Incidental Mutation 'R1835:Llgl1'
ID 205190
Institutional Source Beutler Lab
Gene Symbol Llgl1
Ensembl Gene ENSMUSG00000020536
Gene Name LLGL1 scribble cell polarity complex component
Synonyms Lgl1
MMRRC Submission 039862-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R1835 (G1)
Quality Score 225
Status Not validated
Chromosome 11
Chromosomal Location 60590549-60605012 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 60595556 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Methionine to Valine at position 81 (M81V)
Ref Sequence ENSEMBL: ENSMUSP00000104359 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000052346] [ENSMUST00000108719]
AlphaFold Q80Y17
Predicted Effect probably benign
Transcript: ENSMUST00000052346
AA Change: M81V

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000060749
Gene: ENSMUSG00000020536
AA Change: M81V

DomainStartEndE-ValueType
WD40 22 62 4.42e1 SMART
WD40 64 103 1.65e1 SMART
WD40 187 223 2.74e2 SMART
WD40 226 264 2.06e0 SMART
Pfam:LLGL 278 379 1.2e-43 PFAM
WD40 424 460 3.2e0 SMART
Blast:WD40 498 541 2e-13 BLAST
Blast:WD40 585 624 4e-9 BLAST
Pfam:Lgl_C 732 978 1.2e-7 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000108719
AA Change: M81V

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000104359
Gene: ENSMUSG00000020536
AA Change: M81V

DomainStartEndE-ValueType
WD40 22 62 4.42e1 SMART
WD40 64 103 1.65e1 SMART
WD40 187 223 2.74e2 SMART
WD40 226 264 2.06e0 SMART
Pfam:LLGL 275 379 2e-48 PFAM
WD40 424 460 3.2e0 SMART
Blast:WD40 498 540 2e-13 BLAST
Blast:WD40 585 624 4e-9 BLAST
Pfam:Lgl_C 804 976 1.3e-8 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128749
Coding Region Coverage
  • 1x: 97.4%
  • 3x: 96.8%
  • 10x: 94.9%
  • 20x: 91.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that is similar to a tumor suppressor in Drosophila. The protein is part of a cytoskeletal network and is associated with nonmuscle myosin II heavy chain and a kinase that specifically phosphorylates this protein at serine residues. The gene is located within the Smith-Magenis syndrome region on chromosome 17. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous mutant mice die neonatally exhibiting hydroencephaly. Neural progenitor cell physiology is abnormal, resulting in a loss of cell polarity and the development of neuroepithelial rosette-like structures throughout the brain. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 97 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acss2 T A 2: 155,400,550 (GRCm39) Y530N probably damaging Het
Adam4 T C 12: 81,466,333 (GRCm39) I763V probably benign Het
Aipl1 T G 11: 71,921,325 (GRCm39) K190T possibly damaging Het
Alms1 T A 6: 85,655,485 (GRCm39) S3344T possibly damaging Het
Alpi A G 1: 87,027,136 (GRCm39) V381A possibly damaging Het
Ankfn1 A T 11: 89,338,444 (GRCm39) S365R probably benign Het
Aox1 G A 1: 58,348,150 (GRCm39) A623T probably benign Het
Apc T A 18: 34,450,130 (GRCm39) L2308Q probably damaging Het
Atp9b C T 18: 80,822,098 (GRCm39) V501I probably benign Het
Baz2b T C 2: 59,732,163 (GRCm39) E1994G probably benign Het
Bltp2 G T 11: 78,178,576 (GRCm39) V1993F probably damaging Het
Cacna1a T C 8: 85,307,986 (GRCm39) probably null Het
Cacna1h C A 17: 25,611,050 (GRCm39) V583L probably benign Het
Cd55 T C 1: 130,375,346 (GRCm39) probably benign Het
Cep192 T A 18: 67,937,494 (GRCm39) S75T possibly damaging Het
Cfap54 T A 10: 92,798,237 (GRCm39) D1674V probably benign Het
