Incidental Mutation 'R1835:Or2y1'
ID 205189
Institutional Source Beutler Lab
Gene Symbol Or2y1
Ensembl Gene ENSMUSG00000059729
Gene Name olfactory receptor family 2 subfamily Y member 1
Synonyms Olfr1385, Olfr1549-ps1, MOR256-42P, MOR256-42P, GA_x6K02T2QP88-5941817-5940888, MOR256-41P
MMRRC Submission 039862-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.117) question?
Stock # R1835 (G1)
Quality Score 225
Status Not validated
Chromosome 11
Chromosomal Location 49385362-49386291 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 49385497 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Phenylalanine at position 46 (I46F)
Ref Sequence ENSEMBL: ENSMUSP00000150035 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000071807] [ENSMUST00000214948]
AlphaFold Q7TQT1
Predicted Effect probably damaging
Transcript: ENSMUST00000071807
AA Change: I46F

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000071710
Gene: ENSMUSG00000059729
AA Change: I46F

DomainStartEndE-ValueType
Pfam:7tm_4 31 306 2.1e-46 PFAM
Pfam:7TM_GPCR_Srsx 35 214 9.5e-6 PFAM
Pfam:7tm_1 41 289 2.8e-22 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000214948
AA Change: I46F

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000216450
Coding Region Coverage
  • 1x: 97.4%
  • 3x: 96.8%
  • 10x: 94.9%
  • 20x: 91.0%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 97 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acss2 T A 2: 155,400,550 (GRCm39) Y530N probably damaging Het
Adam4 T C 12: 81,466,333 (GRCm39) I763V probably benign Het
Aipl1 T G 11: 71,921,325 (GRCm39) K190T possibly damaging Het
Alms1 T A 6: 85,655,485 (GRCm39) S3344T possibly damaging Het
Alpi A G 1: 87,027,136 (GRCm39) V381A possibly damaging Het
Ankfn1 A T 11: 89,338,444 (GRCm39) S365R probably benign Het
Aox1 G A 1: 58,348,150 (GRCm39) A623T probably benign Het
Apc T A 18: 34,450,130 (GRCm39) L2308Q probably damaging Het
Atp9b C T 18: 80,822,098 (GRCm39) V501I probably benign Het
Baz2b T C 2: 59,732,163 (GRCm39) E1994G probably benign Het
Bltp2 G T 11: 78,178,576 (GRCm39) V1993F probably damaging Het
Cacna1a T C 8: 85,307,986 (GRCm39) probably null Het
Cacna1h C A 17: 25,611,050 (GRCm39) V583L probably benign Het
Cd55 T C 1: 130,375,346 (GRCm39) probably benign Het
Cep192 T A 18: 67,937,494 (GRCm39) S75T possibly damaging Het
Cfap54 T A 10: 92,798,237 (GRCm39) D1674V probably benign Het
Churc1 T C 12: 76,820,071 (GRCm39) F27L possibly damaging Het
Coro1c A G 5: 113,986,604 (GRCm39) I280T probably benign Het
Creb1 C T 1: 64,590,109 (GRCm39) Q32* probably null Het
Cyp2b9 A G 7: 25,900,208 (GRCm39) T339A probably benign Het
Dctn3 T C 4: 41,720,813 (GRCm39) R51G probably damaging Het
Ddb1 T C 19: 10,603,957 (GRCm39) V888A probably damaging Het
Disp1 A G 1: 182,870,564 (GRCm39) Y619H probably damaging Het
Dnajc9 T C 14: 20,438,402 (GRCm39) D96G possibly damaging Het
Eepd1 A G 9: 25,394,164 (GRCm39) T143A possibly damaging Het
Eps8 T A 6: 137,499,277 (GRCm39) K204* probably null Het
Ercc5 T A 1: 44,220,035 (GRCm39) S1102R probably benign Het
Ergic2 T A 6: 148,091,079 (GRCm39) Y211F possibly damaging Het
