Incidental Mutation 'R1835:Aipl1'
ID 205193
Institutional Source Beutler Lab
Gene Symbol Aipl1
Ensembl Gene ENSMUSG00000040554
Gene Name aryl hydrocarbon receptor-interacting protein-like 1
Synonyms
MMRRC Submission 039862-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.131) question?
Stock # R1835 (G1)
Quality Score 225
Status Not validated
Chromosome 11
Chromosomal Location 72027963-72037509 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to G at 72030499 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Lysine to Threonine at position 190 (K190T)
Ref Sequence ENSEMBL: ENSMUSP00000036279 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000048207] [ENSMUST00000059082]
AlphaFold Q924K1
Predicted Effect possibly damaging
Transcript: ENSMUST00000048207
AA Change: K190T

PolyPhen 2 Score 0.911 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000036279
Gene: ENSMUSG00000040554
AA Change: K190T

DomainStartEndE-ValueType
Pfam:FKBP_C 26 154 5.2e-8 PFAM
Pfam:TPR_2 178 210 4.6e-6 PFAM
low complexity region 240 251 N/A INTRINSIC
Pfam:TPR_2 264 296 5.5e-6 PFAM
low complexity region 302 312 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000059082
SMART Domains Protein: ENSMUSP00000061957
Gene: ENSMUSG00000040554

DomainStartEndE-ValueType
Pfam:FKBP_C 25 154 1e-8 PFAM
Coding Region Coverage
  • 1x: 97.4%
  • 3x: 96.8%
  • 10x: 94.9%
  • 20x: 91.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Leber congenital amaurosis (LCA) is the most severe inherited retinopathy with the earliest age of onset and accounts for at least 5% of all inherited retinal diseases. Affected individuals are diagnosed at birth or in the first few months of life with nystagmus, severely impaired vision or blindness and an abnormal or flat electroretinogram. The photoreceptor/pineal-expressed gene, AIPL1, encoding aryl-hydrocarbon interacting protein-like 1, is located within the LCA4 candidate region. The encoded protein contains three tetratricopeptide motifs, consistent with chaperone or nuclear transport activity. Mutations in this gene may cause approximately 20% of recessive LCA. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jan 2014]
PHENOTYPE: Homozygous null mice display complete retinal degeneration and a lack of electroretinographic responses. Homozygous hypomorphic mutants display less severe retinal degeneration and impaired electroretinographic responses. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 97 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610507B11Rik G T 11: 78,287,750 V1993F probably damaging Het
4933425L06Rik C A 13: 105,082,194 A12E unknown Het
Acss2 T A 2: 155,558,630 Y530N probably damaging Het
Adam4 T C 12: 81,419,559 I763V probably benign Het
Alms1 T A 6: 85,678,503 S3344T possibly damaging Het
Alpi A G 1: 87,099,414 V381A possibly damaging Het
Ankfn1 A T 11: 89,447,618 S365R probably benign Het
Aox2 G A 1: 58,308,991 A623T probably benign Het
Apc T A 18: 34,317,077 L2308Q probably damaging Het
Atp9b C T 18: 80,778,883 V501I probably benign Het
Baz2b T C 2: 59,901,819 E1994G probably benign Het
Cacna1a T C 8: 84,581,357 probably null Het
Cacna1h C A 17: 25,392,076 V583L probably benign Het