Churc1 T C 12: 76,820,071 (GRCm39) F27L possibly damaging Het
Coro1c A G 5: 113,986,604 (GRCm39) I280T probably benign Het
Creb1 C T 1: 64,590,109 (GRCm39) Q32* probably null Het
Cyp2b9 A G 7: 25,900,208 (GRCm39) T339A probably benign Het
Dctn3 T C 4: 41,720,813 (GRCm39) R51G probably damaging Het
Ddb1 T C 19: 10,603,957 (GRCm39) V888A probably damaging Het
Disp1 A G 1: 182,870,564 (GRCm39) Y619H probably damaging Het
Dnajc9 T C 14: 20,438,402 (GRCm39) D96G possibly damaging Het
Eepd1 A G 9: 25,394,164 (GRCm39) T143A possibly damaging Het
Eps8 T A 6: 137,499,277 (GRCm39) K204* probably null Het
Ercc5 T A 1: 44,220,035 (GRCm39) S1102R probably benign Het
Ergic2 T A 6: 148,091,079 (GRCm39) Y211F possibly damaging Het
Fam135b G T 15: 71,362,560 (GRCm39) L274M probably damaging Het
Fat3 G A 9: 15,909,384 (GRCm39) T2206I probably damaging Het
Fat4 A G 3: 39,037,720 (GRCm39) I3791V probably benign Het
Gemin4 A G 11: 76,104,122 (GRCm39) M213T possibly damaging Het
Gnai3 T C 3: 108,025,723 (GRCm39) M119V probably benign Het
Heatr5b A T 17: 79,080,992 (GRCm39) L1420Q probably damaging Het
Herc2 G T 7: 55,856,513 (GRCm39) G3918* probably null Het
Ints9 A G 14: 65,269,705 (GRCm39) Y465C probably damaging Het
Ist1 A G 8: 110,405,515 (GRCm39) V175A probably damaging Het
Kcnj12 T C 11: 60,960,383 (GRCm39) L227P possibly damaging Het
Kcnq5 T C 1: 21,536,611 (GRCm39) S416G probably benign Het
Kdm3a T A 6: 71,590,940 (GRCm39) T295S probably benign Het
Kif1c T A 11: 70,599,797 (GRCm39) M479K probably damaging Het
Kif20b T C 19: 34,933,438 (GRCm39) L83P probably damaging Het
Kndc1 A G 7: 139,507,624 (GRCm39) E1194G probably damaging Het
Map4k5 C A 12: 69,871,436 (GRCm39) M495I probably damaging Het
Mest C T 6: 30,742,790 (GRCm39) R146C probably benign Het
Mettl24 T A 10: 40,613,812 (GRCm39) probably null Het
Mical1 T C 10: 41,359,531 (GRCm39) S586P probably benign Het
Mrgpra3 G T 7: 47,239,694 (GRCm39) Y77* probably null Het
Mss51 A T 14: 20,533,246 (GRCm39) C408* probably null Het
Myh6 T C 14: 55,194,858 (GRCm39) T666A probably benign Het
Myo10 T C 15: 25,805,673 (GRCm39) C1685R possibly damaging Het
Naip5 A T 13: 100,359,726 (GRCm39) Y503* probably null Het
Neil1 A C 9: 57,053,888 (GRCm39) F144C probably damaging Het
Nipbl T A 15: 8,373,001 (GRCm39) I1082F possibly damaging Het
Nkiras1 T C 14: 18,276,732 (GRCm38) V7A probably damaging Het
Nt5el C A 13: 105,218,702 (GRCm39) A12E unknown Het
Ntng2 G A 2: 29,087,069 (GRCm39) Q384* probably null Het
Ocrl T A X: 47,050,993 (GRCm39) I74N probably damaging Het
Or10j27 A G 1: 172,958,382 (GRCm39) V134A probably benign Het
Or13a22 A G 7: 140,072,622 (GRCm39) S24G probably benign Het
Or14j8 C T 17: 38,263,276 (GRCm39) G213E possibly damaging Het
Or1e22 A C 11: 73,377,200 (GRCm39) V150G probably benign Het
Or2j3 A T 17: 38,616,203 (GRCm39) S50T probably benign Het
Or2y1 A T 11: 49,385,497 (GRCm39) I46F probably damaging Het
Patj A G 4: 98,379,827 (GRCm39) D151G probably benign Het
Plpbp T C 8: 27,539,259 (GRCm39) V126A probably damaging Het
Pold2 A G 11: 5,823,454 (GRCm39) L325P possibly damaging Het
Ppp1r12c A C 7: 4,486,650 (GRCm39) S480A probably damaging Het
Pum1 T C 4: 130,428,359 (GRCm39) S124P possibly damaging Het
Pwp2 C G 10: 78,014,925 (GRCm39) G353A probably damaging Het
Reln C A 5: 22,184,000 (GRCm39) Q1666H probably damaging Het
Rnf19a T C 15: 36,266,071 (GRCm39) I9V probably benign Het
Ryr2 T C 13: 11,784,764 (GRCm39) H1063R probably benign Het
