Mutagenetix > Incidental Mutation

Incidental Mutation 'R1835:Vps13c'

205180

Institutional Source

Beutler Lab

Gene Symbol

Vps13c

Ensembl Gene

ENSMUSG00000035284

Gene Name

vacuolar protein sorting 13C

Synonyms

C230055H22Rik

MMRRC Submission

039862-MU

Accession Numbers

Genbank: NM_177184; MGI: 2444207

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R1835 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

67840396-67995638 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 67993013 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Phenylalanine to Leucine at position 3671 (F3671L)

Ref Sequence

ENSEMBL: ENSMUSP00000077040 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000077879]

AlphaFold

no structure available at present

Predicted Effect

probably benign
Transcript: ENSMUST00000077879
AA Change: F3671L

PolyPhen 2 Score 0.080 (Sensitivity: 0.93; Specificity: 0.85)

SMART Domains

Protein: ENSMUSP00000077040
Gene: ENSMUSG00000035284
AA Change: F3671L

Domain	Start	End	E-Value	Type
Pfam:Chorein_N	3	117	1.3e-39	PFAM
low complexity region	151	165	N/A	INTRINSIC
Pfam:VPS13	182	414	7.9e-70	PFAM
coiled coil region	422	443	N/A	INTRINSIC
low complexity region	479	490	N/A	INTRINSIC
Pfam:VPS13_mid_rpt	611	832	7.8e-71	PFAM
low complexity region	867	885	N/A	INTRINSIC
low complexity region	1020	1036	N/A	INTRINSIC
low complexity region	1112	1123	N/A	INTRINSIC
Pfam:VPS13_mid_rpt	1172	1369	2.1e-14	PFAM
low complexity region	1552	1573	N/A	INTRINSIC
Pfam:VPS13_mid_rpt	1685	1883	2.8e-13	PFAM
Blast:INB	2128	2403	2e-48	BLAST
Pfam:SHR-BD	2759	3013	9.9e-32	PFAM
Pfam:VPS13_C	3317	3495	5.7e-65	PFAM
Pfam:ATG_C	3498	3588	7.9e-12	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000215524

Coding Region Coverage

1x: 97.4%
3x: 96.8%
10x: 94.9%
20x: 91.0%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the vacuolar protein sorting-associated 13 gene family. Alternate splicing results in multiple transcript variants. [provided by RefSeq, Oct 2010]

Allele List at MGI

All alleles(13) : Targeted, other(2) Gene trapped(11)

