Mutagenetix > Incidental Mutation

Incidental Mutation 'R1835:Herc2'

205169

Institutional Source

Beutler Lab

Gene Symbol

Herc2

Ensembl Gene

ENSMUSG00000030451

Gene Name

HECT and RLD domain containing E3 ubiquitin protein ligase 2

Synonyms

D7H15F37S1, D7H15F32S1, rjs, jdf2, D15F32S1h

MMRRC Submission

039862-MU

Accession Numbers

Essential gene?

Probably essential (E-score: 0.932) question?

Stock #

R1835 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

56050196-56231800 bp(+) (GRCm38)

Type of Mutation

nonsense

DNA Base Change (assembly)

G to T at 56206765 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Glycine to Stop codon at position 3918 (G3918*)

Ref Sequence

ENSEMBL: ENSMUSP00000145997 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000076226] [ENSMUST00000164095] [ENSMUST00000205303]

AlphaFold

no structure available at present

Predicted Effect

probably null
Transcript: ENSMUST00000076226
AA Change: G3954*

SMART Domains

Protein: ENSMUSP00000075579
Gene: ENSMUSG00000030451
AA Change: G3954*

Domain	Start	End	E-Value	Type
low complexity region	73	87	N/A	INTRINSIC
low complexity region	164	175	N/A	INTRINSIC
low complexity region	198	212	N/A	INTRINSIC
low complexity region	272	281	N/A	INTRINSIC
low complexity region	304	317	N/A	INTRINSIC
Pfam:RCC1	514	567	7.6e-16	PFAM
Pfam:RCC1_2	554	583	6e-9	PFAM
Pfam:RCC1	570	615	7.1e-17	PFAM
Pfam:RCC1_2	606	637	6.9e-8	PFAM
Pfam:RCC1	624	673	7.2e-15	PFAM
Pfam:RCC1	676	725	3.3e-18	PFAM
Pfam:RCC1_2	712	740	1.6e-9	PFAM
low complexity region	854	866	N/A	INTRINSIC
low complexity region	902	913	N/A	INTRINSIC
coiled coil region	950	977	N/A	INTRINSIC
low complexity region	1052	1066	N/A	INTRINSIC
Cyt-b5	1211	1284	1.08e-1	SMART
low complexity region	1310	1316	N/A	INTRINSIC
low complexity region	1440	1446	N/A	INTRINSIC
low complexity region	1545	1563	N/A	INTRINSIC
coiled coil region	1651	1674	N/A	INTRINSIC
Pfam:MIB_HERC2	1871	1933	5.8e-29	PFAM
low complexity region	1939	1952	N/A	INTRINSIC
low complexity region	2211	2222	N/A	INTRINSIC
low complexity region	2381	2388	N/A	INTRINSIC
low complexity region	2402	2416	N/A	INTRINSIC
low complexity region	2521	2540	N/A	INTRINSIC
Pfam:Cul7	2555	2633	2.6e-43	PFAM
ZnF_ZZ	2703	2747	5.39e-11	SMART
APC10	2780	2933	5.1e-41	SMART
TECPR	2978	3019	7.59e0	SMART
Pfam:RCC1_2	3048	3079	9.2e-8	PFAM
Pfam:RCC1	3066	3115	3.7e-17	PFAM
Pfam:RCC1_2	3102	3131	3.9e-11	PFAM
Pfam:RCC1	3118	3162	1.9e-15	PFAM
Pfam:RCC1	3172	3221	9.6e-15	PFAM
Pfam:RCC1_2	3208	3236	2.2e-7	PFAM
TECPR	3241	3284	1.32e2	SMART
low complexity region	3357	3365	N/A	INTRINSIC
low complexity region	3430	3447	N/A	INTRINSIC
low complexity region	3480	3495	N/A	INTRINSIC
low complexity region	3755	3771	N/A	INTRINSIC
TECPR	3972	4012	2.41e1	SMART
Pfam:RCC1_2	4041	4072	5.1e-8	PFAM
Pfam:RCC1	4059	4108	1.5e-16	PFAM
Pfam:RCC1	4111	4155	7.9e-16	PFAM
TECPR	4184	4225	8.42e1	SMART
Pfam:RCC1_2	4253	4282	4.3e-10	PFAM
Pfam:RCC1	4269	4318	1.2e-17	PFAM
Blast:HECTc	4340	4425	6e-18	BLAST
HECTc	4455	4801	1.37e-62	SMART
low complexity region	4808	4828	N/A	INTRINSIC

