Incidental Mutation 'R1835:Sez6'
ID 205196
Institutional Source Beutler Lab
Gene Symbol Sez6
Ensembl Gene ENSMUSG00000000632
Gene Name seizure related gene 6
Synonyms sez-6, D11Bhm177e
MMRRC Submission 039862-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R1835 (G1)
Quality Score 204
Status Not validated
Chromosome 11
Chromosomal Location 77821626-77869874 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 77844329 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Serine to Proline at position 51 (S51P)
Ref Sequence ENSEMBL: ENSMUSP00000091532 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000000646] [ENSMUST00000093995]
AlphaFold Q7TSK2
Predicted Effect probably benign
Transcript: ENSMUST00000000646
AA Change: S51P

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000000646
Gene: ENSMUSG00000000632
AA Change: S51P

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
low complexity region 72 85 N/A INTRINSIC
low complexity region 119 132 N/A INTRINSIC
low complexity region 223 235 N/A INTRINSIC
CUB 241 350 9.36e-2 SMART
CCP 354 409 1.23e-10 SMART
CUB 413 524 1.41e-28 SMART
CCP 529 586 5.43e-12 SMART
CUB 590 701 7.49e-24 SMART
CCP 707 762 3.09e-16 SMART
CCP 768 827 3.5e-15 SMART
CCP 835 892 1.42e-15 SMART
transmembrane domain 910 932 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000093995
AA Change: S51P

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000091532
Gene: ENSMUSG00000000632
AA Change: S51P

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
low complexity region 72 85 N/A INTRINSIC
low complexity region 119 132 N/A INTRINSIC
low complexity region 223 235 N/A INTRINSIC
CUB 241 350 9.36e-2 SMART
CCP 354 409 1.23e-10 SMART
CUB 413 524 1.41e-28 SMART
CCP 529 586 5.43e-12 SMART
CUB 590 701 7.49e-24 SMART
CCP 707 762 3.09e-16 SMART
CCP 768 827 3.5e-15 SMART
CCP 835 892 1.42e-15 SMART
transmembrane domain 923 945 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138346
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138749
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142542
Predicted Effect probably benign
Transcript: ENSMUST00000151982
SMART Domains Protein: ENSMUSP00000132041
Gene: ENSMUSG00000000632

DomainStartEndE-ValueType
low complexity region 57 69 N/A INTRINSIC
CUB 75 184 9.36e-2 SMART
CCP 188 243 1.23e-10 SMART
CUB 247 358 8.08e-29 SMART
low complexity region 379 394 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000155087
Coding Region Coverage
  • 1x: 97.4%
  • 3x: 96.8%
  • 10x: 94.9%
  • 20x: 91.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is thought to contain five cysteine-rich motifs that are similar to sushi domains, as well as two domains similar to the amino terminal half of the CUB (for complement C1r/C1s, Uegf, Bmp1) domain. Mutations in this gene have been associated with febrile seizures. [provided by RefSeq, Jul 2016]