Other mutations in this stock

Total: 97 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2610507B11Rik	G	T	11: 78,287,750	V1993F	probably damaging	Het
4933425L06Rik	C	A	13: 105,082,194	A12E	unknown	Het
Acss2	T	A	2: 155,558,630	Y530N	probably damaging	Het
Adam4	T	C	12: 81,419,559	I763V	probably benign	Het
Aipl1	T	G	11: 72,030,499	K190T	possibly damaging	Het
Alms1	T	A	6: 85,678,503	S3344T	possibly damaging	Het
Alpi	A	G	1: 87,099,414	V381A	possibly damaging	Het
Ankfn1	A	T	11: 89,447,618	S365R	probably benign	Het
Aox2	G	A	1: 58,308,991	A623T	probably benign	Het
Apc	T	A	18: 34,317,077	L2308Q	probably damaging	Het
Atp9b	C	T	18: 80,778,883	V501I	probably benign	Het
Baz2b	T	C	2: 59,901,819	E1994G	probably benign	Het
Cacna1a	T	C	8: 84,581,357		probably null	Het
Cacna1h	C	A	17: 25,392,076	V583L	probably benign	Het
Cd55	T	C	1: 130,447,609		probably benign	Het
Cep192	T	A	18: 67,804,424	S75T	possibly damaging	Het
Cfap54	T	A	10: 92,962,375	D1674V	probably benign	Het
Churc1	T	C	12: 76,773,297	F27L	possibly damaging	Het
Coro1c	A	G	5: 113,848,543	I280T	probably benign	Het
Creb1	C	T	1: 64,550,950	Q32*	probably null	Het
Cyp2b9	A	G	7: 26,200,783	T339A	probably benign	Het
Dctn3	T	C	4: 41,720,813	R51G	probably damaging	Het
Ddb1	T	C	19: 10,626,593	V888A	probably damaging	Het
Disp1	A	G	1: 183,089,000	Y619H	probably damaging	Het
Dnajc9	T	C	14: 20,388,334	D96G	possibly damaging	Het
Eepd1	A	G	9: 25,482,868	T143A	possibly damaging	Het
Eps8	T	A	6: 137,522,279	K204*	probably null	Het
Ercc5	T	A	1: 44,180,875	S1102R	probably benign	Het
Ergic2	T	A	6: 148,189,581	Y211F	possibly damaging	Het
Fam135b	G	T	15: 71,490,711	L274M	probably damaging	Het
Fat3	G	A	9: 15,998,088	T2206I	probably damaging	Het
Fat4	A	G	3: 38,983,571	I3791V	probably benign	Het
Gemin4	A	G	11: 76,213,296	M213T	possibly damaging	Het
Gnai3	T	C	3: 108,118,407	M119V	probably benign	Het
Heatr5b	A	T	17: 78,773,563	L1420Q	probably damaging	Het
Herc2	G	T	7: 56,206,765	G3918*	probably null	Het
Ints9	A	G	14: 65,032,256	Y465C	probably damaging	Het
Ist1	A	G	8: 109,678,883	V175A	probably damaging	Het
Kcnj12	T	C	11: 61,069,557	L227P	possibly damaging	Het
Kcnq5	T	C	1: 21,466,387	S416G	probably benign	Het
Kdm3a	T	A	6: 71,613,956	T295S	probably benign	Het
Kif1c	T	A	11: 70,708,971	M479K	probably damaging	Het
Kif20b	T	C	19: 34,956,038	L83P	probably damaging	Het
Kndc1	A	G	7: 139,927,711	E1194G	probably damaging	Het
Llgl1	A	G	11: 60,704,730	M81V	probably benign	Het
Map4k5	C	A	12: 69,824,662	M495I	probably damaging	Het
Mest	C	T	6: 30,742,791	R146C	probably benign	Het
