Incidental Mutation 'R1835:Plpbp'
ID 205173
Institutional Source Beutler Lab
Gene Symbol Plpbp
Ensembl Gene ENSMUSG00000031485
Gene Name pyridoxal phosphate binding protein
Synonyms 2200002F22Rik, Prosc
MMRRC Submission 039862-MU
Accession Numbers
Essential gene? Probably essential (E-score: 0.794) question?
Stock # R1835 (G1)
Quality Score 225
Status Not validated
Chromosome 8
Chromosomal Location 27532583-27546160 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 27539259 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Valine to Alanine at position 126 (V126A)
Ref Sequence ENSEMBL: ENSMUSP00000147943 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000033875] [ENSMUST00000098851] [ENSMUST00000209525] [ENSMUST00000209856]
AlphaFold Q9Z2Y8
Predicted Effect probably damaging
Transcript: ENSMUST00000033875
AA Change: V126A

PolyPhen 2 Score 0.980 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000033875
Gene: ENSMUSG00000031485
AA Change: V126A

DomainStartEndE-ValueType
Pfam:Ala_racemase_N 16 251 5.4e-25 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000098851
AA Change: V114A

PolyPhen 2 Score 0.988 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000096450
Gene: ENSMUSG00000031485
AA Change: V114A

DomainStartEndE-ValueType
Pfam:Ala_racemase_N 15 138 2e-13 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000209525
AA Change: V126A

