Incidental Mutation 'R1835:Mical1'
ID 205185
Institutional Source Beutler Lab
Gene Symbol Mical1
Ensembl Gene ENSMUSG00000019823
Gene Name microtubule associated monooxygenase, calponin and LIM domain containing 1
Synonyms Nical
MMRRC Submission 039862-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.121) question?
Stock # R1835 (G1)
Quality Score 180
Status Not validated
Chromosome 10
Chromosomal Location 41352310-41363028 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 41359531 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Serine to Proline at position 586 (S586P)
Ref Sequence ENSEMBL: ENSMUSP00000113783 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000019965] [ENSMUST00000019967] [ENSMUST00000099934] [ENSMUST00000119962] [ENSMUST00000126436] [ENSMUST00000155411]
AlphaFold Q8VDP3
Predicted Effect probably benign
Transcript: ENSMUST00000019965
SMART Domains Protein: ENSMUSP00000019965
Gene: ENSMUSG00000019822

DomainStartEndE-ValueType
Pfam:Exo_endo_phos 11 272 3.9e-24 PFAM
transmembrane domain 322 344 N/A INTRINSIC
transmembrane domain 353 375 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000019967
AA Change: S586P

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000019967
Gene: ENSMUSG00000019823
AA Change: S586P

DomainStartEndE-ValueType
Pfam:FAD_binding_3 84 140 5.5e-8 PFAM
Pfam:FAD_binding_2 86 125 6.1e-6 PFAM
low complexity region 160 171 N/A INTRINSIC
CH 509 606 4.18e-13 SMART
low complexity region 649 666 N/A INTRINSIC
LIM 682 736 2.07e-3 SMART
low complexity region 766 785 N/A INTRINSIC
low complexity region 787 803 N/A INTRINSIC
low complexity region 855 877 N/A INTRINSIC
DUF3585 912 1048 3.07e-44 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000099934
AA Change: S513P

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000097519
Gene: ENSMUSG00000019823
AA Change: S513P

DomainStartEndE-ValueType
PDB:2C4C|B 1 86 5e-49 PDB
low complexity region 87 98 N/A INTRINSIC
PDB:2C4C|B 99 416 N/A PDB
CH 436 533 4.18e-13 SMART
low complexity region 576 593 N/A INTRINSIC
LIM 609 663 2.07e-3 SMART
low complexity region 693 712 N/A INTRINSIC
low complexity region 714 730 N/A INTRINSIC
low complexity region 782 804 N/A INTRINSIC
DUF3585 839 975 3.07e-44 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000119962
AA Change: S586P

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000113783
Gene: ENSMUSG00000019823
AA Change: S586P

DomainStartEndE-ValueType
Pfam:FAD_binding_3 84 140 7.2e-8 PFAM
Pfam:FAD_binding_2 86 125 3.8e-6 PFAM
low complexity region 160 171 N/A INTRINSIC
CH 509 606 4.18e-13 SMART
low complexity region 649 666 N/A INTRINSIC
LIM 682 736 2.07e-3 SMART
low complexity region 766 785 N/A INTRINSIC
low complexity region 787 803 N/A INTRINSIC
low complexity region 855 877 N/A INTRINSIC
DUF3585 912 1048 3.07e-44 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000122997
Predicted Effect noncoding transcript
Transcript: ENSMUST00000123798
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125099
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125730
Predicted Effect probably benign
Transcript: ENSMUST00000126436
AA Change: S586P

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000114969
Gene: ENSMUSG00000019823
AA Change: S586P