PHENOTYPE: Mice homozygous for a null allele exhibit increased short dendrites, decreased excitatory synaptic signaling, resistance to pharmacologically induces seizures, decreased activity and impaired learning and coordination. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 97 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acss2 T A 2: 155,400,550 (GRCm39) Y530N probably damaging Het
Adam4 T C 12: 81,466,333 (GRCm39) I763V probably benign Het
Aipl1 T G 11: 71,921,325 (GRCm39) K190T possibly damaging Het
Alms1 T A 6: 85,655,485 (GRCm39) S3344T possibly damaging Het
Alpi A G 1: 87,027,136 (GRCm39) V381A possibly damaging Het
Ankfn1 A T 11: 89,338,444 (GRCm39) S365R probably benign Het
Aox1 G A 1: 58,348,150 (GRCm39) A623T probably benign Het
Apc T A 18: 34,450,130 (GRCm39) L2308Q probably damaging Het
Atp9b C T 18: 80,822,098 (GRCm39) V501I probably benign Het
Baz2b T C 2: 59,732,163 (GRCm39) E1994G probably benign Het
Bltp2 G T 11: 78,178,576 (GRCm39) V1993F probably damaging Het
Cacna1a T C 8: 85,307,986 (GRCm39) probably null Het
Cacna1h C A 17: 25,611,050 (GRCm39) V583L probably benign Het
Cd55 T C 1: 130,375,346 (GRCm39) probably benign Het
Cep192 T A 18: 67,937,494 (GRCm39) S75T possibly damaging Het
Cfap54 T A 10: 92,798,237 (GRCm39) D1674V probably benign Het
Churc1 T C 12: 76,820,071 (GRCm39) F27L possibly damaging Het
Coro1c A G 5: 113,986,604 (GRCm39) I280T probably benign Het
Creb1 C T 1: 64,590,109 (GRCm39) Q32* probably null Het
Cyp2b9 A G 7: 25,900,208 (GRCm39) T339A probably benign Het
Dctn3 T C 4: 41,720,813 (GRCm39) R51G probably damaging Het
Ddb1 T C 19: 10,603,957 (GRCm39) V888A probably damaging Het
Disp1 A G 1: 182,870,564 (GRCm39) Y619H probably damaging Het
Dnajc9 T C 14: 20,438,402 (GRCm39) D96G possibly damaging Het
Eepd1 A G 9: 25,394,164 (GRCm39) T143A possibly damaging Het
Eps8 T A 6: 137,499,277 (GRCm39) K204* probably null Het
Ercc5 T A 1: 44,220,035 (GRCm39) S1102R probably benign Het
Ergic2 T A 6: 148,091,079 (GRCm39) Y211F possibly damaging Het
Fam135b G T 15: 71,362,560 (GRCm39) L274M probably damaging Het
Fat3 G A 9: 15,909,384 (GRCm39) T2206I probably damaging Het
Fat4 A G 3: 39,037,720 (GRCm39) I3791V probably benign Het
Gemin4 A G 11: 76,104,122 (GRCm39) M213T possibly damaging Het
Gnai3 T C 3: 108,025,723 (GRCm39) M119V probably benign Het
Heatr5b A T 17: 79,080,992 (GRCm39) L1420Q probably damaging Het
Herc2 G T 7: 55,856,513 (GRCm39) G3918* probably null Het
Ints9 A G 14: 65,269,705 (GRCm39) Y465C probably damaging Het
Ist1 A G 8: 110,405,515 (GRCm39) V175A probably damaging Het
Kcnj12 T C 11: 60,960,383 (GRCm39) L227P possibly damaging Het
Kcnq5 T C 1: 21,536,611 (GRCm39) S416G probably benign Het
Kdm3a T A 6: 71,590,940 (GRCm39) T295S probably benign Het
Kif1c T A 11: 70,599,797 (GRCm39) M479K probably damaging Het
Kif20b T C 19: 34,933,438 (GRCm39) L83P probably damaging Het