Predicted Effect

probably null
Transcript: ENSMUST00000164095
AA Change: G3954*

SMART Domains

Protein: ENSMUSP00000131573
Gene: ENSMUSG00000030451
AA Change: G3954*

Domain	Start	End	E-Value	Type
low complexity region	73	87	N/A	INTRINSIC
low complexity region	164	175	N/A	INTRINSIC
low complexity region	198	212	N/A	INTRINSIC
low complexity region	272	281	N/A	INTRINSIC
low complexity region	304	317	N/A	INTRINSIC
Pfam:RCC1	514	567	2.9e-15	PFAM
Pfam:RCC1_2	554	583	1.6e-8	PFAM
Pfam:RCC1	570	615	2.3e-16	PFAM
Pfam:RCC1	624	673	1.2e-14	PFAM
Pfam:RCC1_2	660	689	2.1e-7	PFAM
Pfam:RCC1	676	725	9.8e-18	PFAM
Pfam:RCC1_2	712	740	1.1e-9	PFAM
low complexity region	854	866	N/A	INTRINSIC
low complexity region	902	913	N/A	INTRINSIC
coiled coil region	950	977	N/A	INTRINSIC
low complexity region	1052	1066	N/A	INTRINSIC
Cyt-b5	1211	1284	1.08e-1	SMART
low complexity region	1310	1316	N/A	INTRINSIC
low complexity region	1440	1446	N/A	INTRINSIC
low complexity region	1545	1563	N/A	INTRINSIC
coiled coil region	1651	1674	N/A	INTRINSIC
Pfam:MIB_HERC2	1871	1931	9.3e-25	PFAM
low complexity region	1939	1952	N/A	INTRINSIC
low complexity region	2211	2222	N/A	INTRINSIC
low complexity region	2381	2388	N/A	INTRINSIC
low complexity region	2402	2416	N/A	INTRINSIC
low complexity region	2521	2540	N/A	INTRINSIC
Pfam:Cul7	2555	2632	1.4e-39	PFAM
ZnF_ZZ	2703	2747	5.39e-11	SMART
APC10	2780	2933	5.1e-41	SMART
TECPR	2978	3019	7.59e0	SMART
Pfam:RCC1_2	3048	3079	1.6e-7	PFAM
Pfam:RCC1	3066	3115	7.1e-16	PFAM
Pfam:RCC1_2	3102	3131	7.1e-11	PFAM
Pfam:RCC1	3118	3163	1.2e-14	PFAM
Pfam:RCC1	3172	3221	4.7e-15	PFAM
TECPR	3241	3284	1.32e2	SMART
low complexity region	3357	3365	N/A	INTRINSIC
low complexity region	3430	3447	N/A	INTRINSIC
low complexity region	3480	3495	N/A	INTRINSIC
low complexity region	3755	3771	N/A	INTRINSIC
TECPR	3972	4012	2.41e1	SMART
Pfam:RCC1_2	4041	4072	1.2e-7	PFAM
Pfam:RCC1	4059	4108	9.6e-15	PFAM
Pfam:RCC1	4111	4156	5.6e-15	PFAM
TECPR	4184	4225	8.42e1	SMART
Pfam:RCC1_2	4253	4282	7.3e-10	PFAM
Pfam:RCC1	4269	4318	1.6e-16	PFAM
Blast:HECTc	4340	4425	6e-18	BLAST
HECTc	4455	4801	1.37e-62	SMART
low complexity region	4808	4828	N/A	INTRINSIC

