Incidental Mutation 'R1835:Pum1'
ID 205149
Institutional Source Beutler Lab
Gene Symbol Pum1
Ensembl Gene ENSMUSG00000028580
Gene Name pumilio RNA-binding family member 1
Synonyms Pumm
MMRRC Submission 039862-MU
Accession Numbers
Essential gene? Probably essential (E-score: 0.890) question?
Stock # R1835 (G1)
Quality Score 225
Status Not validated
Chromosome 4
Chromosomal Location 130390632-130508875 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 130428359 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Serine to Proline at position 124 (S124P)
Ref Sequence ENSEMBL: ENSMUSP00000095476 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030315] [ENSMUST00000097862] [ENSMUST00000097864] [ENSMUST00000105991] [ENSMUST00000105992] [ENSMUST00000143277]
AlphaFold Q80U78
Predicted Effect possibly damaging
Transcript: ENSMUST00000030315
AA Change: S124P

PolyPhen 2 Score 0.930 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000030315
Gene: ENSMUSG00000028580
AA Change: S124P

DomainStartEndE-ValueType
low complexity region 45 58 N/A INTRINSIC
low complexity region 94 102 N/A INTRINSIC
low complexity region 393 414 N/A INTRINSIC
low complexity region 443 458 N/A INTRINSIC
low complexity region 476 503 N/A INTRINSIC
low complexity region 528 539 N/A INTRINSIC
low complexity region 584 615 N/A INTRINSIC
low complexity region 627 637 N/A INTRINSIC
low complexity region 643 666 N/A INTRINSIC
low complexity region 672 696 N/A INTRINSIC
low complexity region 731 741 N/A INTRINSIC
low complexity region 763 783 N/A INTRINSIC
low complexity region 798 816 N/A INTRINSIC
Pumilio 849 884 1.75e-6 SMART
Pumilio 885 920 4.03e-6 SMART
Pumilio 921 955 5.24e-5 SMART
Pumilio 959 994 3.37e-8 SMART
Pumilio 995 1030 6.29e-8 SMART
Pumilio 1031 1066 1.04e-8 SMART
Pumilio 1067 1102 6.2e-7 SMART
Pumilio 1110 1145 8.77e-7 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000097862
AA Change: S124P

PolyPhen 2 Score 0.930 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000095474
Gene: ENSMUSG00000028580
AA Change: S124P

DomainStartEndE-ValueType
low complexity region 45 58 N/A INTRINSIC
low complexity region 94 102 N/A INTRINSIC
low complexity region 393 414 N/A INTRINSIC
low complexity region 442 457 N/A INTRINSIC
low complexity region 475 502 N/A INTRINSIC
low complexity region 527 538 N/A INTRINSIC
low complexity region 583 614 N/A INTRINSIC
low complexity region 626 636 N/A INTRINSIC
low complexity region 642 665 N/A INTRINSIC
low complexity region 671 695 N/A INTRINSIC
low complexity region 730 740 N/A INTRINSIC
low complexity region 762 782 N/A INTRINSIC
low complexity region 797 815 N/A INTRINSIC
Pumilio 848 883 1.75e-6 SMART
Pumilio 884 919 4.03e-6 SMART
Pumilio 920 954 5.24e-5 SMART
Pumilio 958 993 3.37e-8 SMART
Pumilio 994 1029 6.29e-8 SMART
Pumilio 1030 1065 1.04e-8 SMART
Pumilio 1066 1101 6.2e-7 SMART
Pumilio 1109 1144 8.77e-7 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000097864
AA Change: S124P

PolyPhen 2 Score 0.930 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000095476
Gene: ENSMUSG00000028580
AA Change: S124P

