Incidental Mutation 'R1835:Ulk4'
ID205182
Institutional Source Beutler Lab
Gene Symbol Ulk4
Ensembl Gene ENSMUSG00000040936
Gene Nameunc-51-like kinase 4
Synonyms4932415A06Rik
MMRRC Submission 039862-MU
Accession Numbers

Genbank: NM_177589; MGI: 1921622

Is this an essential gene? Possibly essential (E-score: 0.697) question?
Stock #R1835 (G1)
Quality Score225
Status Not validated
Chromosome9
Chromosomal Location120955351-121277197 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 121168184 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Methionine at position 774 (R774M)
Ref Sequence ENSEMBL: ENSMUSP00000131342 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000051479] [ENSMUST00000051565] [ENSMUST00000170237] [ENSMUST00000171061] [ENSMUST00000171923]
Predicted Effect probably null
Transcript: ENSMUST00000051479
AA Change: R774M

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000057960
Gene: ENSMUSG00000040936
AA Change: R774M

DomainStartEndE-ValueType
Pfam:Pkinase_Tyr 4 277 9.9e-26 PFAM
Pfam:Pkinase 4 280 4.6e-49 PFAM
low complexity region 949 964 N/A INTRINSIC
low complexity region 968 985 N/A INTRINSIC
low complexity region 1107 1119 N/A INTRINSIC
low complexity region 1147 1161 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000051565
SMART Domains Protein: ENSMUSP00000054833
Gene: ENSMUSG00000040936

DomainStartEndE-ValueType
SCOP:d1jvpp_ 1 32 9e-6 SMART
Blast:S_TKc 4 45 2e-8 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000164336
Predicted Effect noncoding transcript
Transcript: ENSMUST00000164969
Predicted Effect probably benign
Transcript: ENSMUST00000170237
Predicted Effect probably damaging
Transcript: ENSMUST00000171061
AA Change: R774M

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000129214
Gene: ENSMUSG00000040936
AA Change: R774M

DomainStartEndE-ValueType
Pfam:Pkinase_Tyr 4 277 4.3e-26 PFAM
Pfam:Pkinase 4 280 2.1e-49 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000171923
AA Change: R774M

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000131342
Gene: ENSMUSG00000040936
AA Change: R774M

DomainStartEndE-ValueType
Pfam:Pkinase_Tyr 4 153 3.1e-14 PFAM
Pfam:Pkinase 4 280 4.9e-50 PFAM
Pfam:Pkinase_Tyr 165 277 6.1e-10 PFAM
low complexity region 949 964 N/A INTRINSIC
low complexity region 968 985 N/A INTRINSIC
low complexity region 1107 1119 N/A INTRINSIC
low complexity region 1147 1171 N/A INTRINSIC
Coding Region Coverage
  • 1x: 97.4%
  • 3x: 96.8%
  • 10x: 94.9%
  • 20x: 91.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the unc-51-like serine/threonine kinase (STK) family. Members of this protein family play a role in neuronal growth and endocytosis. The encoded protein is likely involved in neurite branching, neurite elongation and neuronal migration. Genome-wide association studies (GWAS) indicate an association of variations in this gene with blood pressure and hypertension. Sequence variations in this gene may also be be associated with psychiatric disorders, including schizophrenia and bipolar disorder. Pseudogenes associated with this gene have been identified and are located on chromosome 15. [provided by RefSeq, Jul 2016]
PHENOTYPE: Homozygotes for a null allele show reduced body size, hydrocephaly, dilated brain ventricles, otitis media, and premature death. Hypomorphic mice show partial corpus callosum aplasia, hydrocephaly, subcommissural organ and ependymal motile ciliary defects, aqueduct stenosis, and impaired CSF flow. [provided by MGI curators]
Allele List at MGI

All alleles(2) : Targeted, other(1) Gene trapped(1)