Mettl24	T	A	10: 40,737,816		probably null	Het
Mical1	T	C	10: 41,483,535	S586P	probably benign	Het
Mrgpra3	G	T	7: 47,589,946	Y77*	probably null	Het
Mss51	A	T	14: 20,483,178	C408*	probably null	Het
Myh6	T	C	14: 54,957,401	T666A	probably benign	Het
Myo10	T	C	15: 25,805,587	C1685R	possibly damaging	Het
Naip5	A	T	13: 100,223,218	Y503*	probably null	Het
Neil1	A	C	9: 57,146,604	F144C	probably damaging	Het
Nipbl	T	A	15: 8,343,517	I1082F	possibly damaging	Het
Nkiras1	T	C	14: 18,276,732	V7A	probably damaging	Het
Ntng2	G	A	2: 29,197,057	Q384*	probably null	Het
Ocrl	T	A	X: 47,962,116	I74N	probably damaging	Het
Olfr137	A	T	17: 38,305,312	S50T	probably benign	Het
Olfr1385	A	T	11: 49,494,670	I46F	probably damaging	Het
Olfr1408	A	G	1: 173,130,815	V134A	probably benign	Het
Olfr381	A	C	11: 73,486,374	V150G	probably benign	Het
Olfr535	A	G	7: 140,492,709	S24G	probably benign	Het
Olfr761	C	T	17: 37,952,385	G213E	possibly damaging	Het
Patj	A	G	4: 98,491,590	D151G	probably benign	Het
Plpbp	T	C	8: 27,049,231	V126A	probably damaging	Het
Pold2	A	G	11: 5,873,454	L325P	possibly damaging	Het
Ppp1r12c	A	C	7: 4,483,651	S480A	probably damaging	Het
Pum1	T	C	4: 130,701,048	S124P	possibly damaging	Het
Pwp2	C	G	10: 78,179,091	G353A	probably damaging	Het
Reln	C	A	5: 21,979,002	Q1666H	probably damaging	Het
Rnf19a	T	C	15: 36,265,925	I9V	probably benign	Het
Ryr2	T	C	13: 11,769,878	H1063R	probably benign	Het
Samd14	C	G	11: 95,023,600	D361E	probably damaging	Het
Samd15	A	T	12: 87,201,843	N365I	probably damaging	Het
Sec16b	A	G	1: 157,531,312	H105R	probably benign	Het
Sez6	T	C	11: 77,953,503	S51P	probably benign	Het
Sh3bp1	T	A	15: 78,905,150	L236Q	probably damaging	Het
Sspo	C	T	6: 48,457,340	T991I	probably damaging	Het
Suco	A	T	1: 161,859,500	L97*	probably null	Het
Tab1	C	A	15: 80,148,296	R35S	probably benign	Het
Tet3	C	A	6: 83,404,163	S341I	possibly damaging	Het
Tlr1	A	T	5: 64,925,700	D511E	probably benign	Het
Tmem132b	A	C	5: 125,785,899	D656A	probably damaging	Het
Tmtc4	T	A	14: 122,941,988		probably null	Het
Trmo	T	C	4: 46,380,158	T404A	probably damaging	Het
Trpm1	A	G	7: 64,230,268	K790E	probably damaging	Het
Ulk4	C	A	9: 121,168,184	R774M	probably null	Het
Ush2a	C	T	1: 188,451,818	L1440F	probably benign	Het
Usp16	A	G	16: 87,480,907	K682E	probably damaging	Het
Virma	T	C	4: 11,540,511	S1471P	probably benign	Het
Vmn1r177	A	T	7: 23,865,686	I255N	probably damaging	Het
Vmn2r61	A	T	7: 42,266,652	R230*	probably null	Het
Washc5	T	C	15: 59,359,340	N358S	possibly damaging	Het
Wdr72	A	G	9: 74,151,617	K331E	probably damaging	Het
Zfp986	A	T	4: 145,899,235	K155I	probably benign	Het