DomainStartEndE-ValueType
Pfam:FAD_binding_3 84 140 1.1e-7 PFAM
Pfam:FAD_binding_2 86 125 3.2e-6 PFAM
low complexity region 160 171 N/A INTRINSIC
CH 509 606 4.18e-13 SMART
low complexity region 649 666 N/A INTRINSIC
LIM 682 736 2.07e-3 SMART
low complexity region 766 785 N/A INTRINSIC
low complexity region 787 803 N/A INTRINSIC
low complexity region 855 877 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000143470
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126833
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141542
Predicted Effect noncoding transcript
Transcript: ENSMUST00000130838
Predicted Effect noncoding transcript
Transcript: ENSMUST00000132170
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147367
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138657
Predicted Effect noncoding transcript
Transcript: ENSMUST00000136681
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134010
Predicted Effect probably benign
Transcript: ENSMUST00000155411
SMART Domains Protein: ENSMUSP00000115461
Gene: ENSMUSG00000019822

DomainStartEndE-ValueType
SCOP:d2dnja_ 9 81 2e-4 SMART
Coding Region Coverage
  • 1x: 97.4%
  • 3x: 96.8%
  • 10x: 94.9%
  • 20x: 91.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an enzyme that oxidizes methionine residues on actin, thereby promoting depolymerization of actin filaments. This protein interacts with and regulates signalling by NEDD9/CAS-L (neural precursor cell expressed, developmentally down-regulated 9). Alternative splicing results in multiple transcript variants. [provided by RefSeq, Aug 2015]
Allele List at MGI
Other mutations in this stock
Total: 97 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acss2 T A 2: 155,400,550 (GRCm39) Y530N probably damaging Het
Adam4 T C 12: 81,466,333 (GRCm39) I763V probably benign Het
Aipl1 T G 11: 71,921,325 (GRCm39) K190T possibly damaging Het
Alms1 T A 6: 85,655,485 (GRCm39) S3344T possibly damaging Het
Alpi A G 1: 87,027,136 (GRCm39) V381A possibly damaging Het
Ankfn1 A T 11: 89,338,444 (GRCm39) S365R probably benign Het
Aox1 G A 1: 58,348,150 (GRCm39) A623T probably benign Het
Apc T A 18: 34,450,130 (GRCm39) L2308Q probably damaging Het
Atp9b C T 18: 80,822,098 (GRCm39) V501I probably benign Het
Baz2b T C 2: 59,732,163 (GRCm39) E1994G probably benign Het
Bltp2 G T 11: 78,178,576 (GRCm39) V1993F probably damaging Het
Cacna1a T C 8: 85,307,986 (GRCm39) probably null Het
Cacna1h C A 17: 25,611,050 (GRCm39) V583L probably benign Het
Cd55 T C 1: 130,375,346 (GRCm39) probably benign Het
Cep192 T A 18: 67,937,494 (GRCm39) S75T possibly damaging Het
Cfap54 T A 10: 92,798,237 (GRCm39) D1674V probably benign Het
Churc1 T C 12: 76,820,071 (GRCm39) F27L possibly damaging Het
Coro1c A G 5: 113,986,604 (GRCm39) I280T probably benign Het
Creb1 C T 1: 64,590,109 (GRCm39) Q32* probably null Het
Cyp2b9 A G 7: 25,900,208 (GRCm39) T339A probably benign Het
Dctn3 T C 4: 41,720,813 (GRCm39) R51G probably damaging Het
Ddb1 T C 19: 10,603,957 (GRCm39) V888A probably damaging Het