Other mutations in this stock
Total: 97 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610507B11Rik G T 11: 78,287,750 V1993F probably damaging Het
4933425L06Rik C A 13: 105,082,194 A12E unknown Het
Acss2 T A 2: 155,558,630 Y530N probably damaging Het
Adam4 T C 12: 81,419,559 I763V probably benign Het
Aipl1 T G 11: 72,030,499 K190T possibly damaging Het
Alms1 T A 6: 85,678,503 S3344T possibly damaging Het
Alpi A G 1: 87,099,414 V381A possibly damaging Het
Ankfn1 A T 11: 89,447,618 S365R probably benign Het
Aox2 G A 1: 58,308,991 A623T probably benign Het
Apc T A 18: 34,317,077 L2308Q probably damaging Het
Atp9b C T 18: 80,778,883 V501I probably benign Het
Baz2b T C 2: 59,901,819 E1994G probably benign Het
Cacna1a T C 8: 84,581,357 probably null Het
Cacna1h C A 17: 25,392,076 V583L probably benign Het
Cd55 T C 1: 130,447,609 probably benign Het
Cep192 T A 18: 67,804,424 S75T possibly damaging Het
Cfap54 T A 10: 92,962,375 D1674V probably benign Het
Churc1 T C 12: 76,773,297 F27L possibly damaging Het
Coro1c A G 5: 113,848,543 I280T probably benign Het
Creb1 C T 1: 64,550,950 Q32* probably null Het
Cyp2b9 A G 7: 26,200,783 T339A probably benign Het
Dctn3 T C 4: 41,720,813 R51G probably damaging Het
Ddb1 T C 19: 10,626,593 V888A probably damaging Het
Disp1 A G 1: 183,089,000 Y619H probably damaging Het
Dnajc9 T C 14: 20,388,334 D96G possibly damaging Het
Eepd1 A G 9: 25,482,868 T143A possibly damaging Het
Eps8 T A 6: 137,522,279 K204* probably null Het
Ercc5 T A 1: 44,180,875 S1102R probably benign Het
Ergic2 T A 6: 148,189,581 Y211F possibly damaging Het
Fam135b G T 15: 71,490,711 L274M probably damaging Het
Fat3 G A 9: 15,998,088 T2206I probably damaging Het
Fat4 A G 3: 38,983,571 I3791V probably benign Het
Gemin4 A G 11: 76,213,296 M213T possibly damaging Het
Gnai3 T C 3: 108,118,407 M119V probably benign Het
Heatr5b A T 17: 78,773,563 L1420Q probably damaging Het
Herc2 G T 7: 56,206,765 G3918* probably null Het
Ints9 A G 14: 65,032,256 Y465C probably damaging Het
Ist1 A G 8: 109,678,883 V175A probably damaging Het
Kcnj12 T C 11: 61,069,557 L227P possibly damaging Het
Kcnq5 T C 1: 21,466,387 S416G probably benign Het
Kdm3a T A 6: 71,613,956 T295S probably benign Het
Kif1c T A 11: 70,708,971 M479K probably damaging Het
Kif20b T C 19: 34,956,038 L83P probably damaging Het
Kndc1 A G 7: 139,927,711 E1194G probably damaging Het
Llgl1 A G 11: 60,704,730 M81V probably benign Het
Map4k5 C A 12: 69,824,662 M495I probably damaging Het
Mest C T 6: 30,742,791 R146C probably benign Het
Mettl24 T A 10: 40,737,816 probably null Het
Mical1 T C 10: 41,483,535 S586P probably benign Het
Mrgpra3 G T 7: 47,589,946 Y77* probably null Het
Mss51 A T 14: 20,483,178 C408* probably null Het
Myh6 T C 14: 54,957,401 T666A probably benign Het
Myo10 T C 15: 25,805,587 C1685R possibly damaging Het
Naip5 A T 13: 100,223,218 Y503* probably null Het
Neil1 A C 9: 57,146,604 F144C probably damaging Het
Nipbl T A 15: 8,343,517 I1082F possibly damaging Het
Nkiras1 T C 14: 18,276,732 V7A probably damaging Het
Ntng2 G A 2: 29,197,057 Q384* probably null Het
Ocrl T A X: 47,962,116 I74N probably damaging Het
Olfr137 A T 17: 38,305,312 S50T probably benign Het
Olfr1385 A T 11: 49,494,670 I46F probably damaging Het