Other mutations in Vps13c

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00159:Vps13c	APN	9	67945999	missense	probably benign	0.20
IGL00336:Vps13c	APN	9	67945942	missense	probably benign	0.01
IGL00418:Vps13c	APN	9	67876262	missense	probably damaging	1.00
IGL00481:Vps13c	APN	9	67860865	missense	probably damaging	1.00
IGL00491:Vps13c	APN	9	67893136	missense	probably damaging	1.00
IGL00558:Vps13c	APN	9	67937857	missense	possibly damaging	0.52
IGL00811:Vps13c	APN	9	67948181	missense	probably damaging	0.99
IGL01011:Vps13c	APN	9	67926955	missense	probably damaging	0.98
IGL01094:Vps13c	APN	9	67886284	missense	probably damaging	1.00
IGL01330:Vps13c	APN	9	67964108	missense	probably damaging	1.00
IGL01402:Vps13c	APN	9	67913204	critical splice acceptor site	probably null
IGL01404:Vps13c	APN	9	67913204	critical splice acceptor site	probably null
IGL01470:Vps13c	APN	9	67912927	splice site	probably benign
IGL01615:Vps13c	APN	9	67955781	missense	probably benign	0.01
IGL01694:Vps13c	APN	9	67895349	missense	probably damaging	1.00
IGL01752:Vps13c	APN	9	67948228	missense	probably damaging	1.00
IGL01810:Vps13c	APN	9	67955780	missense	probably benign
IGL01954:Vps13c	APN	9	67969298	missense	probably damaging	0.98
IGL01978:Vps13c	APN	9	67930643	missense	probably benign	0.03
IGL01998:Vps13c	APN	9	67955068	splice site	probably null
IGL02201:Vps13c	APN	9	67967136	missense	probably damaging	1.00
IGL02205:Vps13c	APN	9	67883454	missense	probably damaging	1.00
IGL02303:Vps13c	APN	9	67945481	splice site	probably benign
IGL02322:Vps13c	APN	9	67937901	missense	probably benign	0.02
IGL02456:Vps13c	APN	9	67952976	missense	probably damaging	1.00
IGL02474:Vps13c	APN	9	67937876	missense	probably benign	0.00
IGL02547:Vps13c	APN	9	67908019	missense	possibly damaging	0.83
IGL02640:Vps13c	APN	9	67886248	splice site	probably benign
IGL02673:Vps13c	APN	9	67878098	missense	probably damaging	1.00
IGL02721:Vps13c	APN	9	67964149	splice site	probably benign
IGL02834:Vps13c	APN	9	67937855	missense	probably benign
IGL02838:Vps13c	APN	9	67975851	missense	probably damaging	1.00
IGL03136:Vps13c	APN	9	67950310	missense	probably damaging	1.00
IGL03137:Vps13c	APN	9	67890380	missense	probably damaging	1.00
IGL03214:Vps13c	APN	9	67897195	missense	probably null	0.81
IGL03240:Vps13c	APN	9	67955047	missense	probably benign
IGL03303:Vps13c	APN	9	67934504	missense	probably benign	0.27
IGL03336:Vps13c	APN	9	67951642	missense	possibly damaging	0.76
IGL03366:Vps13c	APN	9	67946026	missense	probably benign	0.00
Derivative	UTSW	9	67930622	missense	possibly damaging	0.79
diversion	UTSW	9	67910233	missense	possibly damaging	0.93
introversion	UTSW	9	67944046	missense	probably damaging	0.98
Inversion	UTSW	9	67902839	critical splice acceptor site	probably null
subversion	UTSW	9	67908052	missense	probably damaging	1.00
Transversion	UTSW	9	67934501	missense	probably damaging	0.98
3-1:Vps13c	UTSW	9	67936373	missense	probably benign	0.00
IGL02991:Vps13c	UTSW	9	67913877	missense	probably damaging	1.00
PIT4802001:Vps13c	UTSW	9	67937786	missense	probably damaging	1.00
R0008:Vps13c	UTSW	9	67919262	missense	probably benign
R0206:Vps13c	UTSW	9	67939162	splice site	probably benign