Predicted Effect

probably null
Transcript: ENSMUST00000205303
AA Change: G3918*

Coding Region Coverage

1x: 97.4%
3x: 96.8%
10x: 94.9%
20x: 91.0%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene belongs to the HERC gene family that encodes a group of unusually large proteins, which contain multiple structural domains. All members have at least 1 copy of an N-terminal region showing homology to the cell cycle regulator RCC1 and a C-terminal HECT (homologous to E6-AP C terminus) domain found in a number of E3 ubiquitin protein ligases. Genetic variations in this gene are associated with skin/hair/eye pigmentation variability. Multiple pseudogenes of this gene are located on chromosomes 15 and 16. [provided by RefSeq, Mar 2012]
PHENOTYPE: Homozygotes for null mutations exhibit runting, nervousness, and incoordination. Males are sterile with sperm abnormalities, while females show reduced fertility and impaired maternal ability. Also see alleles at the Oca2 (p) locus for deletions that encompass the Herc2 gene. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 97 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2610507B11Rik	G	T	11: 78,287,750	V1993F	probably damaging	Het
4933425L06Rik	C	A	13: 105,082,194	A12E	unknown	Het
Acss2	T	A	2: 155,558,630	Y530N	probably damaging	Het
Adam4	T	C	12: 81,419,559	I763V	probably benign	Het
Aipl1	T	G	11: 72,030,499	K190T	possibly damaging	Het
Alms1	T	A	6: 85,678,503	S3344T	possibly damaging	Het
Alpi	A	G	1: 87,099,414	V381A	possibly damaging	Het
Ankfn1	A	T	11: 89,447,618	S365R	probably benign	Het
Aox2	G	A	1: 58,308,991	A623T	probably benign	Het
Apc	T	A	18: 34,317,077	L2308Q	probably damaging	Het
Atp9b	C	T	18: 80,778,883	V501I	probably benign	Het
Baz2b	T	C	2: 59,901,819	E1994G	probably benign	Het
Cacna1a	T	C	8: 84,581,357		probably null	Het
Cacna1h	C	A	17: 25,392,076	V583L	probably benign	Het
Cd55	T	C	1: 130,447,609		probably benign	Het
Cep192	T	A	18: 67,804,424	S75T	possibly damaging	Het
Cfap54	T	A	10: 92,962,375	D1674V	probably benign	Het
Churc1	T	C	12: 76,773,297	F27L	possibly damaging	Het
Coro1c	A	G	5: 113,848,543	I280T	probably benign	Het
Creb1	C	T	1: 64,550,950	Q32*	probably null	Het
Cyp2b9	A	G	7: 26,200,783	T339A	probably benign	Het
Dctn3	T	C	4: 41,720,813	R51G	probably damaging	Het
Ddb1	T	C	19: 10,626,593	V888A	probably damaging	Het
Disp1	A	G	1: 183,089,000	Y619H	probably damaging	Het
Dnajc9	T	C	14: 20,388,334	D96G	possibly damaging	Het
Eepd1	A	G	9: 25,482,868	T143A	possibly damaging	Het
Eps8	T	A	6: 137,522,279	K204*	probably null	Het
Ercc5	T	A	1: 44,180,875	S1102R	probably benign	Het
Ergic2	T	A	6: 148,189,581	Y211F	possibly damaging	Het
Fam135b	G	T	15: 71,490,711	L274M	probably damaging	Het
Fat3	G	A	9: 15,998,088	T2206I	probably damaging	Het
Fat4	A	G	3: 38,983,571	I3791V	probably benign	Het
Gemin4	A	G	11: 76,213,296	M213T	possibly damaging	Het
Gnai3	T	C	3: 108,118,407	M119V	probably benign	Het
Heatr5b	A	T	17: 78,773,563	L1420Q	probably damaging	Het
Ints9	A	G	14: 65,032,256	Y465C	probably damaging	Het
Ist1	A	G	8: 109,678,883	V175A	probably damaging	Het
