
Adam4 T C 12: 81,419,559 I763V probably benign Het
Aipl1 T G 11: 72,030,499 K190T possibly damaging Het
Alms1 T A 6: 85,678,503 S3344T possibly damaging Het
Alpi A G 1: 87,099,414 V381A possibly damaging Het
Ankfn1 A T 11: 89,447,618 S365R probably benign Het
Aox2 G A 1: 58,308,991 A623T probably benign Het
Apc T A 18: 34,317,077 L2308Q probably damaging Het
Atp9b C T 18: 80,778,883 V501I probably benign Het
Baz2b T C 2: 59,901,819 E1994G probably benign Het
Cacna1a T C 8: 84,581,357 probably null Het
Cacna1h C A 17: 25,392,076 V583L probably benign Het
Cd55 T C 1: 130,447,609 probably benign Het
Cep192 T A 18: 67,804,424 S75T possibly damaging Het
Cfap54 T A 10: 92,962,375 D1674V probably benign Het
Churc1 T C 12: 76,773,297 F27L possibly damaging Het
Coro1c A G 5: 113,848,543 I280T probably benign Het
Creb1 C T 1: 64,550,950 Q32* probably null Het
Cyp2b9 A G 7: 26,200,783 T339A probably benign Het
Dctn3 T C 4: 41,720,813 R51G probably damaging Het
Ddb1 T C 19: 10,626,593 V888A probably damaging Het
Disp1 A G 1: 183,089,000 Y619H probably damaging Het
Dnajc9 T C 14: 20,388,334 D96G possibly damaging Het
Eepd1 A G 9: 25,482,868 T143A possibly damaging Het
Eps8 T A 6: 137,522,279 K204* probably null Het
Ercc5 T A 1: 44,180,875 S1102R probably benign Het
Ergic2 T A 6: 148,189,581 Y211F possibly damaging Het
Fam135b G T 15: 71,490,711 L274M probably damaging Het
Fat3 G A 9: 15,998,088 T2206I probably damaging Het
Fat4 A G 3: 38,983,571 I3791V probably benign Het
Gemin4 A G 11: 76,213,296 M213T possibly damaging Het
Gnai3 T C 3: 108,118,407 M119V probably benign Het
Heatr5b A T 17: 78,773,563 L1420Q probably damaging Het
Herc2 G T 7: 56,206,765 G3918* probably null Het
Ints9 A G 14: 65,032,256 Y465C probably damaging Het
Ist1 A G 8: 109,678,883 V175A probably damaging Het
Kcnj12 T C 11: 61,069,557 L227P possibly damaging Het
Kcnq5 T C 1: 21,466,387 S416G probably benign Het
Kdm3a T A 6: 71,613,956 T295S probably benign Het
Kif1c T A 11: 70,708,971 M479K probably damaging Het
Kif20b T C 19: 34,956,038 L83P probably damaging Het
Kndc1 A G 7: 139,927,711 E1194G probably damaging Het
Llgl1 A G 11: 60,704,730 M81V probably benign Het
Map4k5 C A 12: 69,824,662 M495I probably damaging Het
Mest C T 6: 30,742,791 R146C probably benign Het
Mettl24 T A 10: 40,737,816 probably null Het
Mical1 T C 10: 41,483,535 S586P probably benign Het
Mrgpra3 G T 7: 47,589,946 Y77* probably null Het
Mss51 A T 14: 20,483,178 C408* probably null Het
Myh6 T C 14: 54,957,401 T666A probably benign Het
Myo10 T C 15: 25,805,587 C1685R possibly damaging Het
Naip5 A T 13: 100,223,218 Y503* probably null Het
Neil1 A C 9: 57,146,604 F144C probably damaging Het
Nipbl T A 15: 8,343,517 I1082F possibly damaging Het
Nkiras1 T C 14: 18,276,732 V7A probably damaging Het
Ntng2 G A 2: 29,197,057 Q384* probably null Het