R0288:Vps13c	UTSW	9	67927366	missense	probably damaging	0.99
R0324:Vps13c	UTSW	9	67964309	missense	possibly damaging	0.95
R0347:Vps13c	UTSW	9	67910233	missense	possibly damaging	0.93
R0374:Vps13c	UTSW	9	67886246	splice site	probably benign
R0388:Vps13c	UTSW	9	67922915	splice site	probably benign
R0409:Vps13c	UTSW	9	67951644	missense	probably benign	0.00
R0440:Vps13c	UTSW	9	67972861	missense	probably damaging	1.00
R0513:Vps13c	UTSW	9	67930735	missense	probably benign	0.02
R0520:Vps13c	UTSW	9	67945851	missense	possibly damaging	0.88
R0569:Vps13c	UTSW	9	67973719	missense	probably damaging	0.98
R0601:Vps13c	UTSW	9	67927472	missense	probably benign	0.12
R0659:Vps13c	UTSW	9	67920935	missense	probably benign	0.11
R0667:Vps13c	UTSW	9	67951573	nonsense	probably null
R0670:Vps13c	UTSW	9	67925857	missense	probably benign	0.35
R0698:Vps13c	UTSW	9	67889723	missense	probably benign	0.45
R0729:Vps13c	UTSW	9	67961649	missense	probably damaging	1.00
R0781:Vps13c	UTSW	9	67972003	missense	probably damaging	1.00
R0811:Vps13c	UTSW	9	67934476	missense	probably benign	0.06
R0812:Vps13c	UTSW	9	67934476	missense	probably benign	0.06
R0839:Vps13c	UTSW	9	67898738	missense	probably benign
R1373:Vps13c	UTSW	9	67927511	missense	probably damaging	0.99
R1396:Vps13c	UTSW	9	67955022	missense	probably benign	0.00
R1499:Vps13c	UTSW	9	67957505	missense	probably benign	0.00
R1556:Vps13c	UTSW	9	67930711	missense	probably damaging	0.98
R1560:Vps13c	UTSW	9	67936463	critical splice donor site	probably null
R1584:Vps13c	UTSW	9	67893112	missense	possibly damaging	0.74
R1654:Vps13c	UTSW	9	67951687	missense	probably damaging	1.00
R1674:Vps13c	UTSW	9	67853703	nonsense	probably null
R1676:Vps13c	UTSW	9	67926962	missense	probably benign	0.20
R1695:Vps13c	UTSW	9	67972075	nonsense	probably null
R1710:Vps13c	UTSW	9	67911529	missense	probably benign	0.00
R1769:Vps13c	UTSW	9	67965721	missense	probably benign	0.00
R1775:Vps13c	UTSW	9	67881447	missense	probably damaging	1.00
R1795:Vps13c	UTSW	9	67893985	nonsense	probably null
R1799:Vps13c	UTSW	9	67944117	missense	probably damaging	0.98
R1848:Vps13c	UTSW	9	67936340	missense	probably benign
R1903:Vps13c	UTSW	9	67894052	missense	probably damaging	1.00
R1944:Vps13c	UTSW	9	67886276	missense	probably damaging	1.00
R1945:Vps13c	UTSW	9	67886276	missense	probably damaging	1.00
R1951:Vps13c	UTSW	9	67973759	critical splice donor site	probably null
R1993:Vps13c	UTSW	9	67975856	missense	probably damaging	1.00
R2023:Vps13c	UTSW	9	67936285	splice site	probably benign
R2059:Vps13c	UTSW	9	67860833	missense	probably damaging	1.00
R2086:Vps13c	UTSW	9	67950289	missense	probably benign	0.29
R2120:Vps13c	UTSW	9	67919334	missense	possibly damaging	0.92
R2249:Vps13c	UTSW	9	67988053	critical splice donor site	probably null
R2257:Vps13c	UTSW	9	67952946	missense	possibly damaging	0.87
R2258:Vps13c	UTSW	9	67953860	missense	probably benign	0.01
R2259:Vps13c	UTSW	9	67953860	missense	probably benign	0.01
R2260:Vps13c	UTSW	9	67953860	missense	probably benign	0.01
R2265:Vps13c	UTSW	9	67920947	missense	possibly damaging	0.82
R2266:Vps13c	UTSW	9	67920947	missense	possibly damaging	0.82