Kcnj12	T	C	11: 61,069,557	L227P	possibly damaging	Het
Kcnq5	T	C	1: 21,466,387	S416G	probably benign	Het
Kdm3a	T	A	6: 71,613,956	T295S	probably benign	Het
Kif1c	T	A	11: 70,708,971	M479K	probably damaging	Het
Kif20b	T	C	19: 34,956,038	L83P	probably damaging	Het
Kndc1	A	G	7: 139,927,711	E1194G	probably damaging	Het
Llgl1	A	G	11: 60,704,730	M81V	probably benign	Het
Map4k5	C	A	12: 69,824,662	M495I	probably damaging	Het
Mest	C	T	6: 30,742,791	R146C	probably benign	Het
Mettl24	T	A	10: 40,737,816		probably null	Het
Mical1	T	C	10: 41,483,535	S586P	probably benign	Het
Mrgpra3	G	T	7: 47,589,946	Y77*	probably null	Het
Mss51	A	T	14: 20,483,178	C408*	probably null	Het
Myh6	T	C	14: 54,957,401	T666A	probably benign	Het
Myo10	T	C	15: 25,805,587	C1685R	possibly damaging	Het
Naip5	A	T	13: 100,223,218	Y503*	probably null	Het
Neil1	A	C	9: 57,146,604	F144C	probably damaging	Het
Nipbl	T	A	15: 8,343,517	I1082F	possibly damaging	Het
Nkiras1	T	C	14: 18,276,732	V7A	probably damaging	Het
Ntng2	G	A	2: 29,197,057	Q384*	probably null	Het
Ocrl	T	A	X: 47,962,116	I74N	probably damaging	Het
Olfr137	A	T	17: 38,305,312	S50T	probably benign	Het
Olfr1385	A	T	11: 49,494,670	I46F	probably damaging	Het
Olfr1408	A	G	1: 173,130,815	V134A	probably benign	Het
Olfr381	A	C	11: 73,486,374	V150G	probably benign	Het
Olfr535	A	G	7: 140,492,709	S24G	probably benign	Het
Olfr761	C	T	17: 37,952,385	G213E	possibly damaging	Het
Patj	A	G	4: 98,491,590	D151G	probably benign	Het
Plpbp	T	C	8: 27,049,231	V126A	probably damaging	Het
Pold2	A	G	11: 5,873,454	L325P	possibly damaging	Het
Ppp1r12c	A	C	7: 4,483,651	S480A	probably damaging	Het
Pum1	T	C	4: 130,701,048	S124P	possibly damaging	Het
Pwp2	C	G	10: 78,179,091	G353A	probably damaging	Het
Reln	C	A	5: 21,979,002	Q1666H	probably damaging	Het
Rnf19a	T	C	15: 36,265,925	I9V	probably benign	Het
Ryr2	T	C	13: 11,769,878	H1063R	probably benign	Het
Samd14	C	G	11: 95,023,600	D361E	probably damaging	Het
Samd15	A	T	12: 87,201,843	N365I	probably damaging	Het
Sec16b	A	G	1: 157,531,312	H105R	probably benign	Het
Sez6	T	C	11: 77,953,503	S51P	probably benign	Het
Sh3bp1	T	A	15: 78,905,150	L236Q	probably damaging	Het
Sspo	C	T	6: 48,457,340	T991I	probably damaging	Het
Suco	A	T	1: 161,859,500	L97*	probably null	Het
Tab1	C	A	15: 80,148,296	R35S	probably benign	Het
Tet3	C	A	6: 83,404,163	S341I	possibly damaging	Het
Tlr1	A	T	5: 64,925,700	D511E	probably benign	Het
Tmem132b	A	C	5: 125,785,899	D656A	probably damaging	Het
Tmtc4	T	A	14: 122,941,988		probably null	Het
Trmo	T	C	4: 46,380,158	T404A	probably damaging	Het
Trpm1	A	G	7: 64,230,268	K790E	probably damaging	Het
Ulk4	C	A	9: 121,168,184	R774M	probably null	Het
Ush2a	C	T	1: 188,451,818	L1440F	probably benign	Het
Usp16	A	G	16: 87,480,907	K682E	probably damaging	Het
Virma	T	C	4: 11,540,511	S1471P	probably benign	Het
Vmn1r177	A	T	7: 23,865,686	I255N	probably damaging	Het
Vmn2r61	A	T	7: 42,266,652	R230*	probably null	Het
Vps13c	T	A	9: 67,993,013	F3671L	probably benign	Het
Washc5	T	C	15: 59,359,340	N358S	possibly damaging	Het
Wdr72	A	G	9: 74,151,617	K331E	probably damaging	Het
Zfp986	A	T	4: 145,899,235	K155I	probably benign	Het