Samd14 C G 11: 94,914,426 (GRCm39) D361E probably damaging Het
Samd15 A T 12: 87,248,617 (GRCm39) N365I probably damaging Het
Sec16b A G 1: 157,358,882 (GRCm39) H105R probably benign Het
Sez6 T C 11: 77,844,329 (GRCm39) S51P probably benign Het
Sh3bp1 T A 15: 78,789,350 (GRCm39) L236Q probably damaging Het
Sspo C T 6: 48,434,274 (GRCm39) T991I probably damaging Het
Suco A T 1: 161,687,069 (GRCm39) L97* probably null Het
Tab1 C A 15: 80,032,497 (GRCm39) R35S probably benign Het
Tet3 C A 6: 83,381,145 (GRCm39) S341I possibly damaging Het
Tlr1 A T 5: 65,083,043 (GRCm39) D511E probably benign Het
Tmem132b A C 5: 125,862,963 (GRCm39) D656A probably damaging Het
Tmtc4 T A 14: 123,179,400 (GRCm39) probably null Het
Trmo T C 4: 46,380,158 (GRCm39) T404A probably damaging Het
Trpm1 A G 7: 63,880,016 (GRCm39) K790E probably damaging Het
Ulk4 C A 9: 120,997,250 (GRCm39) R774M probably null Het
Ush2a C T 1: 188,184,015 (GRCm39) L1440F probably benign Het
Usp16 A G 16: 87,277,795 (GRCm39) K682E probably damaging Het
Virma T C 4: 11,540,511 (GRCm39) S1471P probably benign Het
Vmn1r177 A T 7: 23,565,111 (GRCm39) I255N probably damaging Het
Vmn2r61 A T 7: 41,916,076 (GRCm39) R230* probably null Het
Vps13c T A 9: 67,900,295 (GRCm39) F3671L probably benign Het
Washc5 T C 15: 59,231,189 (GRCm39) N358S possibly damaging Het
Wdr72 A G 9: 74,058,899 (GRCm39) K331E probably damaging Het
Zfp986 A T 4: 145,625,805 (GRCm39) K155I probably benign Het
Other mutations in Llgl1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01137:Llgl1 APN 11 60,600,825 (GRCm39) missense probably benign 0.38
IGL01400:Llgl1 APN 11 60,597,316 (GRCm39) missense probably damaging 1.00
IGL03066:Llgl1 APN 11 60,596,860 (GRCm39) missense possibly damaging 0.75
IGL03174:Llgl1 APN 11 60,597,036 (GRCm39) missense probably benign 0.15
IGL03306:Llgl1 APN 11 60,602,180 (GRCm39) missense possibly damaging 0.92
R0284:Llgl1 UTSW 11 60,602,967 (GRCm39) missense probably damaging 0.98
R1137:Llgl1 UTSW 11 60,595,559 (GRCm39) missense probably benign 0.01
R1432:Llgl1 UTSW 11 60,599,380 (GRCm39) missense probably damaging 1.00
R1769:Llgl1 UTSW 11 60,597,873 (GRCm39) missense probably damaging 1.00
R1786:Llgl1 UTSW 11 60,598,066 (GRCm39) missense probably benign 0.19
R1943:Llgl1 UTSW 11 60,596,842 (GRCm39) missense probably benign
R2197:Llgl1 UTSW 11 60,600,865 (GRCm39) missense possibly damaging 0.62
R2510:Llgl1 UTSW 11 60,600,862 (GRCm39) missense probably damaging 1.00
R2568:Llgl1 UTSW 11 60,599,638 (GRCm39) missense probably damaging 1.00
R3690:Llgl1 UTSW 11 60,597,828 (GRCm39) missense probably damaging 1.00
R3853:Llgl1 UTSW 11 60,598,075 (GRCm39) missense probably damaging 1.00
R4079:Llgl1 UTSW 11 60,601,110 (GRCm39) splice site probably null
R4259:Llgl1 UTSW 11 60,600,394 (GRCm39) missense probably benign
R4348:Llgl1 UTSW 11 60,600,394 (GRCm39) missense probably benign
R4349:Llgl1 UTSW 11 60,600,394 (GRCm39) missense probably benign
R4352:Llgl1 UTSW 11 60,600,394 (GRCm39) missense probably benign
R4353:Llgl1 UTSW 11 60,600,394 (GRCm39) missense probably benign
R4396:Llgl1 UTSW 11 60,596,834 (GRCm39) missense probably benign
R4584:Llgl1 UTSW 11 60,602,908 (GRCm39) missense probably damaging 0.99
R4594:Llgl1 UTSW 11 60,597,147 (GRCm39) missense probably benign 0.15
R4628:Llgl1 UTSW 11 60,600,811 (GRCm39) missense probably damaging 1.00
R4651:Llgl1 UTSW 11 60,599,477 (GRCm39) missense possibly damaging 0.80