R2269:Vps13c	UTSW	9	67920947	missense	possibly damaging	0.82
R2278:Vps13c	UTSW	9	67939072	missense	probably benign
R2306:Vps13c	UTSW	9	67987993	missense	probably damaging	0.99
R2327:Vps13c	UTSW	9	67913820	missense	probably damaging	0.98
R2349:Vps13c	UTSW	9	67957526	missense	possibly damaging	0.89
R2483:Vps13c	UTSW	9	67975907	critical splice donor site	probably null
R3031:Vps13c	UTSW	9	67923770	missense	probably benign	0.00
R3623:Vps13c	UTSW	9	67975907	critical splice donor site	probably null
R3870:Vps13c	UTSW	9	67884726	missense	probably benign	0.00
R4173:Vps13c	UTSW	9	67936313	missense	probably benign	0.00
R4445:Vps13c	UTSW	9	67982495	splice site	probably null
R4491:Vps13c	UTSW	9	67910193	missense	probably benign
R4505:Vps13c	UTSW	9	67939034	missense	probably benign	0.02
R4574:Vps13c	UTSW	9	67951683	missense	probably damaging	1.00
R4691:Vps13c	UTSW	9	67952935	missense	possibly damaging	0.95
R4766:Vps13c	UTSW	9	67878224	splice site	probably null
R4771:Vps13c	UTSW	9	67929539	missense	probably benign
R4801:Vps13c	UTSW	9	67964282	missense	probably damaging	1.00
R4802:Vps13c	UTSW	9	67964282	missense	probably damaging	1.00
R4962:Vps13c	UTSW	9	67873891	missense	probably damaging	1.00
R4995:Vps13c	UTSW	9	67919321	missense	probably benign	0.00
R5010:Vps13c	UTSW	9	67916379	missense	probably benign	0.19
R5183:Vps13c	UTSW	9	67908052	missense	probably damaging	1.00
R5226:Vps13c	UTSW	9	67945553	missense	probably benign	0.17
R5297:Vps13c	UTSW	9	67878131	missense	probably damaging	1.00
R5456:Vps13c	UTSW	9	67927447	missense	possibly damaging	0.53
R5494:Vps13c	UTSW	9	67948146	missense	probably benign	0.00
R5521:Vps13c	UTSW	9	67951439	missense	probably benign	0.08
R5524:Vps13c	UTSW	9	67957556	missense	probably damaging	1.00
R5685:Vps13c	UTSW	9	67963173	missense	possibly damaging	0.64
R5731:Vps13c	UTSW	9	67895379	missense	probably damaging	1.00
R5812:Vps13c	UTSW	9	67982495	splice site	probably benign
R5867:Vps13c	UTSW	9	67982622	splice site	probably null
R5893:Vps13c	UTSW	9	67902839	critical splice acceptor site	probably null
R5902:Vps13c	UTSW	9	67934447	missense	probably benign	0.00
R5957:Vps13c	UTSW	9	67954971	missense	probably damaging	1.00
R6076:Vps13c	UTSW	9	67911602	missense	probably damaging	1.00
R6187:Vps13c	UTSW	9	67915657	missense	probably damaging	1.00
R6268:Vps13c	UTSW	9	67951449	missense	probably benign	0.10
R6547:Vps13c	UTSW	9	67973365	missense	probably damaging	1.00
R6716:Vps13c	UTSW	9	67951467	missense	probably benign	0.00
R6837:Vps13c	UTSW	9	67910222	missense	probably benign
R6919:Vps13c	UTSW	9	67927452	missense	probably damaging	0.97
R7039:Vps13c	UTSW	9	67937763	missense	probably damaging	1.00
R7058:Vps13c	UTSW	9	67923828	missense	probably benign	0.39
R7082:Vps13c	UTSW	9	67883453	missense	probably damaging	1.00
R7195:Vps13c	UTSW	9	67945825	missense	possibly damaging	0.95
R7244:Vps13c	UTSW	9	67889804	missense	probably benign	0.00
R7300:Vps13c	UTSW	9	67940544	missense	probably benign	0.20
R7314:Vps13c	UTSW	9	67943340	splice site	probably null
R7352:Vps13c	UTSW	9	67840446	missense	possibly damaging	0.94
R7368:Vps13c	UTSW	9	67914073	missense	probably benign	0.23
R7411:Vps13c	UTSW	9	67972001	missense	probably damaging	0.98