Kndc1 A G 7: 139,507,624 (GRCm39) E1194G probably damaging Het
Llgl1 A G 11: 60,595,556 (GRCm39) M81V probably benign Het
Map4k5 C A 12: 69,871,436 (GRCm39) M495I probably damaging Het
Mest C T 6: 30,742,790 (GRCm39) R146C probably benign Het
Mettl24 T A 10: 40,613,812 (GRCm39) probably null Het
Mical1 T C 10: 41,359,531 (GRCm39) S586P probably benign Het
Mrgpra3 G T 7: 47,239,694 (GRCm39) Y77* probably null Het
Mss51 A T 14: 20,533,246 (GRCm39) C408* probably null Het
Myh6 T C 14: 55,194,858 (GRCm39) T666A probably benign Het
Myo10 T C 15: 25,805,673 (GRCm39) C1685R possibly damaging Het
Naip5 A T 13: 100,359,726 (GRCm39) Y503* probably null Het
Neil1 A C 9: 57,053,888 (GRCm39) F144C probably damaging Het
Nipbl T A 15: 8,373,001 (GRCm39) I1082F possibly damaging Het
Nkiras1 T C 14: 18,276,732 (GRCm38) V7A probably damaging Het
Nt5el C A 13: 105,218,702 (GRCm39) A12E unknown Het
Ntng2 G A 2: 29,087,069 (GRCm39) Q384* probably null Het
Ocrl T A X: 47,050,993 (GRCm39) I74N probably damaging Het
Or10j27 A G 1: 172,958,382 (GRCm39) V134A probably benign Het
Or13a22 A G 7: 140,072,622 (GRCm39) S24G probably benign Het
Or14j8 C T 17: 38,263,276 (GRCm39) G213E possibly damaging Het
Or1e22 A C 11: 73,377,200 (GRCm39) V150G probably benign Het
Or2j3 A T 17: 38,616,203 (GRCm39) S50T probably benign Het
Or2y1 A T 11: 49,385,497 (GRCm39) I46F probably damaging Het
Patj A G 4: 98,379,827 (GRCm39) D151G probably benign Het
Plpbp T C 8: 27,539,259 (GRCm39) V126A probably damaging Het
Pold2 A G 11: 5,823,454 (GRCm39) L325P possibly damaging Het
Ppp1r12c A C 7: 4,486,650 (GRCm39) S480A probably damaging Het
Pum1 T C 4: 130,428,359 (GRCm39) S124P possibly damaging Het
Pwp2 C G 10: 78,014,925 (GRCm39) G353A probably damaging Het
Reln C A 5: 22,184,000 (GRCm39) Q1666H probably damaging Het
Rnf19a T C 15: 36,266,071 (GRCm39) I9V probably benign Het
Ryr2 T C 13: 11,784,764 (GRCm39) H1063R probably benign Het
Samd14 C G 11: 94,914,426 (GRCm39) D361E probably damaging Het
Samd15 A T 12: 87,248,617 (GRCm39) N365I probably damaging Het
Sec16b A G 1: 157,358,882 (GRCm39) H105R probably benign Het
Sh3bp1 T A 15: 78,789,350 (GRCm39) L236Q probably damaging Het
Sspo C T 6: 48,434,274 (GRCm39) T991I probably damaging Het
Suco A T 1: 161,687,069 (GRCm39) L97* probably null Het
Tab1 C A 15: 80,032,497 (GRCm39) R35S probably benign Het
Tet3 C A 6: 83,381,145 (GRCm39) S341I possibly damaging Het
Tlr1 A T 5: 65,083,043 (GRCm39) D511E probably benign Het
Tmem132b A C 5: 125,862,963 (GRCm39) D656A probably damaging Het
Tmtc4 T A 14: 123,179,400 (GRCm39) probably null Het
Trmo T C 4: 46,380,158 (GRCm39) T404A probably damaging Het
Trpm1 A G 7: 63,880,016 (GRCm39) K790E probably damaging Het
Ulk4 C A 9: 120,997,250 (GRCm39) R774M probably null Het
Ush2a C T 1: 188,184,015 (GRCm39) L1440F probably benign Het
Usp16 A G 16: 87,277,795 (GRCm39) K682E probably damaging Het
