Incidental Mutation 'R1835:Ppp1r12c'
ID 205164
Institutional Source Beutler Lab
Gene Symbol Ppp1r12c
Ensembl Gene ENSMUSG00000019254
Gene Name protein phosphatase 1, regulatory subunit 12C
Synonyms Mbs85, 2410197A17Rik
MMRRC Submission 039862-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.139) question?
Stock # R1835 (G1)
Quality Score 205
Status Not validated
Chromosome 7
Chromosomal Location 4484519-4504679 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to C at 4486650 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Serine to Alanine at position 480 (S480A)
Ref Sequence ENSEMBL: ENSMUSP00000120029 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000013886] [ENSMUST00000013886] [ENSMUST00000013886] [ENSMUST00000086372] [ENSMUST00000124248] [ENSMUST00000124248] [ENSMUST00000124248] [ENSMUST00000163893] [ENSMUST00000163137] [ENSMUST00000164987] [ENSMUST00000171445]
AlphaFold Q3UMT1
Predicted Effect probably damaging
Transcript: ENSMUST00000013886
AA Change: S559A

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000013886
Gene: ENSMUSG00000019254
AA Change: S559A

DomainStartEndE-ValueType
low complexity region 6 20 N/A INTRINSIC
low complexity region 74 97 N/A INTRINSIC
ANK 104 133 3.71e-4 SMART
ANK 137 166 3.43e-8 SMART
low complexity region 205 210 N/A INTRINSIC
ANK 230 259 7.95e-4 SMART
ANK 263 292 2.41e-3 SMART
low complexity region 369 385 N/A INTRINSIC
low complexity region 401 413 N/A INTRINSIC
internal_repeat_2 450 508 2.86e-5 PROSPERO
internal_repeat_2 545 599 2.86e-5 PROSPERO
low complexity region 631 649 N/A INTRINSIC
Pfam:PRKG1_interact 682 782 9.7e-33 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000013886
AA Change: S559A

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000013886
Gene: ENSMUSG00000019254
AA Change: S559A

DomainStartEndE-ValueType
low complexity region 6 20 N/A INTRINSIC
low complexity region 74 97 N/A INTRINSIC
ANK 104 133 3.71e-4 SMART
ANK 137 166 3.43e-8 SMART
low complexity region 205 210 N/A INTRINSIC
ANK 230 259 7.95e-4 SMART
ANK 263 292 2.41e-3 SMART
low complexity region 369 385 N/A INTRINSIC
low complexity region 401 413 N/A INTRINSIC
internal_repeat_2 450 508 2.86e-5 PROSPERO
internal_repeat_2 545 599 2.86e-5 PROSPERO
low complexity region 631 649 N/A INTRINSIC
Pfam:PRKG1_interact 682 782 9.7e-33 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000013886
AA Change: S559A

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000013886
Gene: ENSMUSG00000019254
AA Change: S559A

DomainStartEndE-ValueType
low complexity region 6 20 N/A INTRINSIC
low complexity region 74 97 N/A INTRINSIC
ANK 104 133 3.71e-4 SMART
ANK 137 166 3.43e-8 SMART
low complexity region 205 210 N/A INTRINSIC
ANK 230 259 7.95e-4 SMART
ANK 263 292 2.41e-3 SMART
low complexity region 369 385 N/A INTRINSIC
low complexity region 401 413 N/A INTRINSIC
internal_repeat_2 450 508 2.86e-5 PROSPERO
internal_repeat_2 545 599 2.86e-5 PROSPERO
low complexity region 631 649 N/A INTRINSIC
Pfam:PRKG1_interact 682 782 9.7e-33 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000086372
SMART Domains Protein: ENSMUSP00000083559
Gene: ENSMUSG00000006154

DomainStartEndE-ValueType
Pfam:PTB 35 165 2.1e-46 PFAM
low complexity region 282 304 N/A INTRINSIC
SH3 480 535 2.62e-11 SMART
low complexity region 554 564 N/A INTRINSIC
PDB:1WWU|A 632 698 1e-19 PDB
low complexity region 701 715 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000124248
AA Change: S480A