Other mutations in Herc2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00329:Herc2	APN	7	56124299	missense	probably damaging	1.00
IGL00529:Herc2	APN	7	56157753	missense	probably benign
IGL00548:Herc2	APN	7	56206565	missense	probably benign	0.20
IGL00970:Herc2	APN	7	56181064	splice site	probably benign
IGL01141:Herc2	APN	7	56212841	missense	possibly damaging	0.47
IGL01147:Herc2	APN	7	56156949	missense	probably benign	0.43
IGL01150:Herc2	APN	7	56181133	missense	probably damaging	1.00
IGL01519:Herc2	APN	7	56103950	missense	probably damaging	1.00
IGL01576:Herc2	APN	7	56226661	critical splice donor site	probably null
IGL01626:Herc2	APN	7	56085142	missense	probably benign	0.02
IGL01658:Herc2	APN	7	56159452	missense	probably damaging	1.00
IGL01707:Herc2	APN	7	56165187	missense	probably damaging	1.00
IGL01727:Herc2	APN	7	56137806	missense	probably damaging	1.00
IGL01935:Herc2	APN	7	56153793	missense	probably benign
IGL01969:Herc2	APN	7	56185831	splice site	probably benign
IGL02074:Herc2	APN	7	56087444	splice site	probably benign
IGL02261:Herc2	APN	7	56206744	missense	probably damaging	0.99
IGL02339:Herc2	APN	7	56121722	missense	probably benign	0.01
IGL02353:Herc2	APN	7	56114812	missense	probably damaging	1.00
IGL02360:Herc2	APN	7	56114812	missense	probably damaging	1.00
IGL02409:Herc2	APN	7	56220469	splice site	probably null
IGL02528:Herc2	APN	7	56108893	splice site	probably benign
IGL02571:Herc2	APN	7	56153386	missense	probably damaging	1.00
IGL02578:Herc2	APN	7	56106535	splice site	probably null
IGL02661:Herc2	APN	7	56113073	missense	probably damaging	1.00
IGL02664:Herc2	APN	7	56135678	nonsense	probably null
IGL02675:Herc2	APN	7	56164101	missense	probably damaging	0.99
IGL02689:Herc2	APN	7	56165283	splice site	probably benign
IGL02710:Herc2	APN	7	56137814	missense	possibly damaging	0.95
IGL02750:Herc2	APN	7	56204379	splice site	probably benign
IGL02754:Herc2	APN	7	56097498	missense	probably damaging	1.00
IGL03029:Herc2	APN	7	56168967	missense	probably damaging	1.00
IGL03039:Herc2	APN	7	56169021	splice site	probably benign
IGL03082:Herc2	APN	7	56185923	missense	probably benign	0.19
IGL03090:Herc2	APN	7	56204473	missense	probably damaging	0.96
IGL03154:Herc2	APN	7	56202159	missense	probably damaging	1.00
IGL03165:Herc2	APN	7	56191912	missense	probably damaging	1.00
IGL03201:Herc2	APN	7	56219768	missense	probably damaging	1.00
IGL03234:Herc2	APN	7	56103862	missense	probably damaging	1.00
IGL03293:Herc2	APN	7	56155130	missense	probably benign	0.43
IGL03331:Herc2	APN	7	56135267	splice site	probably benign
IGL03340:Herc2	APN	7	56090920	missense	possibly damaging	0.51
IGL03409:Herc2	APN	7	56228569	missense	probably damaging	1.00
alarmed	UTSW	7	56229662	missense	possibly damaging	0.92
hyper	UTSW	7	56159417	missense	probably damaging	1.00
R0798_herc2_487	UTSW	7	56135683	critical splice donor site	probably null
R1370_Herc2_948	UTSW	7	56168873	missense	probably benign	0.01
R2030_Herc2_144	UTSW	7	56184373	missense	probably damaging	0.99
uptight	UTSW	7	56113210	missense	probably damaging	1.00
I0000:Herc2	UTSW	7	56136729	splice site	probably benign
PIT1430001:Herc2	UTSW	7	56226954	missense	probably damaging	1.00
R0009:Herc2	UTSW	7	56207812	missense	probably benign	0.03
R0009:Herc2	UTSW	7	56207812	missense	probably benign	0.03
R0058:Herc2	UTSW	7	56170483	missense	possibly damaging	0.93
R0114:Herc2	UTSW	7	56153774	splice site	probably benign
R0117:Herc2	UTSW	7	56213611	splice site	probably benign
R0141:Herc2	UTSW	7	56121561	missense	probably benign	0.17
R0266:Herc2	UTSW	7	56206578	missense	probably damaging	1.00
R0401:Herc2	UTSW	7	56157732	missense	probably damaging	0.99
R0403:Herc2	UTSW	7	56159417	missense	probably damaging	1.00
R0437:Herc2	UTSW	7	56219815	nonsense	probably null
