Incidental Mutation 'R1835:Eps8'
ID 205162
Institutional Source Beutler Lab
Gene Symbol Eps8
Ensembl Gene ENSMUSG00000015766
Gene Name epidermal growth factor receptor pathway substrate 8
Synonyms
MMRRC Submission 039862-MU
Accession Numbers
Essential gene? Possibly non essential (E-score: 0.324) question?
Stock # R1835 (G1)
Quality Score 225
Status Not validated
Chromosome 6
Chromosomal Location 137454242-137626262 bp(-) (GRCm39)
Type of Mutation nonsense
DNA Base Change (assembly) T to A at 137499277 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Lysine to Stop codon at position 204 (K204*)
Ref Sequence ENSEMBL: ENSMUSP00000120044 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000058210] [ENSMUST00000100841] [ENSMUST00000111878] [ENSMUST00000132920] [ENSMUST00000146442] [ENSMUST00000147526]
AlphaFold Q08509
Predicted Effect probably null
Transcript: ENSMUST00000058210
AA Change: K204*
SMART Domains Protein: ENSMUSP00000052776
Gene: ENSMUSG00000015766
AA Change: K204*

DomainStartEndE-ValueType
PTB 60 197 8.38e-34 SMART
low complexity region 203 221 N/A INTRINSIC
low complexity region 229 241 N/A INTRINSIC
low complexity region 298 309 N/A INTRINSIC
SH3 533 588 5.48e-14 SMART
low complexity region 620 651 N/A INTRINSIC
Blast:SH3 652 686 6e-6 BLAST
PDB:2E8M|A 698 783 5e-50 PDB
Predicted Effect probably null
Transcript: ENSMUST00000100841
AA Change: K204*
SMART Domains Protein: ENSMUSP00000098402
Gene: ENSMUSG00000015766
AA Change: K204*

DomainStartEndE-ValueType
PTB 60 197 8.38e-34 SMART
low complexity region 203 221 N/A INTRINSIC
low complexity region 229 241 N/A INTRINSIC
low complexity region 298 309 N/A INTRINSIC
SH3 533 588 5.48e-14 SMART
low complexity region 620 651 N/A INTRINSIC
Blast:SH3 652 686 6e-6 BLAST
PDB:2E8M|A 698 783 5e-50 PDB
Predicted Effect probably null
Transcript: ENSMUST00000111878
AA Change: K204*
SMART Domains Protein: ENSMUSP00000107509
Gene: ENSMUSG00000015766
AA Change: K204*

DomainStartEndE-ValueType
PTB 60 197 8.38e-34 SMART
low complexity region 203 221 N/A INTRINSIC
low complexity region 229 241 N/A INTRINSIC
low complexity region 298 309 N/A INTRINSIC
SH3 533 588 5.48e-14 SMART
low complexity region 620 651 N/A INTRINSIC
Blast:SH3 652 686 6e-6 BLAST
PDB:2E8M|A 698 783 5e-50 PDB
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127179
Predicted Effect probably null
Transcript: ENSMUST00000132920
AA Change: K221*
SMART Domains Protein: ENSMUSP00000122517
Gene: ENSMUSG00000015766
AA Change: K221*

DomainStartEndE-ValueType
low complexity region 54 66 N/A INTRINSIC
PTB 77 214 8.38e-34 SMART
low complexity region 220 238 N/A INTRINSIC
low complexity region 246 258 N/A INTRINSIC
low complexity region 315 326 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000146442
SMART Domains Protein: ENSMUSP00000119997
Gene: ENSMUSG00000015766

DomainStartEndE-ValueType
PTB 60 188 3.18e-25 SMART
Predicted Effect probably null
Transcript: ENSMUST00000147526
AA Change: K204*
SMART Domains Protein: ENSMUSP00000120044
Gene: ENSMUSG00000015766