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000120029
Gene: ENSMUSG00000019254
AA Change: S480A

DomainStartEndE-ValueType
ANK 25 54 3.71e-4 SMART
ANK 58 87 3.43e-8 SMART
low complexity region 126 131 N/A INTRINSIC
ANK 151 180 7.95e-4 SMART
ANK 184 213 2.41e-3 SMART
low complexity region 290 306 N/A INTRINSIC
low complexity region 322 334 N/A INTRINSIC
PDB:2KJY|A 445 498 3e-11 PDB
low complexity region 553 571 N/A INTRINSIC
coiled coil region 604 704 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000124248
AA Change: S480A

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000120029
Gene: ENSMUSG00000019254
AA Change: S480A

DomainStartEndE-ValueType
ANK 25 54 3.71e-4 SMART
ANK 58 87 3.43e-8 SMART
low complexity region 126 131 N/A INTRINSIC
ANK 151 180 7.95e-4 SMART
ANK 184 213 2.41e-3 SMART
low complexity region 290 306 N/A INTRINSIC
low complexity region 322 334 N/A INTRINSIC
PDB:2KJY|A 445 498 3e-11 PDB
low complexity region 553 571 N/A INTRINSIC
coiled coil region 604 704 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000124248
AA Change: S480A

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000120029
Gene: ENSMUSG00000019254
AA Change: S480A

DomainStartEndE-ValueType
ANK 25 54 3.71e-4 SMART
ANK 58 87 3.43e-8 SMART
low complexity region 126 131 N/A INTRINSIC
ANK 151 180 7.95e-4 SMART
ANK 184 213 2.41e-3 SMART
low complexity region 290 306 N/A INTRINSIC
low complexity region 322 334 N/A INTRINSIC
PDB:2KJY|A 445 498 3e-11 PDB
low complexity region 553 571 N/A INTRINSIC
coiled coil region 604 704 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127329
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133374
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134738
Predicted Effect noncoding transcript
Transcript: ENSMUST00000136863
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147679
Predicted Effect noncoding transcript
Transcript: ENSMUST00000154710
Predicted Effect noncoding transcript
Transcript: ENSMUST00000153101
Predicted Effect probably benign
Transcript: ENSMUST00000163893
SMART Domains Protein: ENSMUSP00000125840
Gene: ENSMUSG00000006154

DomainStartEndE-ValueType
Pfam:PTB 35 165 2.1e-46 PFAM
low complexity region 282 304 N/A INTRINSIC
SH3 480 535 2.62e-11 SMART
low complexity region 554 564 N/A INTRINSIC
PDB:1WWU|A 632 698 1e-19 PDB
low complexity region 701 715 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000163137
SMART Domains Protein: ENSMUSP00000131345
Gene: ENSMUSG00000006154

DomainStartEndE-ValueType
Pfam:PTB 35 100 1.9e-22 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000164987
SMART Domains Protein: ENSMUSP00000130665
Gene: ENSMUSG00000006154

DomainStartEndE-ValueType
low complexity region 15 25 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000171445
SMART Domains Protein: ENSMUSP00000133206
Gene: ENSMUSG00000006154