Fam135b G T 15: 71,362,560 (GRCm39) L274M probably damaging Het
Fat3 G A 9: 15,909,384 (GRCm39) T2206I probably damaging Het
Fat4 A G 3: 39,037,720 (GRCm39) I3791V probably benign Het
Gemin4 A G 11: 76,104,122 (GRCm39) M213T possibly damaging Het
Gnai3 T C 3: 108,025,723 (GRCm39) M119V probably benign Het
Heatr5b A T 17: 79,080,992 (GRCm39) L1420Q probably damaging Het
Herc2 G T 7: 55,856,513 (GRCm39) G3918* probably null Het
Ints9 A G 14: 65,269,705 (GRCm39) Y465C probably damaging Het
Ist1 A G 8: 110,405,515 (GRCm39) V175A probably damaging Het
Kcnj12 T C 11: 60,960,383 (GRCm39) L227P possibly damaging Het
Kcnq5 T C 1: 21,536,611 (GRCm39) S416G probably benign Het
Kdm3a T A 6: 71,590,940 (GRCm39) T295S probably benign Het
Kif1c T A 11: 70,599,797 (GRCm39) M479K probably damaging Het
Kif20b T C 19: 34,933,438 (GRCm39) L83P probably damaging Het
Kndc1 A G 7: 139,507,624 (GRCm39) E1194G probably damaging Het
Llgl1 A G 11: 60,595,556 (GRCm39) M81V probably benign Het
Map4k5 C A 12: 69,871,436 (GRCm39) M495I probably damaging Het
Mest C T 6: 30,742,790 (GRCm39) R146C probably benign Het
Mettl24 T A 10: 40,613,812 (GRCm39) probably null Het
Mical1 T C 10: 41,359,531 (GRCm39) S586P probably benign Het
Mrgpra3 G T 7: 47,239,694 (GRCm39) Y77* probably null Het
Mss51 A T 14: 20,533,246 (GRCm39) C408* probably null Het
Myh6 T C 14: 55,194,858 (GRCm39) T666A probably benign Het
Myo10 T C 15: 25,805,673 (GRCm39) C1685R possibly damaging Het
Naip5 A T 13: 100,359,726 (GRCm39) Y503* probably null Het
Neil1 A C 9: 57,053,888 (GRCm39) F144C probably damaging Het
Nipbl T A 15: 8,373,001 (GRCm39) I1082F possibly damaging Het
Nkiras1 T C 14: 18,276,732 (GRCm38) V7A probably damaging Het
Nt5el C A 13: 105,218,702 (GRCm39) A12E unknown Het
Ntng2 G A 2: 29,087,069 (GRCm39) Q384* probably null Het
Ocrl T A X: 47,050,993 (GRCm39) I74N probably damaging Het
Or10j27 A G 1: 172,958,382 (GRCm39) V134A probably benign Het
Or13a22 A G 7: 140,072,622 (GRCm39) S24G probably benign Het
Or14j8 C T 17: 38,263,276 (GRCm39) G213E possibly damaging Het
Or1e22 A C 11: 73,377,200 (GRCm39) V150G probably benign Het
Or2j3 A T 17: 38,616,203 (GRCm39) S50T probably benign Het
Patj A G 4: 98,379,827 (GRCm39) D151G probably benign Het
Plpbp T C 8: 27,539,259 (GRCm39) V126A probably damaging Het
Pold2 A G 11: 5,823,454 (GRCm39) L325P possibly damaging Het
Ppp1r12c A C 7: 4,486,650 (GRCm39) S480A probably damaging Het
Pum1 T C 4: 130,428,359 (GRCm39) S124P possibly damaging Het
Pwp2 C G 10: 78,014,925 (GRCm39) G353A probably damaging Het
Reln C A 5: 22,184,000 (GRCm39) Q1666H probably damaging Het
Rnf19a T C 15: 36,266,071 (GRCm39) I9V probably benign Het
Ryr2 T C 13: 11,784,764 (GRCm39) H1063R probably benign Het
Samd14 C G 11: 94,914,426 (GRCm39) D361E probably damaging Het
Samd15 A T 12: 87,248,617 (GRCm39) N365I probably damaging Het
Sec16b A G 1: 157,358,882 (GRCm39) H105R probably benign Het
Sez6 T C 11: 77,844,329 (GRCm39) S51P probably benign Het
Sh3bp1 T A 15: 78,789,350 (GRCm39) L236Q probably damaging Het
Sspo C T 6: 48,434,274 (GRCm39) T991I probably damaging Het