Cd55 T C 1: 130,447,609 probably benign Het
Cep192 T A 18: 67,804,424 S75T possibly damaging Het
Cfap54 T A 10: 92,962,375 D1674V probably benign Het
Churc1 T C 12: 76,773,297 F27L possibly damaging Het
Coro1c A G 5: 113,848,543 I280T probably benign Het
Creb1 C T 1: 64,550,950 Q32* probably null Het
Cyp2b9 A G 7: 26,200,783 T339A probably benign Het
Dctn3 T C 4: 41,720,813 R51G probably damaging Het
Ddb1 T C 19: 10,626,593 V888A probably damaging Het
Disp1 A G 1: 183,089,000 Y619H probably damaging Het
Dnajc9 T C 14: 20,388,334 D96G possibly damaging Het
Eepd1 A G 9: 25,482,868 T143A possibly damaging Het
Eps8 T A 6: 137,522,279 K204* probably null Het
Ercc5 T A 1: 44,180,875 S1102R probably benign Het
Ergic2 T A 6: 148,189,581 Y211F possibly damaging Het
Fam135b G T 15: 71,490,711 L274M probably damaging Het
Fat3 G A 9: 15,998,088 T2206I probably damaging Het
Fat4 A G 3: 38,983,571 I3791V probably benign Het
Gemin4 A G 11: 76,213,296 M213T possibly damaging Het
Gnai3 T C 3: 108,118,407 M119V probably benign Het
Heatr5b A T 17: 78,773,563 L1420Q probably damaging Het
Herc2 G T 7: 56,206,765 G3918* probably null Het
Ints9 A G 14: 65,032,256 Y465C probably damaging Het
Ist1 A G 8: 109,678,883 V175A probably damaging Het
Kcnj12 T C 11: 61,069,557 L227P possibly damaging Het
Kcnq5 T C 1: 21,466,387 S416G probably benign Het
Kdm3a T A 6: 71,613,956 T295S probably benign Het
Kif1c T A 11: 70,708,971 M479K probably damaging Het
Kif20b T C 19: 34,956,038 L83P probably damaging Het
Kndc1 A G 7: 139,927,711 E1194G probably damaging Het
Llgl1 A G 11: 60,704,730 M81V probably benign Het
Map4k5 C A 12: 69,824,662 M495I probably damaging Het
Mest C T 6: 30,742,791 R146C probably benign Het
Mettl24 T A 10: 40,737,816 probably null Het
Mical1 T C 10: 41,483,535 S586P probably benign Het
Mrgpra3 G T 7: 47,589,946 Y77* probably null Het
Mss51 A T 14: 20,483,178 C408* probably null Het
Myh6 T C 14: 54,957,401 T666A probably benign Het
Myo10 T C 15: 25,805,587 C1685R possibly damaging Het
Naip5 A T 13: 100,223,218 Y503* probably null Het
Neil1 A C 9: 57,146,604 F144C probably damaging Het
Nipbl T A 15: 8,343,517 I1082F possibly damaging Het
Nkiras1 T C 14: 18,276,732 V7A probably damaging Het
Ntng2 G A 2: 29,197,057 Q384* probably null Het
Ocrl T A X: 47,962,116 I74N probably damaging Het
Olfr137 A T 17: 38,305,312 S50T probably benign Het
Olfr1385 A T 11: 49,494,670 I46F probably damaging Het
Olfr1408 A G 1: 173,130,815 V134A probably benign Het
Olfr381 A C 11: 73,486,374 V150G probably benign Het
Olfr535 A G 7: 140,492,709 S24G probably benign Het
Olfr761 C T 17: 37,952,385 G213E possibly damaging Het
Patj A G 4: 98,491,590 D151G probably benign Het
Plpbp T C 8: 27,049,231 V126A probably damaging Het
Pold2 A G 11: 5,873,454 L325P possibly damaging Het
Ppp1r12c A C 7: 4,483,651 S480A probably damaging Het
Pum1 T C 4: 130,701,048 S124P possibly damaging Het
Pwp2 C G 10: 78,179,091 G353A probably damaging Het
Reln C A 5: 21,979,002 Q1666H probably damaging Het
Rnf19a T C 15: 36,265,925 I9V probably benign Het
Ryr2 T C 13: 11,769,878 H1063R probably benign Het
Samd14 C G 11: 95,023,600 D361E probably damaging Het
Samd15 A T 12: 87,201,843 N365I probably damaging Het