DomainStartEndE-ValueType
low complexity region 45 58 N/A INTRINSIC
low complexity region 94 102 N/A INTRINSIC
low complexity region 393 414 N/A INTRINSIC
low complexity region 442 457 N/A INTRINSIC
low complexity region 475 502 N/A INTRINSIC
low complexity region 527 538 N/A INTRINSIC
low complexity region 583 614 N/A INTRINSIC
low complexity region 626 636 N/A INTRINSIC
low complexity region 642 665 N/A INTRINSIC
low complexity region 671 695 N/A INTRINSIC
low complexity region 730 740 N/A INTRINSIC
low complexity region 762 782 N/A INTRINSIC
low complexity region 797 815 N/A INTRINSIC
Pumilio 848 883 1.75e-6 SMART
Pumilio 884 919 4.03e-6 SMART
Pumilio 920 955 5.48e-8 SMART
Pumilio 956 991 3.37e-8 SMART
Pumilio 992 1027 6.29e-8 SMART
Pumilio 1028 1063 1.04e-8 SMART
Pumilio 1064 1099 6.2e-7 SMART
Pumilio 1107 1142 8.77e-7 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000105991
AA Change: S124P

PolyPhen 2 Score 0.117 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000101612
Gene: ENSMUSG00000028580
AA Change: S124P

DomainStartEndE-ValueType
low complexity region 45 58 N/A INTRINSIC
low complexity region 94 102 N/A INTRINSIC
low complexity region 151 172 N/A INTRINSIC
low complexity region 200 215 N/A INTRINSIC
low complexity region 233 260 N/A INTRINSIC
low complexity region 285 296 N/A INTRINSIC
low complexity region 341 372 N/A INTRINSIC
low complexity region 384 394 N/A INTRINSIC
low complexity region 400 423 N/A INTRINSIC
low complexity region 429 453 N/A INTRINSIC
low complexity region 488 498 N/A INTRINSIC
low complexity region 520 540 N/A INTRINSIC
low complexity region 555 573 N/A INTRINSIC
Pumilio 606 641 1.75e-6 SMART
Pumilio 642 677 4.03e-6 SMART
Pumilio 678 713 5.48e-8 SMART
Pumilio 714 749 3.37e-8 SMART
Pumilio 750 785 6.29e-8 SMART
Pumilio 786 821 1.04e-8 SMART
Pumilio 822 857 6.2e-7 SMART
Pumilio 865 900 8.77e-7 SMART
Predicted Effect unknown
Transcript: ENSMUST00000105992
AA Change: S124P
SMART Domains Protein: ENSMUSP00000101613
Gene: ENSMUSG00000028580
AA Change: S124P

DomainStartEndE-ValueType
low complexity region 45 58 N/A INTRINSIC
low complexity region 94 102 N/A INTRINSIC
low complexity region 297 318 N/A INTRINSIC
low complexity region 346 361 N/A INTRINSIC
low complexity region 379 406 N/A INTRINSIC
low complexity region 431 442 N/A INTRINSIC
low complexity region 487 518 N/A INTRINSIC
low complexity region 530 540 N/A INTRINSIC
low complexity region 546 569 N/A INTRINSIC
low complexity region 575 599 N/A INTRINSIC
low complexity region 634 644 N/A INTRINSIC
low complexity region 666 686 N/A INTRINSIC
low complexity region 701 719 N/A INTRINSIC
Pumilio 752 787 1.75e-6 SMART
Pumilio 788 823 4.03e-6 SMART
Pumilio 824 858 5.24e-5 SMART
Pumilio 862 897 3.37e-8 SMART
Pumilio 898 933 6.29e-8 SMART
Pumilio 934 969 1.04e-8 SMART
Pumilio 970 1005 6.2e-7 SMART
Pumilio 1013 1048 8.77e-7 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000122847
Predicted Effect unknown
Transcript: ENSMUST00000143277
AA Change: S124P
SMART Domains Protein: ENSMUSP00000114629
Gene: ENSMUSG00000028580
AA Change: S124P