R7497:Vps13c	UTSW	9	67840479	missense	probably damaging	1.00
R7516:Vps13c	UTSW	9	67955007	missense	possibly damaging	0.89
R7638:Vps13c	UTSW	9	67945509	missense	probably damaging	1.00
R7732:Vps13c	UTSW	9	67940516	missense	probably damaging	0.97
R7748:Vps13c	UTSW	9	67963089	missense	probably benign	0.03
R7779:Vps13c	UTSW	9	67881422	missense	probably damaging	1.00
R7788:Vps13c	UTSW	9	67940483	missense	probably benign	0.01
R7894:Vps13c	UTSW	9	67926983	missense	probably damaging	0.99
R8163:Vps13c	UTSW	9	67950438	missense	probably benign	0.08
R8165:Vps13c	UTSW	9	67858790	missense	probably benign	0.00
R8202:Vps13c	UTSW	9	67944046	missense	probably damaging	0.98
R8235:Vps13c	UTSW	9	67927396	missense	probably damaging	1.00
R8235:Vps13c	UTSW	9	67955781	missense	probably benign	0.01
R8253:Vps13c	UTSW	9	67943488	nonsense	probably null
R8261:Vps13c	UTSW	9	67954980	missense	probably damaging	1.00
R8348:Vps13c	UTSW	9	67879103	missense	possibly damaging	0.79
R8547:Vps13c	UTSW	9	67945566	missense	probably damaging	1.00
R8734:Vps13c	UTSW	9	67973403	missense	probably damaging	1.00
R8806:Vps13c	UTSW	9	67945828	missense	probably damaging	1.00
R8807:Vps13c	UTSW	9	67858840	missense	probably damaging	0.99
R8813:Vps13c	UTSW	9	67871284	missense	probably damaging	1.00
R8883:Vps13c	UTSW	9	67948197	missense	probably benign	0.10
R8885:Vps13c	UTSW	9	67943454	missense	probably benign
R8899:Vps13c	UTSW	9	67934501	missense	probably damaging	0.98
R8970:Vps13c	UTSW	9	67945521	missense	probably benign	0.11
R9007:Vps13c	UTSW	9	67937724	missense	probably benign	0.00
R9026:Vps13c	UTSW	9	67954581	missense	probably damaging	1.00
R9029:Vps13c	UTSW	9	67948147	missense	probably damaging	0.98
R9057:Vps13c	UTSW	9	67920927	missense	probably benign	0.00
R9105:Vps13c	UTSW	9	67870799	intron	probably benign
R9130:Vps13c	UTSW	9	67929523	missense	probably damaging	1.00
R9286:Vps13c	UTSW	9	67972921	missense	probably benign	0.00
R9338:Vps13c	UTSW	9	67951695	missense	probably damaging	1.00
R9432:Vps13c	UTSW	9	67922855	missense	probably benign	0.02
R9460:Vps13c	UTSW	9	67930622	missense	possibly damaging	0.79
R9464:Vps13c	UTSW	9	67951392	missense	probably damaging	1.00
R9561:Vps13c	UTSW	9	67965512	missense	probably damaging	1.00
R9609:Vps13c	UTSW	9	67934549	missense	probably damaging	1.00
R9622:Vps13c	UTSW	9	67949433	missense	probably damaging	1.00
R9665:Vps13c	UTSW	9	67955743	nonsense	probably null
R9731:Vps13c	UTSW	9	67919244	missense	probably benign
R9763:Vps13c	UTSW	9	67911578	missense	probably benign	0.00
R9774:Vps13c	UTSW	9	67884591	missense	possibly damaging	0.85
R9798:Vps13c	UTSW	9	67919364	missense	probably damaging	1.00
U24488:Vps13c	UTSW	9	67905916	missense	probably benign	0.13
X0021:Vps13c	UTSW	9	67937781	missense	probably damaging	0.99
X0058:Vps13c	UTSW	9	67927419	missense	probably damaging	1.00
X0065:Vps13c	UTSW	9	67873863	missense	probably damaging	1.00
Z1088:Vps13c	UTSW	9	67913975	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- ACTCAGCTTCCGACCCTCAG -3'
(R):5'- CAATTCTGGCGAATCAATTGATAC -3'

Sequencing Primer
(F):5'- GACCCTCAGCACCCTATGG -3'
(R):5'- CTGGCGAATCAATTGATACTATACTC -3'

Posted On

2014-06-23