R0491:Herc2	UTSW	7	56122366	missense	possibly damaging	0.54
R0499:Herc2	UTSW	7	56184369	nonsense	probably null
R0580:Herc2	UTSW	7	56138791	missense	probably damaging	1.00
R0650:Herc2	UTSW	7	56113210	missense	probably damaging	1.00
R0744:Herc2	UTSW	7	56206036	splice site	probably benign
R0798:Herc2	UTSW	7	56135683	critical splice donor site	probably null
R0842:Herc2	UTSW	7	56121705	missense	probably benign
R0849:Herc2	UTSW	7	56206578	missense	probably damaging	1.00
R0850:Herc2	UTSW	7	56204483	missense	probably benign	0.09
R0926:Herc2	UTSW	7	56132548	missense	possibly damaging	0.67
R1146:Herc2	UTSW	7	56146696	missense	probably benign
R1146:Herc2	UTSW	7	56146696	missense	probably benign
R1292:Herc2	UTSW	7	56197203	missense	probably benign	0.05
R1370:Herc2	UTSW	7	56168873	missense	probably benign	0.01
R1443:Herc2	UTSW	7	56204733	missense	possibly damaging	0.69
R1445:Herc2	UTSW	7	56168996	missense	probably damaging	1.00
R1541:Herc2	UTSW	7	56135657	missense	probably damaging	1.00
R1550:Herc2	UTSW	7	56135658	missense	probably damaging	1.00
R1551:Herc2	UTSW	7	56146669	missense	probably benign	0.01
R1633:Herc2	UTSW	7	56229369	missense	probably null	1.00
R1635:Herc2	UTSW	7	56136667	missense	probably benign	0.00
R1659:Herc2	UTSW	7	56135105	missense	probably benign	0.00
R1682:Herc2	UTSW	7	56088400	missense	possibly damaging	0.87
R1697:Herc2	UTSW	7	56153905	missense	probably benign	0.43
R1748:Herc2	UTSW	7	56148823	critical splice donor site	probably null
R1802:Herc2	UTSW	7	56184332	missense	probably damaging	1.00
R1836:Herc2	UTSW	7	56155105	nonsense	probably null
R1872:Herc2	UTSW	7	56157509	missense	probably benign	0.18
R1889:Herc2	UTSW	7	56189813	missense	possibly damaging	0.60
R1906:Herc2	UTSW	7	56114864	missense	probably benign	0.01
R2004:Herc2	UTSW	7	56137859	missense	probably damaging	1.00
R2030:Herc2	UTSW	7	56184373	missense	probably damaging	0.99
R2037:Herc2	UTSW	7	56205961	missense	probably damaging	1.00
R2059:Herc2	UTSW	7	56163897	missense	probably damaging	1.00
R2068:Herc2	UTSW	7	56132497	missense	probably damaging	1.00
R2072:Herc2	UTSW	7	56226964	missense	probably damaging	1.00
R2085:Herc2	UTSW	7	56212965	missense	possibly damaging	0.94
R2115:Herc2	UTSW	7	56185828	splice site	probably benign
R2160:Herc2	UTSW	7	56212922	missense	probably benign	0.00
R2173:Herc2	UTSW	7	56185951	missense	probably benign	0.27
R2221:Herc2	UTSW	7	56169018	critical splice donor site	probably null
R2280:Herc2	UTSW	7	56137271	missense	possibly damaging	0.79
R3078:Herc2	UTSW	7	56137243	missense	probably benign
R3104:Herc2	UTSW	7	56135355	missense	probably benign	0.23
R3177:Herc2	UTSW	7	56153428	missense	probably benign	0.00
R3277:Herc2	UTSW	7	56153428	missense	probably benign	0.00
R3766:Herc2	UTSW	7	56163824	missense	probably damaging	1.00
R3770:Herc2	UTSW	7	56165007	missense	probably benign
R3807:Herc2	UTSW	7	56207809	missense	probably damaging	1.00
R3912:Herc2	UTSW	7	56098437	missense	probably damaging	0.98
R4004:Herc2	UTSW	7	56106465	missense	possibly damaging	0.53
R4039:Herc2	UTSW	7	56156411	missense	probably damaging	0.98
R4190:Herc2	UTSW	7	56122448	missense	probably benign	0.03
R4225:Herc2	UTSW	7	56164987	missense	probably damaging	1.00
R4334:Herc2	UTSW	7	56226654	missense	probably damaging	1.00
R4405:Herc2	UTSW	7	56170477	missense	probably damaging	1.00
R4448:Herc2	UTSW	7	56227892	missense	probably damaging	1.00
R4450:Herc2	UTSW	7	56227892	missense	probably damaging	1.00
R4565:Herc2	UTSW	7	56153838	missense	possibly damaging	0.71
R4667:Herc2	UTSW	7	56131253	missense	probably damaging	1.00
R4747:Herc2	UTSW	7	56106393	missense	possibly damaging	0.80
R4762:Herc2	UTSW	7	56170640	missense	probably benign	0.19
R4829:Herc2	UTSW	7	56106492	missense	probably benign	0.39
R4832:Herc2	UTSW	7	56098417	nonsense	probably null