DomainStartEndE-ValueType
low complexity region 45 58 N/A INTRINSIC
low complexity region 94 102 N/A INTRINSIC
low complexity region 151 172 N/A INTRINSIC
low complexity region 200 215 N/A INTRINSIC
Coding Region Coverage
  • 1x: 97.4%
  • 3x: 96.8%
  • 10x: 94.9%
  • 20x: 91.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the PUF family, evolutionarily conserved RNA-binding proteins related to the Pumilio proteins of Drosophila and the fem-3 mRNA binding factor proteins of C. elegans. The encoded protein contains a sequence-specific RNA binding domain comprised of eight repeats and N- and C-terminal flanking regions, and serves as a translational regulator of specific mRNAs by binding to their 3' untranslated regions. The evolutionarily conserved function of the encoded protein in invertebrates and lower vertebrates suggests that the human protein may be involved in translational regulation of embryogenesis, and cell development and differentiation. Alternatively spliced transcript variants encoding different isoforms have been described. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit decreased testes weight and size, decreased body weight, oligozoospermia, reduced male fertility, increased male germ cell apoptosis and small seminiferous tubules. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 97 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acss2 T A 2: 155,400,550 (GRCm39) Y530N probably damaging Het
Adam4 T C 12: 81,466,333 (GRCm39) I763V probably benign Het
Aipl1 T G 11: 71,921,325 (GRCm39) K190T possibly damaging Het
Alms1 T A 6: 85,655,485 (GRCm39) S3344T possibly damaging Het
Alpi A G 1: 87,027,136 (GRCm39) V381A possibly damaging Het
Ankfn1 A T 11: 89,338,444 (GRCm39) S365R probably benign Het
Aox1 G A 1: 58,348,150 (GRCm39) A623T probably benign Het
Apc T A 18: 34,450,130 (GRCm39) L2308Q probably damaging Het
Atp9b C T 18: 80,822,098 (GRCm39) V501I probably benign Het
Baz2b T C 2: 59,732,163 (GRCm39) E1994G probably benign Het
Bltp2 G T 11: 78,178,576 (GRCm39) V1993F probably damaging Het
Cacna1a T C 8: 85,307,986 (GRCm39) probably null Het
Cacna1h C A 17: 25,611,050 (GRCm39) V583L probably benign Het
Cd55 T C 1: 130,375,346 (GRCm39) probably benign Het
Cep192 T A 18: 67,937,494 (GRCm39) S75T possibly damaging Het
Cfap54 T A 10: 92,798,237 (GRCm39) D1674V probably benign Het
Churc1 T C 12: 76,820,071 (GRCm39) F27L possibly damaging Het
Coro1c A G 5: 113,986,604 (GRCm39) I280T probably benign Het
Creb1 C T 1: 64,590,109 (GRCm39) Q32* probably null Het
Cyp2b9 A G 7: 25,900,208 (GRCm39) T339A probably benign Het
Dctn3 T C 4: 41,720,813 (GRCm39) R51G probably damaging Het
Ddb1 T C 19: 10,603,957 (GRCm39) V888A probably damaging Het
Disp1 A G 1: 182,870,564 (GRCm39) Y619H probably damaging Het
Dnajc9 T C 14: 20,438,402 (GRCm39) D96G possibly damaging Het
Eepd1 A G 9: 25,394,164 (GRCm39) T143A possibly damaging Het
Eps8 T A 6: 137,499,277 (GRCm39) K204* probably null Het
Ercc5 T A 1: 44,220,035 (GRCm39) S1102R probably benign Het
