Mutagenetix > Incidental Mutation

Incidental Mutation 'R1835:Llgl1'

205190

Institutional Source

Beutler Lab

Gene Symbol

Llgl1

Ensembl Gene

ENSMUSG00000020536

Gene Name

LLGL1 scribble cell polarity complex component

Synonyms

Lgl1

MMRRC Submission

039862-MU

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R1835 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

60699723-60714186 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 60704730 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Methionine to Valine at position 81 (M81V)

Ref Sequence

ENSEMBL: ENSMUSP00000104359 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000052346] [ENSMUST00000108719]

AlphaFold

Q80Y17

Predicted Effect

probably benign
Transcript: ENSMUST00000052346
AA Change: M81V

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)

SMART Domains

Protein: ENSMUSP00000060749
Gene: ENSMUSG00000020536
AA Change: M81V

Domain	Start	End	E-Value	Type
WD40	22	62	4.42e1	SMART
WD40	64	103	1.65e1	SMART
WD40	187	223	2.74e2	SMART
WD40	226	264	2.06e0	SMART
Pfam:LLGL	278	379	1.2e-43	PFAM
WD40	424	460	3.2e0	SMART
Blast:WD40	498	541	2e-13	BLAST
Blast:WD40	585	624	4e-9	BLAST
Pfam:Lgl_C	732	978	1.2e-7	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000108719
AA Change: M81V

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)

SMART Domains

Protein: ENSMUSP00000104359
Gene: ENSMUSG00000020536
AA Change: M81V

Domain	Start	End	E-Value	Type
WD40	22	62	4.42e1	SMART
WD40	64	103	1.65e1	SMART
WD40	187	223	2.74e2	SMART
WD40	226	264	2.06e0	SMART
Pfam:LLGL	275	379	2e-48	PFAM
WD40	424	460	3.2e0	SMART
Blast:WD40	498	540	2e-13	BLAST
Blast:WD40	585	624	4e-9	BLAST
Pfam:Lgl_C	804	976	1.3e-8	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000128749