Olfr1408 A G 1: 173,130,815 V134A probably benign Het
Olfr381 A C 11: 73,486,374 V150G probably benign Het
Olfr535 A G 7: 140,492,709 S24G probably benign Het
Olfr761 C T 17: 37,952,385 G213E possibly damaging Het
Patj A G 4: 98,491,590 D151G probably benign Het
Plpbp T C 8: 27,049,231 V126A probably damaging Het
Pold2 A G 11: 5,873,454 L325P possibly damaging Het
Ppp1r12c A C 7: 4,483,651 S480A probably damaging Het
Pum1 T C 4: 130,701,048 S124P possibly damaging Het
Pwp2 C G 10: 78,179,091 G353A probably damaging Het
Reln C A 5: 21,979,002 Q1666H probably damaging Het
Rnf19a T C 15: 36,265,925 I9V probably benign Het
Ryr2 T C 13: 11,769,878 H1063R probably benign Het
Samd14 C G 11: 95,023,600 D361E probably damaging Het
Samd15 A T 12: 87,201,843 N365I probably damaging Het
Sec16b A G 1: 157,531,312 H105R probably benign Het
Sez6 T C 11: 77,953,503 S51P probably benign Het
Sh3bp1 T A 15: 78,905,150 L236Q probably damaging Het
Sspo C T 6: 48,457,340 T991I probably damaging Het
Suco A T 1: 161,859,500 L97* probably null Het
Tab1 C A 15: 80,148,296 R35S probably benign Het
Tet3 C A 6: 83,404,163 S341I possibly damaging Het
Tlr1 A T 5: 64,925,700 D511E probably benign Het
Tmem132b A C 5: 125,785,899 D656A probably damaging Het
Tmtc4 T A 14: 122,941,988 probably null Het
Trmo T C 4: 46,380,158 T404A probably damaging Het
Trpm1 A G 7: 64,230,268 K790E probably damaging Het
Ush2a C T 1: 188,451,818 L1440F probably benign Het
Usp16 A G 16: 87,480,907 K682E probably damaging Het
Virma T C 4: 11,540,511 S1471P probably benign Het
Vmn1r177 A T 7: 23,865,686 I255N probably damaging Het
Vmn2r61 A T 7: 42,266,652 R230* probably null Het
Vps13c T A 9: 67,993,013 F3671L probably benign Het
Washc5 T C 15: 59,359,340 N358S possibly damaging Het
Wdr72 A G 9: 74,151,617 K331E probably damaging Het
Zfp986 A T 4: 145,899,235 K155I probably benign Het
Other mutations in Ulk4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01122:Ulk4 APN 9 121168292 missense possibly damaging 0.48
IGL01345:Ulk4 APN 9 121208162 missense possibly damaging 0.48
IGL01432:Ulk4 APN 9 121266301 missense probably damaging 1.00
IGL01807:Ulk4 APN 9 121255185 missense probably damaging 1.00
IGL02139:Ulk4 APN 9 121141831 splice site probably null
IGL02266:Ulk4 APN 9 121081700 missense probably benign 0.10
IGL02511:Ulk4 APN 9 121188354 missense probably damaging 1.00
IGL02546:Ulk4 APN 9 121152307 nonsense probably null
IGL02687:Ulk4 APN 9 121192662 missense possibly damaging 0.89
IGL03220:Ulk4 APN 9 121145336 missense probably damaging 1.00
3-1:Ulk4 UTSW 9 121255171 missense probably benign 0.02
R0031:Ulk4 UTSW 9 121272982 missense probably damaging 1.00
R0433:Ulk4 UTSW 9 121044819 missense probably benign 0.27
R0513:Ulk4 UTSW 9 121152325 missense probably benign 0.13
R0524:Ulk4 UTSW 9 121252651 critical splice donor site probably null
R1268:Ulk4 UTSW 9 121257074 splice site probably benign
R1439:Ulk4 UTSW 9 121266258 missense possibly damaging 0.58
R1470:Ulk4 UTSW 9 121081656 missense probably benign 0.00
R1470:Ulk4 UTSW 9 121081656 missense probably benign 0.00
R1531:Ulk4 UTSW 9 121044775 missense probably damaging 0.97
R1595:Ulk4 UTSW 9 121044838 missense probably damaging 0.96
R1620:Ulk4 UTSW 9 121204805 missense possibly damaging 0.81