Ergic2 T A 6: 148,091,079 (GRCm39) Y211F possibly damaging Het
Fam135b G T 15: 71,362,560 (GRCm39) L274M probably damaging Het
Fat3 G A 9: 15,909,384 (GRCm39) T2206I probably damaging Het
Fat4 A G 3: 39,037,720 (GRCm39) I3791V probably benign Het
Gemin4 A G 11: 76,104,122 (GRCm39) M213T possibly damaging Het
Gnai3 T C 3: 108,025,723 (GRCm39) M119V probably benign Het
Heatr5b A T 17: 79,080,992 (GRCm39) L1420Q probably damaging Het
Herc2 G T 7: 55,856,513 (GRCm39) G3918* probably null Het
Ints9 A G 14: 65,269,705 (GRCm39) Y465C probably damaging Het
Ist1 A G 8: 110,405,515 (GRCm39) V175A probably damaging Het
Kcnj12 T C 11: 60,960,383 (GRCm39) L227P possibly damaging Het
Kcnq5 T C 1: 21,536,611 (GRCm39) S416G probably benign Het
Kdm3a T A 6: 71,590,940 (GRCm39) T295S probably benign Het
Kif1c T A 11: 70,599,797 (GRCm39) M479K probably damaging Het
Kif20b T C 19: 34,933,438 (GRCm39) L83P probably damaging Het
Kndc1 A G 7: 139,507,624 (GRCm39) E1194G probably damaging Het
Llgl1 A G 11: 60,595,556 (GRCm39) M81V probably benign Het
Map4k5 C A 12: 69,871,436 (GRCm39) M495I probably damaging Het
Mest C T 6: 30,742,790 (GRCm39) R146C probably benign Het
Mettl24 T A 10: 40,613,812 (GRCm39) probably null Het
Mical1 T C 10: 41,359,531 (GRCm39) S586P probably benign Het
Mrgpra3 G T 7: 47,239,694 (GRCm39) Y77* probably null Het
Mss51 A T 14: 20,533,246 (GRCm39) C408* probably null Het
Myh6 T C 14: 55,194,858 (GRCm39) T666A probably benign Het
Myo10 T C 15: 25,805,673 (GRCm39) C1685R possibly damaging Het
Naip5 A T 13: 100,359,726 (GRCm39) Y503* probably null Het
Neil1 A C 9: 57,053,888 (GRCm39) F144C probably damaging Het
Nipbl T A 15: 8,373,001 (GRCm39) I1082F possibly damaging Het
Nkiras1 T C 14: 18,276,732 (GRCm38) V7A probably damaging Het
Nt5el C A 13: 105,218,702 (GRCm39) A12E unknown Het
Ntng2 G A 2: 29,087,069 (GRCm39) Q384* probably null Het
Ocrl T A X: 47,050,993 (GRCm39) I74N probably damaging Het
Or10j27 A G 1: 172,958,382 (GRCm39) V134A probably benign Het
Or13a22 A G 7: 140,072,622 (GRCm39) S24G probably benign Het
Or14j8 C T 17: 38,263,276 (GRCm39) G213E possibly damaging Het
Or1e22 A C 11: 73,377,200 (GRCm39) V150G probably benign Het
Or2j3 A T 17: 38,616,203 (GRCm39) S50T probably benign Het
Or2y1 A T 11: 49,385,497 (GRCm39) I46F probably damaging Het
Patj A G 4: 98,379,827 (GRCm39) D151G probably benign Het
Plpbp T C 8: 27,539,259 (GRCm39) V126A probably damaging Het
Pold2 A G 11: 5,823,454 (GRCm39) L325P possibly damaging Het
Ppp1r12c A C 7: 4,486,650 (GRCm39) S480A probably damaging Het
Pwp2 C G 10: 78,014,925 (GRCm39) G353A probably damaging Het
Reln C A 5: 22,184,000 (GRCm39) Q1666H probably damaging Het
Rnf19a T C 15: 36,266,071 (GRCm39) I9V probably benign Het
Ryr2 T C 13: 11,784,764 (GRCm39) H1063R probably benign Het
Samd14 C G 11: 94,914,426 (GRCm39) D361E probably damaging Het
Samd15 A T 12: 87,248,617 (GRCm39) N365I probably damaging Het
Sec16b A G 1: 157,358,882 (GRCm39) H105R probably benign Het
Sez6 T C 11: 77,844,329 (GRCm39) S51P probably benign Het