Disp1 A G 1: 182,870,564 (GRCm39) Y619H probably damaging Het
Dnajc9 T C 14: 20,438,402 (GRCm39) D96G possibly damaging Het
Eepd1 A G 9: 25,394,164 (GRCm39) T143A possibly damaging Het
Eps8 T A 6: 137,499,277 (GRCm39) K204* probably null Het
Ercc5 T A 1: 44,220,035 (GRCm39) S1102R probably benign Het
Ergic2 T A 6: 148,091,079 (GRCm39) Y211F possibly damaging Het
Fam135b G T 15: 71,362,560 (GRCm39) L274M probably damaging Het
Fat3 G A 9: 15,909,384 (GRCm39) T2206I probably damaging Het
Fat4 A G 3: 39,037,720 (GRCm39) I3791V probably benign Het
Gemin4 A G 11: 76,104,122 (GRCm39) M213T possibly damaging Het
Gnai3 T C 3: 108,025,723 (GRCm39) M119V probably benign Het
Heatr5b A T 17: 79,080,992 (GRCm39) L1420Q probably damaging Het
Herc2 G T 7: 55,856,513 (GRCm39) G3918* probably null Het
Ints9 A G 14: 65,269,705 (GRCm39) Y465C probably damaging Het
Ist1 A G 8: 110,405,515 (GRCm39) V175A probably damaging Het
Kcnj12 T C 11: 60,960,383 (GRCm39) L227P possibly damaging Het
Kcnq5 T C 1: 21,536,611 (GRCm39) S416G probably benign Het
Kdm3a T A 6: 71,590,940 (GRCm39) T295S probably benign Het
Kif1c T A 11: 70,599,797 (GRCm39) M479K probably damaging Het
Kif20b T C 19: 34,933,438 (GRCm39) L83P probably damaging Het
Kndc1 A G 7: 139,507,624 (GRCm39) E1194G probably damaging Het
Llgl1 A G 11: 60,595,556 (GRCm39) M81V probably benign Het
Map4k5 C A 12: 69,871,436 (GRCm39) M495I probably damaging Het
Mest C T 6: 30,742,790 (GRCm39) R146C probably benign Het
Mettl24 T A 10: 40,613,812 (GRCm39) probably null Het
Mrgpra3 G T 7: 47,239,694 (GRCm39) Y77* probably null Het
Mss51 A T 14: 20,533,246 (GRCm39) C408* probably null Het
Myh6 T C 14: 55,194,858 (GRCm39) T666A probably benign Het
Myo10 T C 15: 25,805,673 (GRCm39) C1685R possibly damaging Het
Naip5 A T 13: 100,359,726 (GRCm39) Y503* probably null Het
Neil1 A C 9: 57,053,888 (GRCm39) F144C probably damaging Het
Nipbl T A 15: 8,373,001 (GRCm39) I1082F possibly damaging Het
Nkiras1 T C 14: 18,276,732 (GRCm38) V7A probably damaging Het
Nt5el C A 13: 105,218,702 (GRCm39) A12E unknown Het
Ntng2 G A 2: 29,087,069 (GRCm39) Q384* probably null Het
Ocrl T A X: 47,050,993 (GRCm39) I74N probably damaging Het
Or10j27 A G 1: 172,958,382 (GRCm39) V134A probably benign Het
Or13a22 A G 7: 140,072,622 (GRCm39) S24G probably benign Het
Or14j8 C T 17: 38,263,276 (GRCm39) G213E possibly damaging Het
Or1e22 A C 11: 73,377,200 (GRCm39) V150G probably benign Het
Or2j3 A T 17: 38,616,203 (GRCm39) S50T probably benign Het
Or2y1 A T 11: 49,385,497 (GRCm39) I46F probably damaging Het
Patj A G 4: 98,379,827 (GRCm39) D151G probably benign Het
Plpbp T C 8: 27,539,259 (GRCm39) V126A probably damaging Het
Pold2 A G 11: 5,823,454 (GRCm39) L325P possibly damaging Het
Ppp1r12c A C 7: 4,486,650 (GRCm39) S480A probably damaging Het
Pum1 T C 4: 130,428,359 (GRCm39) S124P possibly damaging Het
Pwp2 C G 10: 78,014,925 (GRCm39) G353A probably damaging Het
Reln C A 5: 22,184,000 (GRCm39) Q1666H probably damaging Het
Rnf19a T C 15: 36,266,071 (GRCm39) I9V probably benign Het