Ocrl T A X: 47,962,116 I74N probably damaging Het
Olfr137 A T 17: 38,305,312 S50T probably benign Het
Olfr1385 A T 11: 49,494,670 I46F probably damaging Het
Olfr1408 A G 1: 173,130,815 V134A probably benign Het
Olfr381 A C 11: 73,486,374 V150G probably benign Het
Olfr535 A G 7: 140,492,709 S24G probably benign Het
Olfr761 C T 17: 37,952,385 G213E possibly damaging Het
Patj A G 4: 98,491,590 D151G probably benign Het
Plpbp T C 8: 27,049,231 V126A probably damaging Het
Pold2 A G 11: 5,873,454 L325P possibly damaging Het
Ppp1r12c A C 7: 4,483,651 S480A probably damaging Het
Pwp2 C G 10: 78,179,091 G353A probably damaging Het
Reln C A 5: 21,979,002 Q1666H probably damaging Het
Rnf19a T C 15: 36,265,925 I9V probably benign Het
Ryr2 T C 13: 11,769,878 H1063R probably benign Het
Samd14 C G 11: 95,023,600 D361E probably damaging Het
Samd15 A T 12: 87,201,843 N365I probably damaging Het
Sec16b A G 1: 157,531,312 H105R probably benign Het
Sez6 T C 11: 77,953,503 S51P probably benign Het
Sh3bp1 T A 15: 78,905,150 L236Q probably damaging Het
Sspo C T 6: 48,457,340 T991I probably damaging Het
Suco A T 1: 161,859,500 L97* probably null Het
Tab1 C A 15: 80,148,296 R35S probably benign Het
Tet3 C A 6: 83,404,163 S341I possibly damaging Het
Tlr1 A T 5: 64,925,700 D511E probably benign Het
Tmem132b A C 5: 125,785,899 D656A probably damaging Het
Tmtc4 T A 14: 122,941,988 probably null Het
Trmo T C 4: 46,380,158 T404A probably damaging Het
Trpm1 A G 7: 64,230,268 K790E probably damaging Het
Ulk4 C A 9: 121,168,184 R774M probably null Het
Ush2a C T 1: 188,451,818 L1440F probably benign Het
Usp16 A G 16: 87,480,907 K682E probably damaging Het
Virma T C 4: 11,540,511 S1471P probably benign Het
Vmn1r177 A T 7: 23,865,686 I255N probably damaging Het
Vmn2r61 A T 7: 42,266,652 R230* probably null Het
Vps13c T A 9: 67,993,013 F3671L probably benign Het
Washc5 T C 15: 59,359,340 N358S possibly damaging Het
Wdr72 A G 9: 74,151,617 K331E probably damaging Het
Zfp986 A T 4: 145,899,235 K155I probably benign Het
Other mutations in Pum1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00985:Pum1 APN 4 130743789 missense probably damaging 1.00
IGL01327:Pum1 APN 4 130730543 missense probably damaging 0.97
IGL01360:Pum1 APN 4 130728170 intron probably benign
IGL02055:Pum1 APN 4 130754054 missense probably benign 0.19
IGL02713:Pum1 APN 4 130766012 missense probably damaging 1.00
IGL03401:Pum1 APN 4 130743681 splice site probably benign
LCD18:Pum1 UTSW 4 130730549 intron probably benign
R0077:Pum1 UTSW 4 130772674 missense probably benign 0.06
R0346:Pum1 UTSW 4 130779805 missense possibly damaging 0.74
R0632:Pum1 UTSW 4 130728104 missense probably benign 0.34
R0870:Pum1 UTSW 4 130768844 missense probably damaging 0.99
R1006:Pum1 UTSW 4 130771888 missense probably damaging 0.98
R1300:Pum1 UTSW 4 130765961 missense probably damaging 1.00