Coding Region Coverage

1x: 97.4%
3x: 96.8%
10x: 94.9%
20x: 91.0%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that is similar to a tumor suppressor in Drosophila. The protein is part of a cytoskeletal network and is associated with nonmuscle myosin II heavy chain and a kinase that specifically phosphorylates this protein at serine residues. The gene is located within the Smith-Magenis syndrome region on chromosome 17. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous mutant mice die neonatally exhibiting hydroencephaly. Neural progenitor cell physiology is abnormal, resulting in a loss of cell polarity and the development of neuroepithelial rosette-like structures throughout the brain. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 97 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2610507B11Rik	G	T	11: 78,287,750	V1993F	probably damaging	Het
4933425L06Rik	C	A	13: 105,082,194	A12E	unknown	Het
Acss2	T	A	2: 155,558,630	Y530N	probably damaging	Het
Adam4	T	C	12: 81,419,559	I763V	probably benign	Het
Aipl1	T	G	11: 72,030,499	K190T	possibly damaging	Het
Alms1	T	A	6: 85,678,503	S3344T	possibly damaging	Het
Alpi	A	G	1: 87,099,414	V381A	possibly damaging	Het
Ankfn1	A	T	11: 89,447,618	S365R	probably benign	Het
Aox2	G	A	1: 58,308,991	A623T	probably benign	Het
Apc	T	A	18: 34,317,077	L2308Q	probably damaging	Het
Atp9b	C	T	18: 80,778,883	V501I	probably benign	Het
Baz2b	T	C	2: 59,901,819	E1994G	probably benign	Het
Cacna1a	T	C	8: 84,581,357		probably null	Het
Cacna1h	C	A	17: 25,392,076	V583L	probably benign	Het
Cd55	T	C	1: 130,447,609		probably benign	Het
Cep192	T	A	18: 67,804,424	S75T	possibly damaging	Het
Cfap54	T	A	10: 92,962,375	D1674V	probably benign	Het
Churc1	T	C	12: 76,773,297	F27L	possibly damaging	Het
Coro1c	A	G	5: 113,848,543	I280T	probably benign	Het
Creb1	C	T	1: 64,550,950	Q32*	probably null	Het
Cyp2b9	A	G	7: 26,200,783	T339A	probably benign	Het
Dctn3	T	C	4: 41,720,813	R51G	probably damaging	Het
Ddb1	T	C	19: 10,626,593	V888A	probably damaging	Het
Disp1	A	G	1: 183,089,000	Y619H	probably damaging	Het
Dnajc9	T	C	14: 20,388,334	D96G	possibly damaging	Het
Eepd1	A	G	9: 25,482,868	T143A	possibly damaging	Het
Eps8	T	A	6: 137,522,279	K204*	probably null	Het
Ercc5	T	A	1: 44,180,875	S1102R	probably benign	Het
Ergic2	T	A	6: 148,189,581	Y211F	possibly damaging	Het
Fam135b	G	T	15: 71,490,711	L274M	probably damaging	Het
Fat3	G	A	9: 15,998,088	T2206I	probably damaging	Het
Fat4	A	G	3: 38,983,571	I3791V	probably benign	Het
Gemin4	A	G	11: 76,213,296	M213T	possibly damaging	Het
Gnai3	T	C	3: 108,118,407	M119V	probably benign	Het
Heatr5b	A	T	17: 78,773,563	L1420Q	probably damaging	Het
Herc2	G	T	7: 56,206,765	G3918*	probably null	Het
Ints9	A	G	14: 65,032,256	Y465C	probably damaging	Het
Ist1	A	G	8: 109,678,883	V175A	probably damaging	Het
Kcnj12	T	C	11: 61,069,557	L227P	possibly damaging	Het
Kcnq5	T	C	1: 21,466,387	S416G	probably benign	Het