AA Change: K204*

DomainStartEndE-ValueType
PTB 60 197 8.38e-34 SMART
low complexity region 203 221 N/A INTRINSIC
low complexity region 229 241 N/A INTRINSIC
low complexity region 298 309 N/A INTRINSIC
SH3 533 587 4.56e-11 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152046
Coding Region Coverage
  • 1x: 97.4%
  • 3x: 96.8%
  • 10x: 94.9%
  • 20x: 91.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the EPS8 family. This protein contains one PH domain and one SH3 domain. It functions as part of the EGFR pathway, though its exact role has not been determined. Highly similar proteins in other organisms are involved in the transduction of signals from Ras to Rac and growth factor-mediated actin remodeling. Alternate transcriptional splice variants of this gene have been observed but have not been thoroughly characterized. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous mutation of this gene results in resistance to some of the intoxicating effects of ethanol and increased ethanol consumption. NMDA receptor currents and their sensitivity to inhibition by ethanol are abnormal. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 97 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acss2 T A 2: 155,400,550 (GRCm39) Y530N probably damaging Het
Adam4 T C 12: 81,466,333 (GRCm39) I763V probably benign Het
Aipl1 T G 11: 71,921,325 (GRCm39) K190T possibly damaging Het
Alms1 T A 6: 85,655,485 (GRCm39) S3344T possibly damaging Het
Alpi A G 1: 87,027,136 (GRCm39) V381A possibly damaging Het
Ankfn1 A T 11: 89,338,444 (GRCm39) S365R probably benign Het
Aox1 G A 1: 58,348,150 (GRCm39) A623T probably benign Het
Apc T A 18: 34,450,130 (GRCm39) L2308Q probably damaging Het
Atp9b C T 18: 80,822,098 (GRCm39) V501I probably benign Het
Baz2b T C 2: 59,732,163 (GRCm39) E1994G probably benign Het
Bltp2 G T 11: 78,178,576 (GRCm39) V1993F probably damaging Het
Cacna1a T C 8: 85,307,986 (GRCm39) probably null Het
Cacna1h C A 17: 25,611,050 (GRCm39) V583L probably benign Het
Cd55 T C 1: 130,375,346 (GRCm39) probably benign Het
Cep192 T A 18: 67,937,494 (GRCm39) S75T possibly damaging Het
Cfap54 T A 10: 92,798,237 (GRCm39) D1674V probably benign Het
Churc1 T C 12: 76,820,071 (GRCm39) F27L possibly damaging Het
Coro1c A G 5: 113,986,604 (GRCm39) I280T probably benign Het
Creb1 C T 1: 64,590,109 (GRCm39) Q32* probably null Het
Cyp2b9 A G 7: 25,900,208 (GRCm39) T339A probably benign Het
Dctn3 T C 4: 41,720,813 (GRCm39) R51G probably damaging Het
Ddb1 T C 19: 10,603,957 (GRCm39) V888A probably damaging Het
Disp1 A G 1: 182,870,564 (GRCm39) Y619H probably damaging Het
Dnajc9 T C 14: 20,438,402 (GRCm39) D96G possibly damaging Het
Eepd1 A G 9: 25,394,164 (GRCm39) T143A possibly damaging Het
Ercc5 T A 1: 44,220,035 (GRCm39) S1102R probably benign Het
Ergic2 T A 6: 148,091,079 (GRCm39) Y211F possibly damaging Het
Fam135b G T 15: 71,362,560 (GRCm39) L274M probably damaging Het
Fat3 G A 9: 15,909,384 (GRCm39) T2206I probably damaging Het
Fat4 A G 3: 39,037,720 (GRCm39) I3791V probably benign Het