R4895:Herc2	UTSW	7	56222986	missense	probably damaging	1.00
R4904:Herc2	UTSW	7	56157486	missense	probably damaging	0.99
R4908:Herc2	UTSW	7	56177912	missense	probably benign	0.01
R4911:Herc2	UTSW	7	56227892	missense	probably damaging	1.00
R4921:Herc2	UTSW	7	56229690	missense	probably benign	0.04
R4939:Herc2	UTSW	7	56206736	missense	probably damaging	1.00
R5155:Herc2	UTSW	7	56227826	missense	possibly damaging	0.85
R5184:Herc2	UTSW	7	56122351	missense	probably damaging	1.00
R5269:Herc2	UTSW	7	56168870	nonsense	probably null
R5306:Herc2	UTSW	7	56184961	missense	probably damaging	1.00
R5314:Herc2	UTSW	7	56219786	missense	probably damaging	0.99
R5369:Herc2	UTSW	7	56182700	missense	probably damaging	1.00
R5418:Herc2	UTSW	7	56137565	missense	probably damaging	1.00
R5420:Herc2	UTSW	7	56203830	missense	probably damaging	0.96
R5463:Herc2	UTSW	7	56194262	missense	probably damaging	1.00
R5510:Herc2	UTSW	7	56206771	missense	probably damaging	1.00
R5634:Herc2	UTSW	7	56206783	missense	probably damaging	1.00
R5638:Herc2	UTSW	7	56204416	missense	probably benign	0.01
R5690:Herc2	UTSW	7	56157705	missense	probably benign
R5762:Herc2	UTSW	7	56197190	missense	possibly damaging	0.68
R5807:Herc2	UTSW	7	56230919	missense	probably damaging	0.99
R5878:Herc2	UTSW	7	56124248	missense	probably benign
R6036:Herc2	UTSW	7	56068053	missense	probably benign	0.01
R6036:Herc2	UTSW	7	56068053	missense	probably benign	0.01
R6083:Herc2	UTSW	7	56228505	missense	probably benign	0.00
R6192:Herc2	UTSW	7	56207762	missense	probably damaging	1.00
R6193:Herc2	UTSW	7	56156901	missense	probably damaging	0.98
R6261:Herc2	UTSW	7	56197072	nonsense	probably null
R6267:Herc2	UTSW	7	56153166	nonsense	probably null
R6267:Herc2	UTSW	7	56204718	missense	possibly damaging	0.51
R6298:Herc2	UTSW	7	56191265	missense	probably benign
R6299:Herc2	UTSW	7	56135055	missense	possibly damaging	0.47
R6326:Herc2	UTSW	7	56222934	missense	probably damaging	0.98
R6347:Herc2	UTSW	7	56194403	critical splice donor site	probably null
R6394:Herc2	UTSW	7	56215981	missense	probably damaging	1.00
R6500:Herc2	UTSW	7	56146645	nonsense	probably null
R6526:Herc2	UTSW	7	56157330	missense	probably damaging	0.99
R6592:Herc2	UTSW	7	56207690	critical splice acceptor site	probably null
R6619:Herc2	UTSW	7	56068092	nonsense	probably null
R6719:Herc2	UTSW	7	56212826	missense	probably damaging	1.00
R6750:Herc2	UTSW	7	56097447	missense	probably damaging	1.00
R6807:Herc2	UTSW	7	56164922	missense	probably damaging	1.00
R6811:Herc2	UTSW	7	56113433	nonsense	probably null
R6837:Herc2	UTSW	7	56189841	missense	possibly damaging	0.89
R6838:Herc2	UTSW	7	56108778	missense	probably damaging	1.00
R6902:Herc2	UTSW	7	56135486	missense	probably benign	0.37
R6983:Herc2	UTSW	7	56106453	missense	possibly damaging	0.74
R6985:Herc2	UTSW	7	56106453	missense	possibly damaging	0.74
R6985:Herc2	UTSW	7	56132480	missense	probably damaging	1.00
R6986:Herc2	UTSW	7	56106453	missense	possibly damaging	0.74
R6987:Herc2	UTSW	7	56106453	missense	possibly damaging	0.74
R7113:Herc2	UTSW	7	56203849	missense	probably damaging	0.99
R7173:Herc2	UTSW	7	56203827	missense	probably damaging	1.00
R7202:Herc2	UTSW	7	56131286	missense	probably damaging	0.99
R7205:Herc2	UTSW	7	56182640	missense	probably damaging	1.00
R7236:Herc2	UTSW	7	56085080	missense	probably benign	0.29
R7297:Herc2	UTSW	7	56136658	missense	probably benign	0.00
R7358:Herc2	UTSW	7	56182675	missense	possibly damaging	0.48
R7438:Herc2	UTSW	7	56103718	splice site	probably null
R7537:Herc2	UTSW	7	56219779	nonsense	probably null
R7578:Herc2	UTSW	7	56134800	missense	probably benign	0.07
R7614:Herc2	UTSW	7	56153275	nonsense	probably null
R7638:Herc2	UTSW	7	56157438	missense	probably benign	0.26
R7638:Herc2	UTSW	7	56220525	missense	probably damaging	1.00