DomainStartEndE-ValueType
Pfam:PTB 96 226 5.8e-46 PFAM
low complexity region 343 365 N/A INTRINSIC
SH3 541 596 2.62e-11 SMART
low complexity region 615 625 N/A INTRINSIC
PDB:1WWU|A 693 759 1e-19 PDB
low complexity region 762 776 N/A INTRINSIC
Coding Region Coverage
  • 1x: 97.4%
  • 3x: 96.8%
  • 10x: 94.9%
  • 20x: 91.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The gene encodes a subunit of myosin phosphatase. The encoded protein regulates the catalytic activity of protein phosphatase 1 delta and assembly of the actin cytoskeleton. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Oct 2012]
Allele List at MGI
Other mutations in this stock
Total: 97 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acss2 T A 2: 155,400,550 (GRCm39) Y530N probably damaging Het
Adam4 T C 12: 81,466,333 (GRCm39) I763V probably benign Het
Aipl1 T G 11: 71,921,325 (GRCm39) K190T possibly damaging Het
Alms1 T A 6: 85,655,485 (GRCm39) S3344T possibly damaging Het
Alpi A G 1: 87,027,136 (GRCm39) V381A possibly damaging Het
Ankfn1 A T 11: 89,338,444 (GRCm39) S365R probably benign Het
Aox1 G A 1: 58,348,150 (GRCm39) A623T probably benign Het
Apc T A 18: 34,450,130 (GRCm39) L2308Q probably damaging Het
Atp9b C T 18: 80,822,098 (GRCm39) V501I probably benign Het
Baz2b T C 2: 59,732,163 (GRCm39) E1994G probably benign Het
Bltp2 G T 11: 78,178,576 (GRCm39) V1993F probably damaging Het
Cacna1a T C 8: 85,307,986 (GRCm39) probably null Het
Cacna1h C A 17: 25,611,050 (GRCm39) V583L probably benign Het
Cd55 T C 1: 130,375,346 (GRCm39) probably benign Het
Cep192 T A 18: 67,937,494 (GRCm39) S75T possibly damaging Het
Cfap54 T A 10: 92,798,237 (GRCm39) D1674V probably benign Het
Churc1 T C 12: 76,820,071 (GRCm39) F27L possibly damaging Het
Coro1c A G 5: 113,986,604 (GRCm39) I280T probably benign Het
Creb1 C T 1: 64,590,109 (GRCm39) Q32* probably null Het
Cyp2b9 A G 7: 25,900,208 (GRCm39) T339A probably benign Het
Dctn3 T C 4: 41,720,813 (GRCm39) R51G probably damaging Het
Ddb1 T C 19: 10,603,957 (GRCm39) V888A probably damaging Het
Disp1 A G 1: 182,870,564 (GRCm39) Y619H probably damaging Het
Dnajc9 T C 14: 20,438,402 (GRCm39) D96G possibly damaging Het
Eepd1 A G 9: 25,394,164 (GRCm39) T143A possibly damaging Het
Eps8 T A 6: 137,499,277 (GRCm39) K204* probably null Het
Ercc5 T A 1: 44,220,035 (GRCm39) S1102R probably benign Het
Ergic2 T A 6: 148,091,079 (GRCm39) Y211F possibly damaging Het
Fam135b G T 15: 71,362,560 (GRCm39) L274M probably damaging Het
Fat3 G A 9: 15,909,384 (GRCm39) T2206I probably damaging Het
Fat4 A G 3: 39,037,720 (GRCm39) I3791V probably benign Het
Gemin4 A G 11: 76,104,122 (GRCm39) M213T possibly damaging Het
Gnai3 T C 3: 108,025,723 (GRCm39) M119V probably benign Het
Heatr5b A T 17: 79,080,992 (GRCm39) L1420Q probably damaging Het
Herc2 G T 7: 55,856,513 (GRCm39) G3918* probably null Het
Ints9 A G 14: 65,269,705 (GRCm39) Y465C probably damaging Het
Ist1 A G 8: 110,405,515 (GRCm39) V175A probably damaging Het
Kcnj12 T C 11: 60,960,383 (GRCm39) L227P possibly damaging Het
Kcnq5 T C 1: 21,536,611 (GRCm39) S416G probably benign Het