Kdm3a	T	A	6: 71,613,956	T295S	probably benign	Het
Kif1c	T	A	11: 70,708,971	M479K	probably damaging	Het
Kif20b	T	C	19: 34,956,038	L83P	probably damaging	Het
Kndc1	A	G	7: 139,927,711	E1194G	probably damaging	Het
Map4k5	C	A	12: 69,824,662	M495I	probably damaging	Het
Mest	C	T	6: 30,742,791	R146C	probably benign	Het
Mettl24	T	A	10: 40,737,816		probably null	Het
Mical1	T	C	10: 41,483,535	S586P	probably benign	Het
Mrgpra3	G	T	7: 47,589,946	Y77*	probably null	Het
Mss51	A	T	14: 20,483,178	C408*	probably null	Het
Myh6	T	C	14: 54,957,401	T666A	probably benign	Het
Myo10	T	C	15: 25,805,587	C1685R	possibly damaging	Het
Naip5	A	T	13: 100,223,218	Y503*	probably null	Het
Neil1	A	C	9: 57,146,604	F144C	probably damaging	Het
Nipbl	T	A	15: 8,343,517	I1082F	possibly damaging	Het
Nkiras1	T	C	14: 18,276,732	V7A	probably damaging	Het
Ntng2	G	A	2: 29,197,057	Q384*	probably null	Het
Ocrl	T	A	X: 47,962,116	I74N	probably damaging	Het
Olfr137	A	T	17: 38,305,312	S50T	probably benign	Het
Olfr1385	A	T	11: 49,494,670	I46F	probably damaging	Het
Olfr1408	A	G	1: 173,130,815	V134A	probably benign	Het
Olfr381	A	C	11: 73,486,374	V150G	probably benign	Het
Olfr535	A	G	7: 140,492,709	S24G	probably benign	Het
Olfr761	C	T	17: 37,952,385	G213E	possibly damaging	Het
Patj	A	G	4: 98,491,590	D151G	probably benign	Het
Plpbp	T	C	8: 27,049,231	V126A	probably damaging	Het
Pold2	A	G	11: 5,873,454	L325P	possibly damaging	Het
Ppp1r12c	A	C	7: 4,483,651	S480A	probably damaging	Het
Pum1	T	C	4: 130,701,048	S124P	possibly damaging	Het
Pwp2	C	G	10: 78,179,091	G353A	probably damaging	Het
Reln	C	A	5: 21,979,002	Q1666H	probably damaging	Het
Rnf19a	T	C	15: 36,265,925	I9V	probably benign	Het
Ryr2	T	C	13: 11,769,878	H1063R	probably benign	Het
Samd14	C	G	11: 95,023,600	D361E	probably damaging	Het
Samd15	A	T	12: 87,201,843	N365I	probably damaging	Het
Sec16b	A	G	1: 157,531,312	H105R	probably benign	Het
Sez6	T	C	11: 77,953,503	S51P	probably benign	Het
Sh3bp1	T	A	15: 78,905,150	L236Q	probably damaging	Het
Sspo	C	T	6: 48,457,340	T991I	probably damaging	Het
Suco	A	T	1: 161,859,500	L97*	probably null	Het
Tab1	C	A	15: 80,148,296	R35S	probably benign	Het
Tet3	C	A	6: 83,404,163	S341I	possibly damaging	Het
Tlr1	A	T	5: 64,925,700	D511E	probably benign	Het
Tmem132b	A	C	5: 125,785,899	D656A	probably damaging	Het
Tmtc4	T	A	14: 122,941,988		probably null	Het
Trmo	T	C	4: 46,380,158	T404A	probably damaging	Het
Trpm1	A	G	7: 64,230,268	K790E	probably damaging	Het
Ulk4	C	A	9: 121,168,184	R774M	probably null	Het
Ush2a	C	T	1: 188,451,818	L1440F	probably benign	Het
Usp16	A	G	16: 87,480,907	K682E	probably damaging	Het
Virma	T	C	4: 11,540,511	S1471P	probably benign	Het
Vmn1r177	A	T	7: 23,865,686	I255N	probably damaging	Het
Vmn2r61	A	T	7: 42,266,652	R230*	probably null	Het
Vps13c	T	A	9: 67,993,013	F3671L	probably benign	Het
Washc5	T	C	15: 59,359,340	N358S	possibly damaging	Het
Wdr72	A	G	9: 74,151,617	K331E	probably damaging	Het
Zfp986	A	T	4: 145,899,235	K155I	probably benign	Het