R7646:Herc2	UTSW	7	56134613	missense	probably benign
R7663:Herc2	UTSW	7	56136685	missense	probably benign
R7665:Herc2	UTSW	7	56153155	missense	probably damaging	1.00
R7691:Herc2	UTSW	7	56191845	missense	probably benign
R7733:Herc2	UTSW	7	56188664	missense	probably damaging	0.99
R7767:Herc2	UTSW	7	56228527	missense	probably benign	0.39
R7802:Herc2	UTSW	7	56164090	missense	probably damaging	1.00
R7847:Herc2	UTSW	7	56157560	critical splice donor site	probably null
R7956:Herc2	UTSW	7	56113400	missense	probably damaging	0.97
R7985:Herc2	UTSW	7	56165244	missense	probably benign
R8003:Herc2	UTSW	7	56168904	missense	possibly damaging	0.94
R8045:Herc2	UTSW	7	56184900	missense	probably damaging	1.00
R8085:Herc2	UTSW	7	56229679	missense	probably benign	0.01
R8134:Herc2	UTSW	7	56085136	missense	probably benign	0.10
R8259:Herc2	UTSW	7	56205890	missense	probably damaging	0.99
R8286:Herc2	UTSW	7	56229662	missense	possibly damaging	0.92
R8304:Herc2	UTSW	7	56159438	missense	probably damaging	1.00
R8321:Herc2	UTSW	7	56229348	missense	possibly damaging	0.84
R8332:Herc2	UTSW	7	56146595	missense	probably damaging	1.00
R8432:Herc2	UTSW	7	56155112	missense	probably benign	0.14
R8516:Herc2	UTSW	7	56206570	missense	probably benign	0.05
R8676:Herc2	UTSW	7	56188613	missense	probably damaging	1.00
R8738:Herc2	UTSW	7	56148654	missense	possibly damaging	0.78
R8742:Herc2	UTSW	7	56094395	missense	probably benign	0.12
R8796:Herc2	UTSW	7	56135375	missense	probably benign	0.01
R8825:Herc2	UTSW	7	56050878	start codon destroyed	probably null	0.01
R8826:Herc2	UTSW	7	56106396	missense	probably benign	0.12
R8842:Herc2	UTSW	7	56088311	missense	probably damaging	0.99
R9103:Herc2	UTSW	7	56135055	missense	possibly damaging	0.47
R9124:Herc2	UTSW	7	56184308	missense	probably damaging	1.00
R9134:Herc2	UTSW	7	56182429	missense	probably damaging	0.99
R9168:Herc2	UTSW	7	56152460	missense	probably damaging	0.99
R9173:Herc2	UTSW	7	56206602	missense	probably damaging	0.97
R9238:Herc2	UTSW	7	56163760	missense	probably damaging	0.98
R9249:Herc2	UTSW	7	56113142	missense	probably damaging	1.00
R9344:Herc2	UTSW	7	56122364	missense	probably benign	0.07
R9432:Herc2	UTSW	7	56131184	missense	probably damaging	1.00
R9472:Herc2	UTSW	7	56164095	missense	probably damaging	1.00
R9513:Herc2	UTSW	7	56113100	missense	probably damaging	1.00
R9579:Herc2	UTSW	7	56108752	missense	probably damaging	0.99
R9596:Herc2	UTSW	7	56184847	missense
R9664:Herc2	UTSW	7	56170590	missense	possibly damaging	0.90
R9760:Herc2	UTSW	7	56163911	critical splice donor site	probably null
R9781:Herc2	UTSW	7	56100348	missense	possibly damaging	0.53
RF024:Herc2	UTSW	7	56226525	missense	probably damaging	1.00
X0011:Herc2	UTSW	7	56131292	missense	probably benign
X0023:Herc2	UTSW	7	56090918	missense	possibly damaging	0.73
X0057:Herc2	UTSW	7	56229690	missense	probably benign	0.04
X0064:Herc2	UTSW	7	56191211	missense	probably benign	0.01
X0064:Herc2	UTSW	7	56191258	missense	probably benign
Z1088:Herc2	UTSW	7	56131292	missense	probably benign
Z1088:Herc2	UTSW	7	56215381	missense	possibly damaging	0.86
Z1088:Herc2	UTSW	7	56215432	missense	probably damaging	1.00
Z1088:Herc2	UTSW	7	56226589	missense	probably damaging	1.00
Z1088:Herc2	UTSW	7	56087341	missense	probably benign	0.00
Z1176:Herc2	UTSW	7	56097533	missense	possibly damaging	0.48
Z1176:Herc2	UTSW	7	56131292	missense	probably benign
Z1176:Herc2	UTSW	7	56132498	missense	probably damaging	1.00
Z1177:Herc2	UTSW	7	56121589	missense	possibly damaging	0.55
Z1177:Herc2	UTSW	7	56131292	missense	probably benign

Predicted Primers

PCR Primer
(F):5'- GTTCTCCATGAAAGCCACAGC -3'
(R):5'- GGCGCTACCATAATCATTCTTCAG -3'

Sequencing Primer
(F):5'- GCCACAGCATCTTTAAAAGAGAG -3'
(R):5'- ACCCTAATGAAGCATATCTCTGTC -3'

Posted On

2014-06-23