Sec16b A G 1: 157,531,312 H105R probably benign Het
Sez6 T C 11: 77,953,503 S51P probably benign Het
Sh3bp1 T A 15: 78,905,150 L236Q probably damaging Het
Sspo C T 6: 48,457,340 T991I probably damaging Het
Suco A T 1: 161,859,500 L97* probably null Het
Tab1 C A 15: 80,148,296 R35S probably benign Het
Tet3 C A 6: 83,404,163 S341I possibly damaging Het
Tlr1 A T 5: 64,925,700 D511E probably benign Het
Tmem132b A C 5: 125,785,899 D656A probably damaging Het
Tmtc4 T A 14: 122,941,988 probably null Het
Trmo T C 4: 46,380,158 T404A probably damaging Het
Trpm1 A G 7: 64,230,268 K790E probably damaging Het
Ulk4 C A 9: 121,168,184 R774M probably null Het
Ush2a C T 1: 188,451,818 L1440F probably benign Het
Usp16 A G 16: 87,480,907 K682E probably damaging Het
Virma T C 4: 11,540,511 S1471P probably benign Het
Vmn1r177 A T 7: 23,865,686 I255N probably damaging Het
Vmn2r61 A T 7: 42,266,652 R230* probably null Het
Vps13c T A 9: 67,993,013 F3671L probably benign Het
Washc5 T C 15: 59,359,340 N358S possibly damaging Het
Wdr72 A G 9: 74,151,617 K331E probably damaging Het
Zfp986 A T 4: 145,899,235 K155I probably benign Het
Other mutations in Aipl1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00914:Aipl1 APN 11 72031547 missense probably damaging 1.00
IGL01713:Aipl1 APN 11 72036623 missense probably damaging 1.00
IGL02031:Aipl1 APN 11 72030202 utr 3 prime probably benign
IGL02603:Aipl1 APN 11 72036700 missense possibly damaging 0.82
IGL02677:Aipl1 APN 11 72029396 missense possibly damaging 0.90
R1563:Aipl1 UTSW 11 72036712 missense probably damaging 0.99
R2041:Aipl1 UTSW 11 72031506 missense possibly damaging 0.87
R2118:Aipl1 UTSW 11 72029369 missense possibly damaging 0.92
R2216:Aipl1 UTSW 11 72031446 missense probably damaging 1.00
R4001:Aipl1 UTSW 11 72031602 missense probably damaging 1.00
R4969:Aipl1 UTSW 11 72031430 missense probably benign 0.22
R5428:Aipl1 UTSW 11 72030487 missense probably benign 0.02
R5933:Aipl1 UTSW 11 72030282 missense probably benign 0.01
R8151:Aipl1 UTSW 11 72036758 missense probably benign 0.44
R8379:Aipl1 UTSW 11 72029300 missense probably benign 0.05
R8406:Aipl1 UTSW 11 72031506 missense possibly damaging 0.87
R8998:Aipl1 UTSW 11 72030257 missense possibly damaging 0.93
R8999:Aipl1 UTSW 11 72030257 missense possibly damaging 0.93
R9340:Aipl1 UTSW 11 72037427 missense probably damaging 1.00
R9346:Aipl1 UTSW 11 72037427 missense probably damaging 1.00
R9422:Aipl1 UTSW 11 72037427 missense probably damaging 1.00
R9424:Aipl1 UTSW 11 72037427 missense probably damaging 1.00
R9462:Aipl1 UTSW 11 72037427 missense probably damaging 1.00
R9576:Aipl1 UTSW 11 72037427 missense probably damaging 1.00
R9577:Aipl1 UTSW 11 72037427 missense probably damaging 1.00
R9578:Aipl1 UTSW 11 72037427 missense probably damaging 1.00
R9593:Aipl1 UTSW 11 72030335 missense probably benign
X0018:Aipl1 UTSW 11 72030541 missense probably benign 0.00
Z1176:Aipl1 UTSW 11 72030533 missense possibly damaging 0.69
Predicted Primers PCR Primer
(F):5'- ATCAGGGTGTTGATCATCTTCTCC -3'
(R):5'- TGGGACACAGGAAACCCTTTC -3'

Sequencing Primer
(F):5'- GTGTTGATCATCTTCTCCAGCTTCAG -3'
(R):5'- CCCAAATGAGTACCAGAGG -3'
Posted On 2014-06-23