R4653:Llgl1 UTSW 11 60,599,477 (GRCm39) missense possibly damaging 0.80
R4731:Llgl1 UTSW 11 60,597,051 (GRCm39) nonsense probably null
R4869:Llgl1 UTSW 11 60,598,036 (GRCm39) nonsense probably null
R4898:Llgl1 UTSW 11 60,600,394 (GRCm39) missense probably benign
R4899:Llgl1 UTSW 11 60,600,394 (GRCm39) missense probably benign
R4939:Llgl1 UTSW 11 60,600,805 (GRCm39) critical splice acceptor site probably null
R4941:Llgl1 UTSW 11 60,600,394 (GRCm39) missense probably benign
R4942:Llgl1 UTSW 11 60,600,394 (GRCm39) missense probably benign
R4958:Llgl1 UTSW 11 60,602,261 (GRCm39) missense probably benign 0.02
R4995:Llgl1 UTSW 11 60,600,550 (GRCm39) missense probably benign 0.00
R4997:Llgl1 UTSW 11 60,600,394 (GRCm39) missense probably benign
R5177:Llgl1 UTSW 11 60,602,833 (GRCm39) missense possibly damaging 0.94
R5257:Llgl1 UTSW 11 60,602,389 (GRCm39) splice site probably null
R5258:Llgl1 UTSW 11 60,602,389 (GRCm39) splice site probably null
R5401:Llgl1 UTSW 11 60,597,297 (GRCm39) missense probably benign
R5406:Llgl1 UTSW 11 60,604,010 (GRCm39) missense probably damaging 0.99
R5432:Llgl1 UTSW 11 60,598,449 (GRCm39) missense probably benign
R5587:Llgl1 UTSW 11 60,601,168 (GRCm39) missense probably benign 0.00
R5732:Llgl1 UTSW 11 60,600,286 (GRCm39) missense probably benign 0.00
R5758:Llgl1 UTSW 11 60,599,393 (GRCm39) missense probably damaging 1.00
R5879:Llgl1 UTSW 11 60,603,806 (GRCm39) missense probably benign 0.00
R6268:Llgl1 UTSW 11 60,602,989 (GRCm39) missense probably benign 0.13
R6286:Llgl1 UTSW 11 60,600,358 (GRCm39) missense probably damaging 1.00
R6455:Llgl1 UTSW 11 60,600,486 (GRCm39) missense probably damaging 0.98
R6805:Llgl1 UTSW 11 60,593,691 (GRCm39) missense probably benign 0.25
R6929:Llgl1 UTSW 11 60,601,179 (GRCm39) nonsense probably null
R7274:Llgl1 UTSW 11 60,596,812 (GRCm39) missense possibly damaging 0.89
R7889:Llgl1 UTSW 11 60,598,138 (GRCm39) missense probably damaging 1.00
R7986:Llgl1 UTSW 11 60,602,221 (GRCm39) missense probably benign 0.16
R8141:Llgl1 UTSW 11 60,601,142 (GRCm39) missense probably benign 0.02
R8176:Llgl1 UTSW 11 60,597,387 (GRCm39) missense probably benign 0.27
R8223:Llgl1 UTSW 11 60,593,648 (GRCm39) missense possibly damaging 0.86
R8332:Llgl1 UTSW 11 60,601,210 (GRCm39) missense possibly damaging 0.90
R8350:Llgl1 UTSW 11 60,602,947 (GRCm39) missense probably damaging 1.00
R8500:Llgl1 UTSW 11 60,595,809 (GRCm39) critical splice donor site probably null
R8979:Llgl1 UTSW 11 60,601,129 (GRCm39) missense probably benign 0.25
R9155:Llgl1 UTSW 11 60,597,934 (GRCm39) missense probably benign 0.00
R9163:Llgl1 UTSW 11 60,600,402 (GRCm39) missense probably benign 0.02
R9225:Llgl1 UTSW 11 60,600,889 (GRCm39) missense probably damaging 1.00
R9234:Llgl1 UTSW 11 60,600,956 (GRCm39) critical splice donor site probably null
Z1186:Llgl1 UTSW 11 60,603,923 (GRCm39) frame shift probably null
Z1187:Llgl1 UTSW 11 60,603,923 (GRCm39) frame shift probably null
Z1188:Llgl1 UTSW 11 60,603,923 (GRCm39) frame shift probably null
Z1189:Llgl1 UTSW 11 60,603,923 (GRCm39) frame shift probably null
Z1190:Llgl1 UTSW 11 60,603,923 (GRCm39) frame shift probably null
Z1191:Llgl1 UTSW 11 60,603,923 (GRCm39) frame shift probably null
Z1192:Llgl1 UTSW 11 60,603,923 (GRCm39) frame shift probably null
Predicted Primers PCR Primer
(F):5'- CCTCAGATACAGGAGCAGAGTTG -3'
(R):5'- AAAACTGGGTCTGCTGGGTG -3'

Sequencing Primer
(F):5'- GCAGAGTTGCTTTAGGAAGTG -3'
(R):5'- CATTATGATGGATGATCTCCCAGAG -3'
Posted On 2014-06-23