Other mutations in Llgl1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01137:Llgl1	APN	11	60709999	missense	probably benign	0.38
IGL01400:Llgl1	APN	11	60706490	missense	probably damaging	1.00
IGL03066:Llgl1	APN	11	60706034	missense	possibly damaging	0.75
IGL03174:Llgl1	APN	11	60706210	missense	probably benign	0.15
IGL03306:Llgl1	APN	11	60711354	missense	possibly damaging	0.92
R0284:Llgl1	UTSW	11	60712141	missense	probably damaging	0.98
R1137:Llgl1	UTSW	11	60704733	missense	probably benign	0.01
R1432:Llgl1	UTSW	11	60708554	missense	probably damaging	1.00
R1769:Llgl1	UTSW	11	60707047	missense	probably damaging	1.00
R1786:Llgl1	UTSW	11	60707240	missense	probably benign	0.19
R1943:Llgl1	UTSW	11	60706016	missense	probably benign
R2197:Llgl1	UTSW	11	60710039	missense	possibly damaging	0.62
R2510:Llgl1	UTSW	11	60710036	missense	probably damaging	1.00
R2568:Llgl1	UTSW	11	60708812	missense	probably damaging	1.00
R3690:Llgl1	UTSW	11	60707002	missense	probably damaging	1.00
R3853:Llgl1	UTSW	11	60707249	missense	probably damaging	1.00
R4079:Llgl1	UTSW	11	60710284	splice site	probably null
R4259:Llgl1	UTSW	11	60709568	missense	probably benign
R4348:Llgl1	UTSW	11	60709568	missense	probably benign
R4349:Llgl1	UTSW	11	60709568	missense	probably benign
R4352:Llgl1	UTSW	11	60709568	missense	probably benign
R4353:Llgl1	UTSW	11	60709568	missense	probably benign
R4396:Llgl1	UTSW	11	60706008	missense	probably benign
R4584:Llgl1	UTSW	11	60712082	missense	probably damaging	0.99
R4594:Llgl1	UTSW	11	60706321	missense	probably benign	0.15
R4628:Llgl1	UTSW	11	60709985	missense	probably damaging	1.00
R4651:Llgl1	UTSW	11	60708651	missense	possibly damaging	0.80
R4653:Llgl1	UTSW	11	60708651	missense	possibly damaging	0.80
R4731:Llgl1	UTSW	11	60706225	nonsense	probably null
R4869:Llgl1	UTSW	11	60707210	nonsense	probably null
R4898:Llgl1	UTSW	11	60709568	missense	probably benign
R4899:Llgl1	UTSW	11	60709568	missense	probably benign
R4939:Llgl1	UTSW	11	60709979	critical splice acceptor site	probably null
R4941:Llgl1	UTSW	11	60709568	missense	probably benign
R4942:Llgl1	UTSW	11	60709568	missense	probably benign
R4958:Llgl1	UTSW	11	60711435	missense	probably benign	0.02
R4995:Llgl1	UTSW	11	60709724	missense	probably benign	0.00
R4997:Llgl1	UTSW	11	60709568	missense	probably benign
R5177:Llgl1	UTSW	11	60712007	missense	possibly damaging	0.94
R5257:Llgl1	UTSW	11	60711563	splice site	probably null
R5258:Llgl1	UTSW	11	60711563	splice site	probably null
R5401:Llgl1	UTSW	11	60706471	missense	probably benign
R5406:Llgl1	UTSW	11	60713184	missense	probably damaging	0.99
R5432:Llgl1	UTSW	11	60707623	missense	probably benign
R5587:Llgl1	UTSW	11	60710342	missense	probably benign	0.00
R5732:Llgl1	UTSW	11	60709460	missense	probably benign	0.00
R5758:Llgl1	UTSW	11	60708567	missense	probably damaging	1.00
R5879:Llgl1	UTSW	11	60712980	missense	probably benign	0.00
R6268:Llgl1	UTSW	11	60712163	missense	probably benign	0.13
R6286:Llgl1	UTSW	11	60709532	missense	probably damaging	1.00
R6455:Llgl1	UTSW	11	60709660	missense	probably damaging	0.98
R6805:Llgl1	UTSW	11	60702865	missense	probably benign	0.25
R6929:Llgl1	UTSW	11	60710353	nonsense	probably null
R7274:Llgl1	UTSW	11	60705986	missense	possibly damaging	0.89
R7889:Llgl1	UTSW	11	60707312	missense	probably damaging	1.00
R7986:Llgl1	UTSW	11	60711395	missense	probably benign	0.16
R8141:Llgl1	UTSW	11	60710316	missense	probably benign	0.02
R8176:Llgl1	UTSW	11	60706561	missense	probably benign	0.27
R8223:Llgl1	UTSW	11	60702822	missense	possibly damaging	0.86
R8332:Llgl1	UTSW	11	60710384	missense	possibly damaging	0.90
R8350:Llgl1	UTSW	11	60712121	missense	probably damaging	1.00
R8500:Llgl1	UTSW	11	60704983	critical splice donor site	probably null
R8979:Llgl1	UTSW	11	60710303	missense	probably benign	0.25
R9155:Llgl1	UTSW	11	60707108	missense	probably benign	0.00
R9163:Llgl1	UTSW	11	60709576	missense	probably benign	0.02
R9225:Llgl1	UTSW	11	60710063	missense	probably damaging	1.00
R9234:Llgl1	UTSW	11	60710130	critical splice donor site	probably null
Z1186:Llgl1	UTSW	11	60713097	frame shift	probably null
Z1187:Llgl1	UTSW	11	60713097	frame shift	probably null
Z1188:Llgl1	UTSW	11	60713097	frame shift	probably null
Z1189:Llgl1	UTSW	11	60713097	frame shift	probably null
Z1190:Llgl1	UTSW	11	60713097	frame shift	probably null
Z1191:Llgl1	UTSW	11	60713097	frame shift	probably null
Z1192:Llgl1	UTSW	11	60713097	frame shift	probably null

Predicted Primers

PCR Primer
(F):5'- CCTCAGATACAGGAGCAGAGTTG -3'
(R):5'- AAAACTGGGTCTGCTGGGTG -3'

Sequencing Primer
(F):5'- GCAGAGTTGCTTTAGGAAGTG -3'
(R):5'- CATTATGATGGATGATCTCCCAGAG -3'

Posted On

2014-06-23