Suco A T 1: 161,687,069 (GRCm39) L97* probably null Het
Tab1 C A 15: 80,032,497 (GRCm39) R35S probably benign Het
Tet3 C A 6: 83,381,145 (GRCm39) S341I possibly damaging Het
Tlr1 A T 5: 65,083,043 (GRCm39) D511E probably benign Het
Tmem132b A C 5: 125,862,963 (GRCm39) D656A probably damaging Het
Tmtc4 T A 14: 123,179,400 (GRCm39) probably null Het
Trmo T C 4: 46,380,158 (GRCm39) T404A probably damaging Het
Trpm1 A G 7: 63,880,016 (GRCm39) K790E probably damaging Het
Ulk4 C A 9: 120,997,250 (GRCm39) R774M probably null Het
Ush2a C T 1: 188,184,015 (GRCm39) L1440F probably benign Het
Usp16 A G 16: 87,277,795 (GRCm39) K682E probably damaging Het
Virma T C 4: 11,540,511 (GRCm39) S1471P probably benign Het
Vmn1r177 A T 7: 23,565,111 (GRCm39) I255N probably damaging Het
Vmn2r61 A T 7: 41,916,076 (GRCm39) R230* probably null Het
Vps13c T A 9: 67,900,295 (GRCm39) F3671L probably benign Het
Washc5 T C 15: 59,231,189 (GRCm39) N358S possibly damaging Het
Wdr72 A G 9: 74,058,899 (GRCm39) K331E probably damaging Het
Zfp986 A T 4: 145,625,805 (GRCm39) K155I probably benign Het
Other mutations in Or2y1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01722:Or2y1 APN 11 49,385,793 (GRCm39) missense probably damaging 0.99
IGL02098:Or2y1 APN 11 49,386,224 (GRCm39) missense probably damaging 1.00
IGL03206:Or2y1 APN 11 49,385,536 (GRCm39) missense probably benign 0.05
IGL03402:Or2y1 APN 11 49,385,873 (GRCm39) missense probably benign
R0412:Or2y1 UTSW 11 49,385,594 (GRCm39) missense probably damaging 1.00
R1263:Or2y1 UTSW 11 49,385,848 (GRCm39) missense probably benign
R1371:Or2y1 UTSW 11 49,385,650 (GRCm39) missense probably damaging 1.00
R1488:Or2y1 UTSW 11 49,385,945 (GRCm39) missense probably benign 0.07
R1923:Or2y1 UTSW 11 49,386,131 (GRCm39) missense probably damaging 0.97
R2290:Or2y1 UTSW 11 49,385,857 (GRCm39) missense probably benign
R3738:Or2y1 UTSW 11 49,386,287 (GRCm39) missense possibly damaging 0.56
R3739:Or2y1 UTSW 11 49,386,287 (GRCm39) missense possibly damaging 0.56
R4034:Or2y1 UTSW 11 49,386,287 (GRCm39) missense possibly damaging 0.56
R4193:Or2y1 UTSW 11 49,386,134 (GRCm39) missense probably damaging 1.00
R4406:Or2y1 UTSW 11 49,385,744 (GRCm39) missense probably benign 0.01
R5239:Or2y1 UTSW 11 49,385,555 (GRCm39) missense possibly damaging 0.93
R6713:Or2y1 UTSW 11 49,385,784 (GRCm39) missense probably damaging 1.00
R6861:Or2y1 UTSW 11 49,385,632 (GRCm39) missense probably benign 0.00
R7916:Or2y1 UTSW 11 49,385,543 (GRCm39) missense probably benign
R8712:Or2y1 UTSW 11 49,385,671 (GRCm39) missense probably benign
R9509:Or2y1 UTSW 11 49,385,476 (GRCm39) missense probably benign
R9624:Or2y1 UTSW 11 49,385,834 (GRCm39) missense possibly damaging 0.94
R9793:Or2y1 UTSW 11 49,385,882 (GRCm39) missense probably damaging 1.00
R9795:Or2y1 UTSW 11 49,385,882 (GRCm39) missense probably damaging 1.00
Z1176:Or2y1 UTSW 11 49,385,894 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GAAATCAAAGGGCCTGGTTCAG -3'
(R):5'- TGAAAAGCTGGGCCACACAC -3'

Sequencing Primer
(F):5'- AGTGGGCACTAAGTTAATACCCTG -3'
(R):5'- CACACCCTCCATAGCTGATG -3'
Posted On 2014-06-23