R1499:Pum1 UTSW 4 130719256 missense probably damaging 1.00
R1572:Pum1 UTSW 4 130718204 missense probably damaging 0.99
R1864:Pum1 UTSW 4 130751525 missense possibly damaging 0.90
R1991:Pum1 UTSW 4 130718218 missense possibly damaging 0.93
R2068:Pum1 UTSW 4 130774434 missense probably benign 0.02
R2119:Pum1 UTSW 4 130669270 missense possibly damaging 0.92
R2120:Pum1 UTSW 4 130669270 missense possibly damaging 0.92
R2122:Pum1 UTSW 4 130669270 missense possibly damaging 0.92
R2153:Pum1 UTSW 4 130751491 missense probably damaging 1.00
R2164:Pum1 UTSW 4 130728083 nonsense probably null
R2164:Pum1 UTSW 4 130728084 missense probably damaging 0.99
R2280:Pum1 UTSW 4 130766011 missense probably damaging 1.00
R3116:Pum1 UTSW 4 130772660 missense probably damaging 1.00
R3890:Pum1 UTSW 4 130764082 missense probably damaging 1.00
R3891:Pum1 UTSW 4 130764082 missense probably damaging 1.00
R3892:Pum1 UTSW 4 130764082 missense probably damaging 1.00
R4134:Pum1 UTSW 4 130764069 missense probably damaging 1.00
R4258:Pum1 UTSW 4 130730280 missense probably damaging 1.00
R4731:Pum1 UTSW 4 130718193 missense probably benign 0.00
R4732:Pum1 UTSW 4 130718193 missense probably benign 0.00
R4733:Pum1 UTSW 4 130718193 missense probably benign 0.00
R4973:Pum1 UTSW 4 130669137 missense probably benign 0.27
R5198:Pum1 UTSW 4 130779879 nonsense probably null
R5249:Pum1 UTSW 4 130762814 missense probably benign 0.07
R5478:Pum1 UTSW 4 130751484 missense possibly damaging 0.93
R5652:Pum1 UTSW 4 130764127 missense possibly damaging 0.95
R5932:Pum1 UTSW 4 130730366 missense probably benign 0.04
R6008:Pum1 UTSW 4 130768847 missense probably damaging 1.00
R6112:Pum1 UTSW 4 130730280 missense probably damaging 1.00
R6416:Pum1 UTSW 4 130728287 splice site probably null
R6426:Pum1 UTSW 4 130753972 missense probably damaging 1.00
R6431:Pum1 UTSW 4 130774505 missense probably damaging 1.00
R7226:Pum1 UTSW 4 130771981 missense probably damaging 1.00
R7273:Pum1 UTSW 4 130751480 missense probably damaging 0.99
R7423:Pum1 UTSW 4 130774545 missense probably damaging 1.00
R7491:Pum1 UTSW 4 130719174 missense probably benign 0.08
R7526:Pum1 UTSW 4 130747026 missense probably damaging 0.99
R7731:Pum1 UTSW 4 130762963 missense probably benign 0.29
R7911:Pum1 UTSW 4 130774477 missense probably benign 0.40
R8065:Pum1 UTSW 4 130751525 missense possibly damaging 0.90
R8067:Pum1 UTSW 4 130751525 missense possibly damaging 0.90
R8305:Pum1 UTSW 4 130771920 missense probably benign 0.02
R8476:Pum1 UTSW 4 130752713 missense possibly damaging 0.91
X0024:Pum1 UTSW 4 130779790 missense probably benign 0.00
Z1177:Pum1 UTSW 4 130751479 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- GGGTAACACAGGGATCATTTCTG -3'
(R):5'- CACCAGTAGAGTTTTGGCACAG -3'

Sequencing Primer
(F):5'- CACAGGGATCATTTCTGAATCTTG -3'
(R):5'- CTATTCCTACTGTGAGGATGGCAAC -3'
Posted On2014-06-23