Ryr2 T C 13: 11,784,764 (GRCm39) H1063R probably benign Het
Samd14 C G 11: 94,914,426 (GRCm39) D361E probably damaging Het
Samd15 A T 12: 87,248,617 (GRCm39) N365I probably damaging Het
Sec16b A G 1: 157,358,882 (GRCm39) H105R probably benign Het
Sez6 T C 11: 77,844,329 (GRCm39) S51P probably benign Het
Sh3bp1 T A 15: 78,789,350 (GRCm39) L236Q probably damaging Het
Sspo C T 6: 48,434,274 (GRCm39) T991I probably damaging Het
Suco A T 1: 161,687,069 (GRCm39) L97* probably null Het
Tab1 C A 15: 80,032,497 (GRCm39) R35S probably benign Het
Tet3 C A 6: 83,381,145 (GRCm39) S341I possibly damaging Het
Tlr1 A T 5: 65,083,043 (GRCm39) D511E probably benign Het
Tmem132b A C 5: 125,862,963 (GRCm39) D656A probably damaging Het
Tmtc4 T A 14: 123,179,400 (GRCm39) probably null Het
Trmo T C 4: 46,380,158 (GRCm39) T404A probably damaging Het
Trpm1 A G 7: 63,880,016 (GRCm39) K790E probably damaging Het
Ulk4 C A 9: 120,997,250 (GRCm39) R774M probably null Het
Ush2a C T 1: 188,184,015 (GRCm39) L1440F probably benign Het
Usp16 A G 16: 87,277,795 (GRCm39) K682E probably damaging Het
Virma T C 4: 11,540,511 (GRCm39) S1471P probably benign Het
Vmn1r177 A T 7: 23,565,111 (GRCm39) I255N probably damaging Het
Vmn2r61 A T 7: 41,916,076 (GRCm39) R230* probably null Het
Vps13c T A 9: 67,900,295 (GRCm39) F3671L probably benign Het
Washc5 T C 15: 59,231,189 (GRCm39) N358S possibly damaging Het
Wdr72 A G 9: 74,058,899 (GRCm39) K331E probably damaging Het
Zfp986 A T 4: 145,625,805 (GRCm39) K155I probably benign Het
Other mutations in Mical1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01455:Mical1 APN 10 41,355,065 (GRCm39) critical splice donor site probably null
IGL01594:Mical1 APN 10 41,356,325 (GRCm39) missense probably damaging 1.00
IGL02065:Mical1 APN 10 41,360,407 (GRCm39) missense possibly damaging 0.55
IGL02321:Mical1 APN 10 41,362,660 (GRCm39) missense possibly damaging 0.52
IGL02323:Mical1 APN 10 41,362,660 (GRCm39) missense possibly damaging 0.52
IGL02324:Mical1 APN 10 41,362,660 (GRCm39) missense possibly damaging 0.52
IGL02327:Mical1 APN 10 41,362,660 (GRCm39) missense possibly damaging 0.52
IGL02416:Mical1 APN 10 41,360,806 (GRCm39) critical splice donor site probably null
IGL02419:Mical1 APN 10 41,358,273 (GRCm39) missense possibly damaging 0.73
IGL03027:Mical1 APN 10 41,355,501 (GRCm39) unclassified probably benign
IGL03087:Mical1 APN 10 41,358,686 (GRCm39) missense probably damaging 1.00
IGL03368:Mical1 APN 10 41,355,625 (GRCm39) missense probably damaging 0.96
IGL03387:Mical1 APN 10 41,354,195 (GRCm39) missense probably damaging 1.00
PIT1430001:Mical1 UTSW 10 41,359,492 (GRCm39) missense possibly damaging 0.55
R0433:Mical1 UTSW 10 41,355,486 (GRCm39) missense probably benign 0.15
R0617:Mical1 UTSW 10 41,357,311 (GRCm39) missense probably damaging 0.97
R0638:Mical1 UTSW 10 41,358,235 (GRCm39) missense probably benign 0.01
R1535:Mical1 UTSW 10 41,361,207 (GRCm39) missense possibly damaging 0.55
R1623:Mical1 UTSW 10 41,357,389 (GRCm39) critical splice donor site probably null