Virma T C 4: 11,540,511 (GRCm39) S1471P probably benign Het
Vmn1r177 A T 7: 23,565,111 (GRCm39) I255N probably damaging Het
Vmn2r61 A T 7: 41,916,076 (GRCm39) R230* probably null Het
Vps13c T A 9: 67,900,295 (GRCm39) F3671L probably benign Het
Washc5 T C 15: 59,231,189 (GRCm39) N358S possibly damaging Het
Wdr72 A G 9: 74,058,899 (GRCm39) K331E probably damaging Het
Zfp986 A T 4: 145,625,805 (GRCm39) K155I probably benign Het
Other mutations in Sez6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01125:Sez6 APN 11 77,868,115 (GRCm39) splice site probably benign
IGL01142:Sez6 APN 11 77,864,642 (GRCm39) missense probably damaging 1.00
IGL02252:Sez6 APN 11 77,865,339 (GRCm39) missense probably damaging 1.00
IGL02332:Sez6 APN 11 77,845,568 (GRCm39) splice site probably benign
IGL02366:Sez6 APN 11 77,867,708 (GRCm39) missense probably damaging 0.98
IGL02479:Sez6 APN 11 77,868,852 (GRCm39) missense possibly damaging 0.84
IGL02963:Sez6 APN 11 77,853,775 (GRCm39) missense possibly damaging 0.93
velum UTSW 11 77,865,375 (GRCm39) missense probably damaging 1.00
R0054:Sez6 UTSW 11 77,844,699 (GRCm39) missense possibly damaging 0.94
R0054:Sez6 UTSW 11 77,844,699 (GRCm39) missense possibly damaging 0.94
R0089:Sez6 UTSW 11 77,865,170 (GRCm39) splice site probably benign
R0485:Sez6 UTSW 11 77,844,639 (GRCm39) missense probably damaging 1.00
R0598:Sez6 UTSW 11 77,868,647 (GRCm39) missense possibly damaging 0.88
R0729:Sez6 UTSW 11 77,867,411 (GRCm39) missense probably benign 0.01
R1117:Sez6 UTSW 11 77,865,340 (GRCm39) missense probably damaging 1.00
R1199:Sez6 UTSW 11 77,844,711 (GRCm39) missense probably benign
R1534:Sez6 UTSW 11 77,853,871 (GRCm39) missense probably damaging 1.00
R1840:Sez6 UTSW 11 77,844,543 (GRCm39) missense possibly damaging 0.79
R1929:Sez6 UTSW 11 77,863,758 (GRCm39) missense probably damaging 1.00
R1970:Sez6 UTSW 11 77,844,894 (GRCm39) critical splice donor site probably null
R3156:Sez6 UTSW 11 77,844,605 (GRCm39) missense possibly damaging 0.63
R3930:Sez6 UTSW 11 77,867,708 (GRCm39) missense probably damaging 0.98
R3931:Sez6 UTSW 11 77,867,708 (GRCm39) missense probably damaging 0.98
R4894:Sez6 UTSW 11 77,866,086 (GRCm39) missense probably damaging 1.00
R4904:Sez6 UTSW 11 77,866,080 (GRCm39) missense probably damaging 1.00
R5026:Sez6 UTSW 11 77,859,815 (GRCm39) missense probably damaging 1.00
R5040:Sez6 UTSW 11 77,859,915 (GRCm39) critical splice donor site probably null
R5057:Sez6 UTSW 11 77,863,979 (GRCm39) missense probably damaging 1.00
R5093:Sez6 UTSW 11 77,867,388 (GRCm39) missense possibly damaging 0.88
R5640:Sez6 UTSW 11 77,864,585 (GRCm39) intron probably benign
R6013:Sez6 UTSW 11 77,864,623 (GRCm39) missense probably damaging 1.00
R6126:Sez6 UTSW 11 77,864,630 (GRCm39) missense probably damaging 1.00
R6153:Sez6 UTSW 11 77,868,648 (GRCm39) missense probably damaging 0.99
R6279:Sez6 UTSW 11 77,867,367 (GRCm39) missense possibly damaging 0.63