Gemin4 A G 11: 76,104,122 (GRCm39) M213T possibly damaging Het
Gnai3 T C 3: 108,025,723 (GRCm39) M119V probably benign Het
Heatr5b A T 17: 79,080,992 (GRCm39) L1420Q probably damaging Het
Herc2 G T 7: 55,856,513 (GRCm39) G3918* probably null Het
Ints9 A G 14: 65,269,705 (GRCm39) Y465C probably damaging Het
Ist1 A G 8: 110,405,515 (GRCm39) V175A probably damaging Het
Kcnj12 T C 11: 60,960,383 (GRCm39) L227P possibly damaging Het
Kcnq5 T C 1: 21,536,611 (GRCm39) S416G probably benign Het
Kdm3a T A 6: 71,590,940 (GRCm39) T295S probably benign Het
Kif1c T A 11: 70,599,797 (GRCm39) M479K probably damaging Het
Kif20b T C 19: 34,933,438 (GRCm39) L83P probably damaging Het
Kndc1 A G 7: 139,507,624 (GRCm39) E1194G probably damaging Het
Llgl1 A G 11: 60,595,556 (GRCm39) M81V probably benign Het
Map4k5 C A 12: 69,871,436 (GRCm39) M495I probably damaging Het
Mest C T 6: 30,742,790 (GRCm39) R146C probably benign Het
Mettl24 T A 10: 40,613,812 (GRCm39) probably null Het
Mical1 T C 10: 41,359,531 (GRCm39) S586P probably benign Het
Mrgpra3 G T 7: 47,239,694 (GRCm39) Y77* probably null Het
Mss51 A T 14: 20,533,246 (GRCm39) C408* probably null Het
Myh6 T C 14: 55,194,858 (GRCm39) T666A probably benign Het
Myo10 T C 15: 25,805,673 (GRCm39) C1685R possibly damaging Het
Naip5 A T 13: 100,359,726 (GRCm39) Y503* probably null Het
Neil1 A C 9: 57,053,888 (GRCm39) F144C probably damaging Het
Nipbl T A 15: 8,373,001 (GRCm39) I1082F possibly damaging Het
Nkiras1 T C 14: 18,276,732 (GRCm38) V7A probably damaging Het
Nt5el C A 13: 105,218,702 (GRCm39) A12E unknown Het
Ntng2 G A 2: 29,087,069 (GRCm39) Q384* probably null Het
Ocrl T A X: 47,050,993 (GRCm39) I74N probably damaging Het
Or10j27 A G 1: 172,958,382 (GRCm39) V134A probably benign Het
Or13a22 A G 7: 140,072,622 (GRCm39) S24G probably benign Het
Or14j8 C T 17: 38,263,276 (GRCm39) G213E possibly damaging Het
Or1e22 A C 11: 73,377,200 (GRCm39) V150G probably benign Het
Or2j3 A T 17: 38,616,203 (GRCm39) S50T probably benign Het
Or2y1 A T 11: 49,385,497 (GRCm39) I46F probably damaging Het
Patj A G 4: 98,379,827 (GRCm39) D151G probably benign Het
Plpbp T C 8: 27,539,259 (GRCm39) V126A probably damaging Het
Pold2 A G 11: 5,823,454 (GRCm39) L325P possibly damaging Het
Ppp1r12c A C 7: 4,486,650 (GRCm39) S480A probably damaging Het
Pum1 T C 4: 130,428,359 (GRCm39) S124P possibly damaging Het
Pwp2 C G 10: 78,014,925 (GRCm39) G353A probably damaging Het
Reln C A 5: 22,184,000 (GRCm39) Q1666H probably damaging Het
Rnf19a T C 15: 36,266,071 (GRCm39) I9V probably benign Het
Ryr2 T C 13: 11,784,764 (GRCm39) H1063R probably benign Het
Samd14 C G 11: 94,914,426 (GRCm39) D361E probably damaging Het
Samd15 A T 12: 87,248,617 (GRCm39) N365I probably damaging Het
Sec16b A G 1: 157,358,882 (GRCm39) H105R probably benign Het
Sez6 T C 11: 77,844,329 (GRCm39) S51P probably benign Het
Sh3bp1 T A 15: 78,789,350 (GRCm39) L236Q probably damaging Het
Sspo C T 6: 48,434,274 (GRCm39) T991I probably damaging Het
Suco A T 1: 161,687,069 (GRCm39) L97* probably null Het