PolyPhen 2 Score 0.990 (Sensitivity: 0.72; Specificity: 0.97)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000209555
Predicted Effect probably benign
Transcript: ENSMUST00000209856
Predicted Effect probably benign
Transcript: ENSMUST00000210141
Predicted Effect unknown
Transcript: ENSMUST00000211518
AA Change: V117A
Predicted Effect unknown
Transcript: ENSMUST00000211393
AA Change: V123A
Predicted Effect unknown
Transcript: ENSMUST00000210765
AA Change: V54A
Predicted Effect noncoding transcript
Transcript: ENSMUST00000211012
Predicted Effect noncoding transcript
Transcript: ENSMUST00000211756
Predicted Effect noncoding transcript
Transcript: ENSMUST00000210225
Predicted Effect noncoding transcript
Transcript: ENSMUST00000211281
Predicted Effect noncoding transcript
Transcript: ENSMUST00000211490
Coding Region Coverage
  • 1x: 97.4%
  • 3x: 96.8%
  • 10x: 94.9%
  • 20x: 91.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a pyridoxal 5'-phosphate binding protein involved in the homeostatic regulation of intracellular pyridoxal 5'-phosphate. This gene has a tumor suppressive effect on hepatocellular carcinoma and other solid tumors of epithelial origin. Naturally occurring mutations in this gene are associated with a pyridoxine-dependent epilepsy. [provided by RefSeq, Mar 2017]
Allele List at MGI
Other mutations in this stock
Total: 97 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acss2 T A 2: 155,400,550 (GRCm39) Y530N probably damaging Het
Adam4 T C 12: 81,466,333 (GRCm39) I763V probably benign Het
Aipl1 T G 11: 71,921,325 (GRCm39) K190T possibly damaging Het
Alms1 T A 6: 85,655,485 (GRCm39) S3344T possibly damaging Het
Alpi A G 1: 87,027,136 (GRCm39) V381A possibly damaging Het
Ankfn1 A T 11: 89,338,444 (GRCm39) S365R probably benign Het
Aox1 G A 1: 58,348,150 (GRCm39) A623T probably benign Het
Apc T A 18: 34,450,130 (GRCm39) L2308Q probably damaging Het
Atp9b C T 18: 80,822,098 (GRCm39) V501I probably benign Het
Baz2b T C 2: 59,732,163 (GRCm39) E1994G probably benign Het
Bltp2 G T 11: 78,178,576 (GRCm39) V1993F probably damaging Het
Cacna1a T C 8: 85,307,986 (GRCm39) probably null Het
Cacna1h C A 17: 25,611,050 (GRCm39) V583L probably benign Het
Cd55 T C 1: 130,375,346 (GRCm39) probably benign Het
Cep192 T A 18: 67,937,494 (GRCm39) S75T possibly damaging Het
Cfap54 T A 10: 92,798,237 (GRCm39) D1674V probably benign Het
Churc1 T C 12: 76,820,071 (GRCm39) F27L possibly damaging Het
Coro1c A G 5: 113,986,604 (GRCm39) I280T probably benign Het
Creb1 C T 1: 64,590,109 (GRCm39) Q32* probably null Het
Cyp2b9 A G 7: 25,900,208 (GRCm39) T339A probably benign Het
Dctn3 T C 4: 41,720,813 (GRCm39) R51G probably damaging Het
Ddb1 T C 19: 10,603,957 (GRCm39) V888A probably damaging Het
Disp1 A G 1: 182,870,564 (GRCm39) Y619H probably damaging Het
Dnajc9 T C 14: 20,438,402 (GRCm39) D96G possibly damaging Het
Eepd1 A G 9: 25,394,164 (GRCm39) T143A possibly damaging Het
Eps8 T A 6: 137,499,277 (GRCm39) K204* probably null Het
Ercc5 T A 1: 44,220,035 (GRCm39) S1102R probably benign Het
Ergic2 T A 6: 148,091,079 (GRCm39) Y211F possibly damaging Het
Fam135b G T 15: 71,362,560 (GRCm39) L274M probably damaging Het
Fat3 G A 9: 15,909,384 (GRCm39) T2206I probably damaging Het
Fat4 A G 3: 39,037,720 (GRCm39) I3791V probably benign Het
Gemin4 A G 11: 76,104,122 (GRCm39) M213T possibly damaging Het
Gnai3 T C 3: 108,025,723 (GRCm39) M119V probably benign Het
Heatr5b A T 17: 79,080,992 (GRCm39) L1420Q probably damaging Het
Herc2 G T 7: 55,856,513 (GRCm39) G3918* probably null Het
Ints9 A G 14: 65,269,705 (GRCm39) Y465C probably damaging Het
Ist1 A G 8: 110,405,515 (GRCm39) V175A probably damaging Het
Kcnj12 T C 11: 60,960,383 (GRCm39) L227P possibly damaging Het
Kcnq5 T C 1: 21,536,611 (GRCm39) S416G probably benign Het
Kdm3a T A 6: 71,590,940 (GRCm39) T295S probably benign Het
Kif1c T A 11: 70,599,797 (GRCm39) M479K probably damaging Het
Kif20b T C 19: 34,933,438 (GRCm39) L83P probably damaging Het
Kndc1 A G 7: 139,507,624 (GRCm39) E1194G probably damaging Het
Llgl1 A G 11: 60,595,556 (GRCm39) M81V probably benign Het
Map4k5 C A 12: 69,871,436 (GRCm39) M495I probably damaging Het