R6300:Sez6 UTSW 11 77,867,367 (GRCm39) missense possibly damaging 0.63
R6475:Sez6 UTSW 11 77,864,670 (GRCm39)
R6722:Sez6 UTSW 11 77,844,528 (GRCm39) missense probably damaging 1.00
R6897:Sez6 UTSW 11 77,844,385 (GRCm39) missense probably damaging 1.00
R6910:Sez6 UTSW 11 77,844,695 (GRCm39) missense possibly damaging 0.85
R7012:Sez6 UTSW 11 77,868,621 (GRCm39) missense probably benign 0.04
R7233:Sez6 UTSW 11 77,863,963 (GRCm39) missense probably damaging 1.00
R7265:Sez6 UTSW 11 77,853,691 (GRCm39) missense probably damaging 0.96
R7289:Sez6 UTSW 11 77,865,149 (GRCm39) missense possibly damaging 0.96
R7405:Sez6 UTSW 11 77,853,717 (GRCm39) missense probably benign 0.10
R7408:Sez6 UTSW 11 77,844,356 (GRCm39) missense probably damaging 1.00
R7485:Sez6 UTSW 11 77,864,711 (GRCm39) missense probably benign 0.01
R7592:Sez6 UTSW 11 77,868,876 (GRCm39) missense probably damaging 0.99
R7778:Sez6 UTSW 11 77,865,375 (GRCm39) missense probably damaging 1.00
R7793:Sez6 UTSW 11 77,868,426 (GRCm39) missense probably damaging 1.00
R7818:Sez6 UTSW 11 77,867,728 (GRCm39) missense probably damaging 1.00
R7824:Sez6 UTSW 11 77,865,375 (GRCm39) missense probably damaging 1.00
R7980:Sez6 UTSW 11 77,844,668 (GRCm39) missense probably benign 0.34
R8008:Sez6 UTSW 11 77,864,082 (GRCm39) nonsense probably null
R8840:Sez6 UTSW 11 77,867,313 (GRCm39) missense probably damaging 1.00
R8947:Sez6 UTSW 11 77,844,353 (GRCm39) missense probably damaging 1.00
R8973:Sez6 UTSW 11 77,865,397 (GRCm39) missense probably damaging 1.00
R9040:Sez6 UTSW 11 77,864,762 (GRCm39) missense probably benign
R9081:Sez6 UTSW 11 77,865,121 (GRCm39) missense possibly damaging 0.83
R9082:Sez6 UTSW 11 77,865,121 (GRCm39) missense possibly damaging 0.83
R9092:Sez6 UTSW 11 77,865,121 (GRCm39) missense possibly damaging 0.83
R9094:Sez6 UTSW 11 77,865,121 (GRCm39) missense possibly damaging 0.83
R9095:Sez6 UTSW 11 77,865,121 (GRCm39) missense possibly damaging 0.83
R9097:Sez6 UTSW 11 77,865,121 (GRCm39) missense possibly damaging 0.83
R9169:Sez6 UTSW 11 77,868,473 (GRCm39) missense probably damaging 0.96
R9513:Sez6 UTSW 11 77,865,409 (GRCm39) missense probably damaging 1.00
R9630:Sez6 UTSW 11 77,865,121 (GRCm39) missense possibly damaging 0.83
R9632:Sez6 UTSW 11 77,865,121 (GRCm39) missense possibly damaging 0.83
R9646:Sez6 UTSW 11 77,867,632 (GRCm39) missense probably damaging 0.99
R9709:Sez6 UTSW 11 77,865,121 (GRCm39) missense possibly damaging 0.83
X0013:Sez6 UTSW 11 77,845,606 (GRCm39) missense probably benign 0.01
X0067:Sez6 UTSW 11 77,865,264 (GRCm39) critical splice acceptor site probably null
Z1088:Sez6 UTSW 11 77,864,023 (GRCm39) missense possibly damaging 0.95
Predicted Primers PCR Primer
(F):5'- GCAAGATGGATCTCCTCCTG -3'
(R):5'- CTGGAGTCGGACTGGTAAAGAC -3'

Sequencing Primer
(F):5'- GATGGATCTCCTCCTGCCTGC -3'
(R):5'- TAAAGACGGGGCGGTTGTCC -3'
Posted On 2014-06-23