Tab1 C A 15: 80,032,497 (GRCm39) R35S probably benign Het
Tet3 C A 6: 83,381,145 (GRCm39) S341I possibly damaging Het
Tlr1 A T 5: 65,083,043 (GRCm39) D511E probably benign Het
Tmem132b A C 5: 125,862,963 (GRCm39) D656A probably damaging Het
Tmtc4 T A 14: 123,179,400 (GRCm39) probably null Het
Trmo T C 4: 46,380,158 (GRCm39) T404A probably damaging Het
Trpm1 A G 7: 63,880,016 (GRCm39) K790E probably damaging Het
Ulk4 C A 9: 120,997,250 (GRCm39) R774M probably null Het
Ush2a C T 1: 188,184,015 (GRCm39) L1440F probably benign Het
Usp16 A G 16: 87,277,795 (GRCm39) K682E probably damaging Het
Virma T C 4: 11,540,511 (GRCm39) S1471P probably benign Het
Vmn1r177 A T 7: 23,565,111 (GRCm39) I255N probably damaging Het
Vmn2r61 A T 7: 41,916,076 (GRCm39) R230* probably null Het
Vps13c T A 9: 67,900,295 (GRCm39) F3671L probably benign Het
Washc5 T C 15: 59,231,189 (GRCm39) N358S possibly damaging Het
Wdr72 A G 9: 74,058,899 (GRCm39) K331E probably damaging Het
Zfp986 A T 4: 145,625,805 (GRCm39) K155I probably benign Het
Other mutations in Eps8
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00482:Eps8 APN 6 137,482,477 (GRCm39) missense probably benign 0.00
IGL00499:Eps8 APN 6 137,499,886 (GRCm39) nonsense probably null
IGL01587:Eps8 APN 6 137,491,711 (GRCm39) missense probably damaging 1.00
IGL01789:Eps8 APN 6 137,516,364 (GRCm39) missense probably benign 0.01
IGL01836:Eps8 APN 6 137,460,539 (GRCm39) critical splice donor site probably null
IGL01951:Eps8 APN 6 137,514,669 (GRCm39) missense possibly damaging 0.66
IGL02478:Eps8 APN 6 137,499,840 (GRCm39) missense probably benign 0.05
IGL02546:Eps8 APN 6 137,456,064 (GRCm39) missense probably benign 0.30
IGL02861:Eps8 APN 6 137,476,597 (GRCm39) missense probably damaging 1.00
IGL03115:Eps8 APN 6 137,504,379 (GRCm39) missense probably damaging 1.00
IGL03355:Eps8 APN 6 137,489,143 (GRCm39) splice site probably benign
FR4589:Eps8 UTSW 6 137,494,067 (GRCm39) frame shift probably null
R0113:Eps8 UTSW 6 137,514,682 (GRCm39) missense possibly damaging 0.87
R0245:Eps8 UTSW 6 137,456,126 (GRCm39) missense probably benign 0.01
R0462:Eps8 UTSW 6 137,491,309 (GRCm39) missense probably benign 0.00
R0905:Eps8 UTSW 6 137,491,305 (GRCm39) missense probably benign 0.23
R1106:Eps8 UTSW 6 137,491,322 (GRCm39) missense probably damaging 1.00
R1178:Eps8 UTSW 6 137,499,852 (GRCm39) missense possibly damaging 0.46
R1181:Eps8 UTSW 6 137,499,852 (GRCm39) missense possibly damaging 0.46
R1448:Eps8 UTSW 6 137,499,852 (GRCm39) missense possibly damaging 0.46
R1612:Eps8 UTSW 6 137,477,616 (GRCm39) missense probably benign 0.00
R2068:Eps8 UTSW 6 137,499,172 (GRCm39) missense probably benign 0.13
R2113:Eps8 UTSW 6 137,514,633 (GRCm39) splice site probably null
R2943:Eps8 UTSW 6 137,499,870 (GRCm39) missense probably damaging 1.00
R3032:Eps8 UTSW 6 137,489,175 (GRCm39) missense probably damaging 0.96
R3879:Eps8 UTSW 6 137,504,360 (GRCm39) splice site probably benign
R3973:Eps8 UTSW 6 137,486,153 (GRCm39) missense probably benign 0.00
R4199:Eps8 UTSW 6 137,491,325 (GRCm39) missense probably damaging 0.96