R1966:Ulk4 UTSW 9 121257116 missense probably benign
R2129:Ulk4 UTSW 9 121152182 missense probably benign 0.03
R2329:Ulk4 UTSW 9 121272887 missense probably damaging 1.00
R2877:Ulk4 UTSW 9 121260039 missense probably benign 0.11
R2878:Ulk4 UTSW 9 121260039 missense probably benign 0.11
R3734:Ulk4 UTSW 9 121261989 missense probably benign 0.21
R3769:Ulk4 UTSW 9 121263700 missense probably benign 0.00
R4005:Ulk4 UTSW 9 121168199 missense possibly damaging 0.94
R4024:Ulk4 UTSW 9 121044849 missense possibly damaging 0.86
R4321:Ulk4 UTSW 9 121073996 missense probably benign 0.00
R4461:Ulk4 UTSW 9 121156884 missense possibly damaging 0.83
R4537:Ulk4 UTSW 9 121263638 nonsense probably null
R4542:Ulk4 UTSW 9 121263638 nonsense probably null
R4572:Ulk4 UTSW 9 121192764 missense probably damaging 1.00
R4647:Ulk4 UTSW 9 121141852 missense probably benign 0.15
R4712:Ulk4 UTSW 9 121244370 missense probably benign 0.23
R4730:Ulk4 UTSW 9 121263725 missense probably benign 0.05
R4731:Ulk4 UTSW 9 121263638 nonsense probably null
R4732:Ulk4 UTSW 9 121263638 nonsense probably null
R4733:Ulk4 UTSW 9 121263638 nonsense probably null
R4737:Ulk4 UTSW 9 121073872 nonsense probably null
R4781:Ulk4 UTSW 9 121103576 missense probably benign 0.00
R4860:Ulk4 UTSW 9 121250902 missense possibly damaging 0.68
R4926:Ulk4 UTSW 9 121258732 missense probably benign 0.00
R4990:Ulk4 UTSW 9 121192786 missense probably benign 0.01
R6056:Ulk4 UTSW 9 121272955 missense probably damaging 1.00
R6448:Ulk4 UTSW 9 121103630 missense probably damaging 0.99
R6546:Ulk4 UTSW 9 121141894 missense probably damaging 1.00
R6668:Ulk4 UTSW 9 121188342 missense probably damaging 1.00
R6915:Ulk4 UTSW 9 121258820 missense probably benign
R6929:Ulk4 UTSW 9 121074015 missense probably benign 0.02
R7069:Ulk4 UTSW 9 121258810 missense probably benign 0.01
R7069:Ulk4 UTSW 9 121266517 missense probably benign 0.25
R7293:Ulk4 UTSW 9 121255124 missense probably damaging 1.00
R7299:Ulk4 UTSW 9 121145059 missense probably benign 0.32
R7301:Ulk4 UTSW 9 121145059 missense probably benign 0.32
R7337:Ulk4 UTSW 9 121248927 missense probably benign 0.44
R7395:Ulk4 UTSW 9 121255112 missense probably benign
R7423:Ulk4 UTSW 9 121103621 missense possibly damaging 0.48
R7545:Ulk4 UTSW 9 121141838 missense probably benign 0.00
R7753:Ulk4 UTSW 9 121266512 critical splice donor site probably null
R7790:Ulk4 UTSW 9 121263668 missense possibly damaging 0.70
R7791:Ulk4 UTSW 9 121263668 missense possibly damaging 0.70
R7793:Ulk4 UTSW 9 121263668 missense possibly damaging 0.70
R7834:Ulk4 UTSW 9 121263668 missense possibly damaging 0.70
R7836:Ulk4 UTSW 9 121044819 missense possibly damaging 0.72
R7960:Ulk4 UTSW 9 121272956 missense probably damaging 1.00
R8087:Ulk4 UTSW 9 121266251 missense probably damaging 0.99
R8203:Ulk4 UTSW 9 121168208 missense probably damaging 0.96
R8246:Ulk4 UTSW 9 121156875 makesense probably null
R8430:Ulk4 UTSW 9 121257078 critical splice donor site probably null
X0024:Ulk4 UTSW 9 121192753 missense probably damaging 1.00
X0066:Ulk4 UTSW 9 121262606 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GTCTCCAGGGCATCTGTAATC -3'
(R):5'- GTTGCAGGCTATGAGCTGAC -3'

Sequencing Primer
(F):5'- AGGGCATCTGTAATCCCAGCTC -3'
(R):5'- AGGCTATGAGCTGACCTGTCTAC -3'
Posted On2014-06-23