R1712:Mical1 UTSW 10 41,356,359 (GRCm39) missense probably damaging 1.00
R1806:Mical1 UTSW 10 41,354,210 (GRCm39) missense probably damaging 0.96
R1866:Mical1 UTSW 10 41,361,466 (GRCm39) missense probably benign 0.39
R2134:Mical1 UTSW 10 41,358,708 (GRCm39) missense probably damaging 1.00
R2352:Mical1 UTSW 10 41,358,229 (GRCm39) missense probably benign 0.21
R3740:Mical1 UTSW 10 41,355,067 (GRCm39) missense probably benign 0.01
R4033:Mical1 UTSW 10 41,357,172 (GRCm39) missense probably benign 0.40
R4093:Mical1 UTSW 10 41,362,933 (GRCm39) unclassified probably benign
R4184:Mical1 UTSW 10 41,357,866 (GRCm39) unclassified probably benign
R4194:Mical1 UTSW 10 41,357,624 (GRCm39) missense possibly damaging 0.88
R4659:Mical1 UTSW 10 41,362,932 (GRCm39) unclassified probably benign
R5139:Mical1 UTSW 10 41,354,411 (GRCm39) splice site probably null
R5173:Mical1 UTSW 10 41,360,985 (GRCm39) missense probably damaging 1.00
R5340:Mical1 UTSW 10 41,359,427 (GRCm39) splice site probably null
R5501:Mical1 UTSW 10 41,362,075 (GRCm39) missense probably benign 0.01
R5560:Mical1 UTSW 10 41,354,961 (GRCm39) missense probably damaging 1.00
R5726:Mical1 UTSW 10 41,359,692 (GRCm39) unclassified probably benign
R5864:Mical1 UTSW 10 41,362,064 (GRCm39) missense possibly damaging 0.88
R5905:Mical1 UTSW 10 41,362,873 (GRCm39) missense probably benign 0.00
R6028:Mical1 UTSW 10 41,362,873 (GRCm39) missense probably benign 0.00
R6047:Mical1 UTSW 10 41,357,703 (GRCm39) critical splice donor site probably null
R6074:Mical1 UTSW 10 41,362,061 (GRCm39) missense probably benign 0.27
R6458:Mical1 UTSW 10 41,360,731 (GRCm39) missense probably benign 0.44
R6879:Mical1 UTSW 10 41,360,515 (GRCm39) missense probably damaging 0.99
R6966:Mical1 UTSW 10 41,355,750 (GRCm39) missense probably damaging 0.98
R7049:Mical1 UTSW 10 41,358,246 (GRCm39) missense possibly damaging 0.63
R7095:Mical1 UTSW 10 41,355,206 (GRCm39) splice site probably null
R7156:Mical1 UTSW 10 41,361,253 (GRCm39) critical splice donor site probably null
R7312:Mical1 UTSW 10 41,355,772 (GRCm39) critical splice donor site probably null
R8021:Mical1 UTSW 10 41,358,720 (GRCm39) missense probably damaging 0.97
R8056:Mical1 UTSW 10 41,357,168 (GRCm39) missense probably damaging 1.00
R8427:Mical1 UTSW 10 41,354,591 (GRCm39) missense probably damaging 1.00
R8883:Mical1 UTSW 10 41,355,636 (GRCm39) missense
R9021:Mical1 UTSW 10 41,361,141 (GRCm39) missense probably benign 0.43
R9368:Mical1 UTSW 10 41,357,302 (GRCm39) missense possibly damaging 0.76
R9526:Mical1 UTSW 10 41,358,602 (GRCm39) missense probably benign
R9651:Mical1 UTSW 10 41,362,022 (GRCm39) critical splice acceptor site probably null
X0020:Mical1 UTSW 10 41,354,992 (GRCm39) missense probably damaging 1.00
Z1177:Mical1 UTSW 10 41,357,701 (GRCm39) missense probably null 1.00
Predicted Primers PCR Primer
(F):5'- GACAACCTTCATGCGCTCAC -3'
(R):5'- TCTGGAGTTTGCCAAGGAAAAG -3'

Sequencing Primer
(F):5'- ATGCGCTCACTCACCCC -3'
(R):5'- AAGTATAGCACTGGGGGTTCC -3'
Posted On 2014-06-23