R4384:Eps8 UTSW 6 137,476,590 (GRCm39) missense probably benign 0.30
R4728:Eps8 UTSW 6 137,486,160 (GRCm39) nonsense probably null
R4840:Eps8 UTSW 6 137,504,128 (GRCm39) missense probably damaging 1.00
R4860:Eps8 UTSW 6 137,491,293 (GRCm39) missense probably damaging 0.97
R4860:Eps8 UTSW 6 137,491,293 (GRCm39) missense probably damaging 0.97
R4864:Eps8 UTSW 6 137,455,967 (GRCm39) utr 3 prime probably benign
R5197:Eps8 UTSW 6 137,467,288 (GRCm39) missense probably damaging 0.97
R5197:Eps8 UTSW 6 137,467,289 (GRCm39) missense possibly damaging 0.91
R5214:Eps8 UTSW 6 137,504,490 (GRCm39) missense probably damaging 0.99
R5457:Eps8 UTSW 6 137,489,175 (GRCm39) missense probably damaging 0.96
R5464:Eps8 UTSW 6 137,504,473 (GRCm39) missense probably damaging 1.00
R5557:Eps8 UTSW 6 137,456,094 (GRCm39) missense possibly damaging 0.90
R5981:Eps8 UTSW 6 137,459,208 (GRCm39) missense probably damaging 0.98
R6150:Eps8 UTSW 6 137,494,172 (GRCm39) missense probably damaging 1.00
R6473:Eps8 UTSW 6 137,456,096 (GRCm39) missense probably damaging 1.00
R6529:Eps8 UTSW 6 137,491,335 (GRCm39) missense possibly damaging 0.92
R6574:Eps8 UTSW 6 137,460,596 (GRCm39) nonsense probably null
R6890:Eps8 UTSW 6 137,489,255 (GRCm39) missense probably damaging 0.99
R7180:Eps8 UTSW 6 137,456,072 (GRCm39) missense possibly damaging 0.78
R7229:Eps8 UTSW 6 137,516,354 (GRCm39) missense probably benign
R7314:Eps8 UTSW 6 137,504,090 (GRCm39) missense possibly damaging 0.51
R7336:Eps8 UTSW 6 137,486,211 (GRCm39) missense possibly damaging 0.75
R7784:Eps8 UTSW 6 137,476,585 (GRCm39) missense probably benign 0.01
R7942:Eps8 UTSW 6 137,507,575 (GRCm39) missense possibly damaging 0.53
R7988:Eps8 UTSW 6 137,505,569 (GRCm39) missense possibly damaging 0.95
R7989:Eps8 UTSW 6 137,505,569 (GRCm39) missense possibly damaging 0.95
R7991:Eps8 UTSW 6 137,505,569 (GRCm39) missense possibly damaging 0.95
R8235:Eps8 UTSW 6 137,460,576 (GRCm39) missense possibly damaging 0.62
R8262:Eps8 UTSW 6 137,459,252 (GRCm39) missense probably benign 0.10
R8834:Eps8 UTSW 6 137,504,306 (GRCm39) intron probably benign
R8902:Eps8 UTSW 6 137,489,175 (GRCm39) missense probably damaging 1.00
R9081:Eps8 UTSW 6 137,504,415 (GRCm39) missense probably benign 0.02
R9225:Eps8 UTSW 6 137,507,561 (GRCm39) missense probably benign 0.18
RF025:Eps8 UTSW 6 137,494,064 (GRCm39) critical splice donor site probably benign
RF028:Eps8 UTSW 6 137,494,061 (GRCm39) critical splice donor site probably benign
RF035:Eps8 UTSW 6 137,494,068 (GRCm39) frame shift probably null
RF039:Eps8 UTSW 6 137,494,068 (GRCm39) frame shift probably null
RF046:Eps8 UTSW 6 137,494,061 (GRCm39) critical splice donor site probably benign
RF057:Eps8 UTSW 6 137,494,062 (GRCm39) critical splice donor site probably benign
Z1177:Eps8 UTSW 6 137,476,579 (GRCm39) critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- CTTGAAAGGAGGACTGACACC -3'
(R):5'- AAATCAATGTTGCTTCCCAGG -3'

Sequencing Primer
(F):5'- CATAGCTCTCGTGGATGCTCAGAAG -3'
(R):5'- TTCTGTGTCTCAGGAACTTACCAG -3'
Posted On 2014-06-23