Sh3bp1 T A 15: 78,789,350 (GRCm39) L236Q probably damaging Het
Sspo C T 6: 48,434,274 (GRCm39) T991I probably damaging Het
Suco A T 1: 161,687,069 (GRCm39) L97* probably null Het
Tab1 C A 15: 80,032,497 (GRCm39) R35S probably benign Het
Tet3 C A 6: 83,381,145 (GRCm39) S341I possibly damaging Het
Tlr1 A T 5: 65,083,043 (GRCm39) D511E probably benign Het
Tmem132b A C 5: 125,862,963 (GRCm39) D656A probably damaging Het
Tmtc4 T A 14: 123,179,400 (GRCm39) probably null Het
Trmo T C 4: 46,380,158 (GRCm39) T404A probably damaging Het
Trpm1 A G 7: 63,880,016 (GRCm39) K790E probably damaging Het
Ulk4 C A 9: 120,997,250 (GRCm39) R774M probably null Het
Ush2a C T 1: 188,184,015 (GRCm39) L1440F probably benign Het
Usp16 A G 16: 87,277,795 (GRCm39) K682E probably damaging Het
Virma T C 4: 11,540,511 (GRCm39) S1471P probably benign Het
Vmn1r177 A T 7: 23,565,111 (GRCm39) I255N probably damaging Het
Vmn2r61 A T 7: 41,916,076 (GRCm39) R230* probably null Het
Vps13c T A 9: 67,900,295 (GRCm39) F3671L probably benign Het
Washc5 T C 15: 59,231,189 (GRCm39) N358S possibly damaging Het
Wdr72 A G 9: 74,058,899 (GRCm39) K331E probably damaging Het
Zfp986 A T 4: 145,625,805 (GRCm39) K155I probably benign Het
Other mutations in Pum1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00985:Pum1 APN 4 130,471,100 (GRCm39) missense probably damaging 1.00
IGL01327:Pum1 APN 4 130,457,854 (GRCm39) missense probably damaging 0.97
IGL01360:Pum1 APN 4 130,455,481 (GRCm39) intron probably benign
IGL02055:Pum1 APN 4 130,481,365 (GRCm39) missense probably benign 0.19
IGL02713:Pum1 APN 4 130,493,323 (GRCm39) missense probably damaging 1.00
IGL03401:Pum1 APN 4 130,470,992 (GRCm39) splice site probably benign
LCD18:Pum1 UTSW 4 130,730,549 (GRCm38) intron probably benign
R0077:Pum1 UTSW 4 130,499,985 (GRCm39) missense probably benign 0.06
R0346:Pum1 UTSW 4 130,507,116 (GRCm39) missense possibly damaging 0.74
R0632:Pum1 UTSW 4 130,455,415 (GRCm39) missense probably benign 0.34
R0870:Pum1 UTSW 4 130,496,155 (GRCm39) missense probably damaging 0.99
R1006:Pum1 UTSW 4 130,499,199 (GRCm39) missense probably damaging 0.98
R1300:Pum1 UTSW 4 130,493,272 (GRCm39) missense probably damaging 1.00
R1499:Pum1 UTSW 4 130,446,567 (GRCm39) missense probably damaging 1.00
R1572:Pum1 UTSW 4 130,445,515 (GRCm39) missense probably damaging 0.99
R1864:Pum1 UTSW 4 130,478,836 (GRCm39) missense possibly damaging 0.90
R1991:Pum1 UTSW 4 130,445,529 (GRCm39) missense possibly damaging 0.93
R2068:Pum1 UTSW 4 130,501,745 (GRCm39) missense probably benign 0.02
R2119:Pum1 UTSW 4 130,396,581 (GRCm39) missense possibly damaging 0.92
R2120:Pum1 UTSW 4 130,396,581 (GRCm39) missense possibly damaging 0.92
R2122:Pum1 UTSW 4 130,396,581 (GRCm39) missense possibly damaging 0.92
R2153:Pum1 UTSW 4 130,478,802 (GRCm39) missense probably damaging 1.00
R2164:Pum1 UTSW 4 130,455,395 (GRCm39) missense probably damaging 0.99
R2164:Pum1 UTSW 4 130,455,394 (GRCm39) nonsense probably null
R2280:Pum1 UTSW 4 130,493,322 (GRCm39) missense probably damaging 1.00
R3116:Pum1 UTSW 4 130,499,971 (GRCm39) missense probably damaging 1.00