Kdm3a T A 6: 71,590,940 (GRCm39) T295S probably benign Het
Kif1c T A 11: 70,599,797 (GRCm39) M479K probably damaging Het
Kif20b T C 19: 34,933,438 (GRCm39) L83P probably damaging Het
Kndc1 A G 7: 139,507,624 (GRCm39) E1194G probably damaging Het
Llgl1 A G 11: 60,595,556 (GRCm39) M81V probably benign Het
Map4k5 C A 12: 69,871,436 (GRCm39) M495I probably damaging Het
Mest C T 6: 30,742,790 (GRCm39) R146C probably benign Het
Mettl24 T A 10: 40,613,812 (GRCm39) probably null Het
Mical1 T C 10: 41,359,531 (GRCm39) S586P probably benign Het
Mrgpra3 G T 7: 47,239,694 (GRCm39) Y77* probably null Het
Mss51 A T 14: 20,533,246 (GRCm39) C408* probably null Het
Myh6 T C 14: 55,194,858 (GRCm39) T666A probably benign Het
Myo10 T C 15: 25,805,673 (GRCm39) C1685R possibly damaging Het
Naip5 A T 13: 100,359,726 (GRCm39) Y503* probably null Het
Neil1 A C 9: 57,053,888 (GRCm39) F144C probably damaging Het
Nipbl T A 15: 8,373,001 (GRCm39) I1082F possibly damaging Het
Nkiras1 T C 14: 18,276,732 (GRCm38) V7A probably damaging Het
Nt5el C A 13: 105,218,702 (GRCm39) A12E unknown Het
Ntng2 G A 2: 29,087,069 (GRCm39) Q384* probably null Het
Ocrl T A X: 47,050,993 (GRCm39) I74N probably damaging Het
Or10j27 A G 1: 172,958,382 (GRCm39) V134A probably benign Het
Or13a22 A G 7: 140,072,622 (GRCm39) S24G probably benign Het
Or14j8 C T 17: 38,263,276 (GRCm39) G213E possibly damaging Het
Or1e22 A C 11: 73,377,200 (GRCm39) V150G probably benign Het
Or2j3 A T 17: 38,616,203 (GRCm39) S50T probably benign Het
Or2y1 A T 11: 49,385,497 (GRCm39) I46F probably damaging Het
Patj A G 4: 98,379,827 (GRCm39) D151G probably benign Het
Plpbp T C 8: 27,539,259 (GRCm39) V126A probably damaging Het
Pold2 A G 11: 5,823,454 (GRCm39) L325P possibly damaging Het
Pum1 T C 4: 130,428,359 (GRCm39) S124P possibly damaging Het
Pwp2 C G 10: 78,014,925 (GRCm39) G353A probably damaging Het
Reln C A 5: 22,184,000 (GRCm39) Q1666H probably damaging Het
Rnf19a T C 15: 36,266,071 (GRCm39) I9V probably benign Het
Ryr2 T C 13: 11,784,764 (GRCm39) H1063R probably benign Het
Samd14 C G 11: 94,914,426 (GRCm39) D361E probably damaging Het
Samd15 A T 12: 87,248,617 (GRCm39) N365I probably damaging Het
Sec16b A G 1: 157,358,882 (GRCm39) H105R probably benign Het
Sez6 T C 11: 77,844,329 (GRCm39) S51P probably benign Het
Sh3bp1 T A 15: 78,789,350 (GRCm39) L236Q probably damaging Het
Sspo C T 6: 48,434,274 (GRCm39) T991I probably damaging Het
Suco A T 1: 161,687,069 (GRCm39) L97* probably null Het
Tab1 C A 15: 80,032,497 (GRCm39) R35S probably benign Het
Tet3 C A 6: 83,381,145 (GRCm39) S341I possibly damaging Het
Tlr1 A T 5: 65,083,043 (GRCm39) D511E probably benign Het
Tmem132b A C 5: 125,862,963 (GRCm39) D656A probably damaging Het
Tmtc4 T A 14: 123,179,400 (GRCm39) probably null Het
Trmo T C 4: 46,380,158 (GRCm39) T404A probably damaging Het
Trpm1 A G 7: 63,880,016 (GRCm39) K790E probably damaging Het
Ulk4 C A 9: 120,997,250 (GRCm39) R774M probably null Het
Ush2a C T 1: 188,184,015 (GRCm39) L1440F probably benign Het
Usp16 A G 16: 87,277,795 (GRCm39) K682E probably damaging Het
Virma T C 4: 11,540,511 (GRCm39) S1471P probably benign Het