Mest C T 6: 30,742,790 (GRCm39) R146C probably benign Het
Mettl24 T A 10: 40,613,812 (GRCm39) probably null Het
Mical1 T C 10: 41,359,531 (GRCm39) S586P probably benign Het
Mrgpra3 G T 7: 47,239,694 (GRCm39) Y77* probably null Het
Mss51 A T 14: 20,533,246 (GRCm39) C408* probably null Het
Myh6 T C 14: 55,194,858 (GRCm39) T666A probably benign Het
Myo10 T C 15: 25,805,673 (GRCm39) C1685R possibly damaging Het
Naip5 A T 13: 100,359,726 (GRCm39) Y503* probably null Het
Neil1 A C 9: 57,053,888 (GRCm39) F144C probably damaging Het
Nipbl T A 15: 8,373,001 (GRCm39) I1082F possibly damaging Het
Nkiras1 T C 14: 18,276,732 (GRCm38) V7A probably damaging Het
Nt5el C A 13: 105,218,702 (GRCm39) A12E unknown Het
Ntng2 G A 2: 29,087,069 (GRCm39) Q384* probably null Het
Ocrl T A X: 47,050,993 (GRCm39) I74N probably damaging Het
Or10j27 A G 1: 172,958,382 (GRCm39) V134A probably benign Het
Or13a22 A G 7: 140,072,622 (GRCm39) S24G probably benign Het
Or14j8 C T 17: 38,263,276 (GRCm39) G213E possibly damaging Het
Or1e22 A C 11: 73,377,200 (GRCm39) V150G probably benign Het
Or2j3 A T 17: 38,616,203 (GRCm39) S50T probably benign Het
Or2y1 A T 11: 49,385,497 (GRCm39) I46F probably damaging Het
Patj A G 4: 98,379,827 (GRCm39) D151G probably benign Het
Pold2 A G 11: 5,823,454 (GRCm39) L325P possibly damaging Het
Ppp1r12c A C 7: 4,486,650 (GRCm39) S480A probably damaging Het
Pum1 T C 4: 130,428,359 (GRCm39) S124P possibly damaging Het
Pwp2 C G 10: 78,014,925 (GRCm39) G353A probably damaging Het
Reln C A 5: 22,184,000 (GRCm39) Q1666H probably damaging Het
Rnf19a T C 15: 36,266,071 (GRCm39) I9V probably benign Het
Ryr2 T C 13: 11,784,764 (GRCm39) H1063R probably benign Het
Samd14 C G 11: 94,914,426 (GRCm39) D361E probably damaging Het
Samd15 A T 12: 87,248,617 (GRCm39) N365I probably damaging Het
Sec16b A G 1: 157,358,882 (GRCm39) H105R probably benign Het
Sez6 T C 11: 77,844,329 (GRCm39) S51P probably benign Het
Sh3bp1 T A 15: 78,789,350 (GRCm39) L236Q probably damaging Het
Sspo C T 6: 48,434,274 (GRCm39) T991I probably damaging Het
Suco A T 1: 161,687,069 (GRCm39) L97* probably null Het
Tab1 C A 15: 80,032,497 (GRCm39) R35S probably benign Het
Tet3 C A 6: 83,381,145 (GRCm39) S341I possibly damaging Het
Tlr1 A T 5: 65,083,043 (GRCm39) D511E probably benign Het
Tmem132b A C 5: 125,862,963 (GRCm39) D656A probably damaging Het
Tmtc4 T A 14: 123,179,400 (GRCm39) probably null Het
Trmo T C 4: 46,380,158 (GRCm39) T404A probably damaging Het
Trpm1 A G 7: 63,880,016 (GRCm39) K790E probably damaging Het
Ulk4 C A 9: 120,997,250 (GRCm39) R774M probably null Het
Ush2a C T 1: 188,184,015 (GRCm39) L1440F probably benign Het
Usp16 A G 16: 87,277,795 (GRCm39) K682E probably damaging Het
Virma T C 4: 11,540,511 (GRCm39) S1471P probably benign Het
Vmn1r177 A T 7: 23,565,111 (GRCm39) I255N probably damaging Het
Vmn2r61 A T 7: 41,916,076 (GRCm39) R230* probably null Het
Vps13c T A 9: 67,900,295 (GRCm39) F3671L probably benign Het
Washc5 T C 15: 59,231,189 (GRCm39) N358S possibly damaging Het
Wdr72 A G 9: 74,058,899 (GRCm39) K331E probably damaging Het
Zfp986 A T 4: 145,625,805 (GRCm39) K155I probably benign Het
Other mutations in Plpbp
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02365:Plpbp APN 8 27,535,952 (GRCm39) missense probably benign 0.02
R0625:Plpbp UTSW 8 27,535,159 (GRCm39) missense probably damaging 1.00
R1770:Plpbp UTSW 8 27,543,326 (GRCm39) missense probably damaging 0.98
R6659:Plpbp UTSW 8 27,542,307 (GRCm39) missense possibly damaging 0.47
R6857:Plpbp UTSW 8 27,535,454 (GRCm39) missense possibly damaging 0.81
R7190:Plpbp UTSW 8 27,541,325 (GRCm39) missense probably benign
R7719:Plpbp UTSW 8 27,535,974 (GRCm39) missense
R8112:Plpbp UTSW 8 27,536,069 (GRCm39) missense unknown
R8302:Plpbp UTSW 8 27,539,216 (GRCm39) missense
R8755:Plpbp UTSW 8 27,535,165 (GRCm39) critical splice donor site probably null
X0013:Plpbp UTSW 8 27,543,317 (GRCm39) nonsense probably null
X0066:Plpbp UTSW 8 27,543,317 (GRCm39) nonsense probably null
Predicted Primers PCR Primer
(F):5'- GGCGGTCATAAGCTGAACTG -3'
(R):5'- TCTTGACGAAGCAGCTCAC -3'

Sequencing Primer
(F):5'- GGTCATAAGCTGAACTGTCCTTTTC -3'
(R):5'- AGGAGGCTGGAGCTTCTC -3'
Posted On 2014-06-23