R3890:Pum1 UTSW 4 130,491,393 (GRCm39) missense probably damaging 1.00
R3891:Pum1 UTSW 4 130,491,393 (GRCm39) missense probably damaging 1.00
R3892:Pum1 UTSW 4 130,491,393 (GRCm39) missense probably damaging 1.00
R4134:Pum1 UTSW 4 130,491,380 (GRCm39) missense probably damaging 1.00
R4258:Pum1 UTSW 4 130,457,591 (GRCm39) missense probably damaging 1.00
R4731:Pum1 UTSW 4 130,445,504 (GRCm39) missense probably benign 0.00
R4732:Pum1 UTSW 4 130,445,504 (GRCm39) missense probably benign 0.00
R4733:Pum1 UTSW 4 130,445,504 (GRCm39) missense probably benign 0.00
R4973:Pum1 UTSW 4 130,396,448 (GRCm39) missense probably benign 0.27
R5198:Pum1 UTSW 4 130,507,190 (GRCm39) nonsense probably null
R5249:Pum1 UTSW 4 130,490,125 (GRCm39) missense probably benign 0.07
R5478:Pum1 UTSW 4 130,478,795 (GRCm39) missense possibly damaging 0.93
R5652:Pum1 UTSW 4 130,491,438 (GRCm39) missense possibly damaging 0.95
R5932:Pum1 UTSW 4 130,457,677 (GRCm39) missense probably benign 0.04
R6008:Pum1 UTSW 4 130,496,158 (GRCm39) missense probably damaging 1.00
R6112:Pum1 UTSW 4 130,457,591 (GRCm39) missense probably damaging 1.00
R6416:Pum1 UTSW 4 130,455,598 (GRCm39) splice site probably null
R6426:Pum1 UTSW 4 130,481,283 (GRCm39) missense probably damaging 1.00
R6431:Pum1 UTSW 4 130,501,816 (GRCm39) missense probably damaging 1.00
R7226:Pum1 UTSW 4 130,499,292 (GRCm39) missense probably damaging 1.00
R7273:Pum1 UTSW 4 130,478,791 (GRCm39) missense probably damaging 0.99
R7423:Pum1 UTSW 4 130,501,856 (GRCm39) missense probably damaging 1.00
R7491:Pum1 UTSW 4 130,446,485 (GRCm39) missense probably benign 0.08
R7526:Pum1 UTSW 4 130,474,337 (GRCm39) missense probably damaging 0.99
R7731:Pum1 UTSW 4 130,490,274 (GRCm39) missense probably benign 0.29
R7911:Pum1 UTSW 4 130,501,788 (GRCm39) missense probably benign 0.40
R8065:Pum1 UTSW 4 130,478,836 (GRCm39) missense possibly damaging 0.90
R8067:Pum1 UTSW 4 130,478,836 (GRCm39) missense possibly damaging 0.90
R8305:Pum1 UTSW 4 130,499,231 (GRCm39) missense probably benign 0.02
R8476:Pum1 UTSW 4 130,480,024 (GRCm39) missense possibly damaging 0.91
R8835:Pum1 UTSW 4 130,471,064 (GRCm39) missense probably damaging 1.00
R8875:Pum1 UTSW 4 130,507,186 (GRCm39) missense possibly damaging 0.60
R9003:Pum1 UTSW 4 130,474,393 (GRCm39) missense probably benign 0.00
R9072:Pum1 UTSW 4 130,480,172 (GRCm39) missense probably damaging 1.00
R9073:Pum1 UTSW 4 130,480,172 (GRCm39) missense probably damaging 1.00
R9332:Pum1 UTSW 4 130,499,209 (GRCm39) nonsense probably null
R9496:Pum1 UTSW 4 130,446,664 (GRCm39) critical splice donor site probably null
R9801:Pum1 UTSW 4 130,481,328 (GRCm39) missense probably benign 0.28
X0024:Pum1 UTSW 4 130,507,101 (GRCm39) missense probably benign 0.00
Z1177:Pum1 UTSW 4 130,478,790 (GRCm39) missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- GGGTAACACAGGGATCATTTCTG -3'
(R):5'- CACCAGTAGAGTTTTGGCACAG -3'

Sequencing Primer
(F):5'- CACAGGGATCATTTCTGAATCTTG -3'
(R):5'- CTATTCCTACTGTGAGGATGGCAAC -3'
Posted On 2014-06-23