Vmn1r177 A T 7: 23,565,111 (GRCm39) I255N probably damaging Het
Vmn2r61 A T 7: 41,916,076 (GRCm39) R230* probably null Het
Vps13c T A 9: 67,900,295 (GRCm39) F3671L probably benign Het
Washc5 T C 15: 59,231,189 (GRCm39) N358S possibly damaging Het
Wdr72 A G 9: 74,058,899 (GRCm39) K331E probably damaging Het
Zfp986 A T 4: 145,625,805 (GRCm39) K155I probably benign Het
Other mutations in Ppp1r12c
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01124:Ppp1r12c APN 7 4,500,344 (GRCm39) splice site probably benign
IGL01419:Ppp1r12c APN 7 4,489,351 (GRCm39) splice site probably null
IGL02126:Ppp1r12c APN 7 4,492,858 (GRCm39) missense probably benign 0.43
IGL03388:Ppp1r12c APN 7 4,485,069 (GRCm39) unclassified probably benign
PIT4418001:Ppp1r12c UTSW 7 4,504,266 (GRCm39) missense probably null 0.09
R0523:Ppp1r12c UTSW 7 4,492,771 (GRCm39) missense probably damaging 1.00
R0815:Ppp1r12c UTSW 7 4,489,365 (GRCm39) missense probably damaging 1.00
R0863:Ppp1r12c UTSW 7 4,489,365 (GRCm39) missense probably damaging 1.00
R1413:Ppp1r12c UTSW 7 4,487,443 (GRCm39) splice site probably null
R1522:Ppp1r12c UTSW 7 4,500,424 (GRCm39) missense probably damaging 1.00
R2004:Ppp1r12c UTSW 7 4,485,974 (GRCm39) nonsense probably null
R2170:Ppp1r12c UTSW 7 4,485,805 (GRCm39) missense possibly damaging 0.76
R3787:Ppp1r12c UTSW 7 4,489,583 (GRCm39) missense probably damaging 1.00
R3833:Ppp1r12c UTSW 7 4,485,785 (GRCm39) unclassified probably benign
R4093:Ppp1r12c UTSW 7 4,486,366 (GRCm39) missense probably damaging 0.99
R4095:Ppp1r12c UTSW 7 4,486,366 (GRCm39) missense probably damaging 0.99
R4108:Ppp1r12c UTSW 7 4,489,565 (GRCm39) missense probably damaging 1.00
R5177:Ppp1r12c UTSW 7 4,487,495 (GRCm39) nonsense probably null
R5319:Ppp1r12c UTSW 7 4,486,983 (GRCm39) missense probably benign 0.01
R5561:Ppp1r12c UTSW 7 4,489,355 (GRCm39) critical splice donor site probably null
R5739:Ppp1r12c UTSW 7 4,500,281 (GRCm39) missense probably damaging 1.00
R5837:Ppp1r12c UTSW 7 4,500,403 (GRCm39) intron probably benign
R6531:Ppp1r12c UTSW 7 4,485,788 (GRCm39) critical splice donor site probably null
R7207:Ppp1r12c UTSW 7 4,492,867 (GRCm39) missense probably damaging 1.00
R7507:Ppp1r12c UTSW 7 4,486,970 (GRCm39) missense probably benign 0.01
R7920:Ppp1r12c UTSW 7 4,486,354 (GRCm39) missense probably benign 0.00
R7934:Ppp1r12c UTSW 7 4,488,416 (GRCm39) nonsense probably null
R8391:Ppp1r12c UTSW 7 4,500,431 (GRCm39) missense probably damaging 1.00
R8397:Ppp1r12c UTSW 7 4,492,768 (GRCm39) missense probably damaging 0.98
R8793:Ppp1r12c UTSW 7 4,485,887 (GRCm39) missense probably benign
R8851:Ppp1r12c UTSW 7 4,487,703 (GRCm39) missense probably damaging 1.00
R8974:Ppp1r12c UTSW 7 4,486,698 (GRCm39) missense probably damaging 1.00
R9114:Ppp1r12c UTSW 7 4,485,792 (GRCm39) missense possibly damaging 0.83
Z1177:Ppp1r12c UTSW 7 4,487,628 (GRCm39) missense probably benign 0.28
Predicted Primers PCR Primer
(F):5'- GTCCTGACAGAAAGGCACAG -3'
(R):5'- AGGATGTGCACCCTTCTATAGTG -3'

Sequencing Primer
(F):5'- TGCTCACCAGGCTGGGTAG -3'
(R):5'- ATGTGCACCCTTCTATAGTGTCATTC -3'
Posted On 2014-06-23