Incidental Mutation 'R1835:Sez6'
ID205196
Institutional Source Beutler Lab
Gene Symbol Sez6
Ensembl Gene ENSMUSG00000000632
Gene Nameseizure related gene 6
SynonymsD11Bhm177e, sez-6
MMRRC Submission 039862-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1835 (G1)
Quality Score204
Status Not validated
Chromosome11
Chromosomal Location77930800-77979048 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 77953503 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 51 (S51P)
Ref Sequence ENSEMBL: ENSMUSP00000091532 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000000646] [ENSMUST00000093995]
Predicted Effect probably benign
Transcript: ENSMUST00000000646
AA Change: S51P

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000000646
Gene: ENSMUSG00000000632
AA Change: S51P

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
low complexity region 72 85 N/A INTRINSIC
low complexity region 119 132 N/A INTRINSIC
low complexity region 223 235 N/A INTRINSIC
CUB 241 350 9.36e-2 SMART
CCP 354 409 1.23e-10 SMART
CUB 413 524 1.41e-28 SMART
CCP 529 586 5.43e-12 SMART
CUB 590 701 7.49e-24 SMART
CCP 707 762 3.09e-16 SMART
CCP 768 827 3.5e-15 SMART
CCP 835 892 1.42e-15 SMART
transmembrane domain 910 932 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000093995
AA Change: S51P

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000091532
Gene: ENSMUSG00000000632
AA Change: S51P

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
low complexity region 72 85 N/A INTRINSIC
low complexity region 119 132 N/A INTRINSIC
low complexity region 223 235 N/A INTRINSIC
CUB 241 350 9.36e-2 SMART
CCP 354 409 1.23e-10 SMART
CUB 413 524 1.41e-28 SMART
CCP 529 586 5.43e-12 SMART
CUB 590 701 7.49e-24 SMART
CCP 707 762 3.09e-16 SMART
CCP 768 827 3.5e-15 SMART
CCP 835 892 1.42e-15 SMART
transmembrane domain 923 945 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138346
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138749
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142542
Predicted Effect probably benign
Transcript: ENSMUST00000151982
SMART Domains Protein: ENSMUSP00000132041
Gene: ENSMUSG00000000632

DomainStartEndE-ValueType
low complexity region 57 69 N/A INTRINSIC
CUB 75 184 9.36e-2 SMART
CCP 188 243 1.23e-10 SMART
CUB 247 358 8.08e-29 SMART
low complexity region 379 394 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000155087
Coding Region Coverage
  • 1x: 97.4%
  • 3x: 96.8%
  • 10x: 94.9%
  • 20x: 91.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is thought to contain five cysteine-rich motifs that are similar to sushi domains, as well as two domains similar to the amino terminal half of the CUB (for complement C1r/C1s, Uegf, Bmp1) domain. Mutations in this gene have been associated with febrile seizures. [provided by RefSeq, Jul 2016]
PHENOTYPE: Mice homozygous for a null allele exhibit increased short dendrites, decreased excitatory synaptic signaling, resistance to pharmacologically induces seizures, decreased activity and impaired learning and coordination. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 97 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610507B11Rik G T 11: 78,287,750 V1993F probably damaging Het
4933425L06Rik C A 13: 105,082,194 A12E unknown Het
Acss2 T A 2: 155,558,630 Y530N probably damaging Het
Adam4 T C 12: 81,419,559 I763V probably benign Het
Aipl1 T G 11: 72,030,499 K190T possibly damaging Het
Alms1 T A 6: 85,678,503 S3344T possibly damaging Het
Alpi A G 1: 87,099,414 V381A possibly damaging Het
Ankfn1 A T 11: 89,447,618 S365R probably benign Het
Aox2 G A 1: 58,308,991 A623T probably benign Het
Apc T A 18: 34,317,077 L2308Q probably damaging Het
Atp9b C T 18: 80,778,883 V501I probably benign Het
Baz2b T C 2: 59,901,819 E1994G probably benign Het
Cacna1a T C 8: 84,581,357 probably null Het
Cacna1h C A 17: 25,392,076 V583L probably benign Het
Cd55 T C 1: 130,447,609 probably benign Het
Cep192 T A 18: 67,804,424 S75T possibly damaging Het
Cfap54 T A 10: 92,962,375 D1674V probably benign Het
Churc1 T C 12: 76,773,297 F27L possibly damaging Het
Coro1c A G 5: 113,848,543 I280T probably benign Het
Creb1 C T 1: 64,550,950 Q32* probably null Het
Cyp2b9 A G 7: 26,200,783 T339A probably benign Het
Dctn3 T C 4: 41,720,813 R51G probably damaging Het
Ddb1 T C 19: 10,626,593 V888A probably damaging Het
Disp1 A G 1: 183,089,000 Y619H probably damaging Het
Dnajc9 T C 14: 20,388,334 D96G possibly damaging Het
Eepd1 A G 9: 25,482,868 T143A possibly damaging Het
Eps8 T A 6: 137,522,279 K204* probably null Het
Ercc5 T A 1: 44,180,875 S1102R probably benign Het
Ergic2 T A 6: 148,189,581 Y211F possibly damaging Het
Fam135b G T 15: 71,490,711 L274M probably damaging Het
Fat3 G A 9: 15,998,088 T2206I probably damaging Het
Fat4 A G 3: 38,983,571 I3791V probably benign Het
Gemin4 A G 11: 76,213,296 M213T possibly damaging Het
Gnai3 T C 3: 108,118,407 M119V probably benign Het
Heatr5b A T 17: 78,773,563 L1420Q probably damaging Het
Herc2 G T 7: 56,206,765 G3918* probably null Het
Ints9 A G 14: 65,032,256 Y465C probably damaging Het
Ist1 A G 8: 109,678,883 V175A probably damaging Het
Kcnj12 T C 11: 61,069,557 L227P possibly damaging Het
Kcnq5 T C 1: 21,466,387 S416G probably benign Het
Kdm3a T A 6: 71,613,956 T295S probably benign Het
Kif1c T A 11: 70,708,971 M479K probably damaging Het
Kif20b T C 19: 34,956,038 L83P probably damaging Het
Kndc1 A G 7: 139,927,711 E1194G probably damaging Het
Llgl1 A G 11: 60,704,730 M81V probably benign Het
Map4k5 C A 12: 69,824,662 M495I probably damaging Het
Mest C T 6: 30,742,791 R146C probably benign Het
Mettl24 T A 10: 40,737,816 probably null Het
Mical1 T C 10: 41,483,535 S586P probably benign Het
Mrgpra3 G T 7: 47,589,946 Y77* probably null Het
Mss51 A T 14: 20,483,178 C408* probably null Het
Myh6 T C 14: 54,957,401 T666A probably benign Het
Myo10 T C 15: 25,805,587 C1685R possibly damaging Het
Naip5 A T 13: 100,223,218 Y503* probably null Het
Neil1 A C 9: 57,146,604 F144C probably damaging Het
Nipbl T A 15: 8,343,517 I1082F possibly damaging Het
Nkiras1 T C 14: 18,276,732 V7A probably damaging Het
Ntng2 G A 2: 29,197,057 Q384* probably null Het
Ocrl T A X: 47,962,116 I74N probably damaging Het
Olfr137 A T 17: 38,305,312 S50T probably benign Het
Olfr1385 A T 11: 49,494,670 I46F probably damaging Het
Olfr1408 A G 1: 173,130,815 V134A probably benign Het
Olfr381 A C 11: 73,486,374 V150G probably benign Het
Olfr535 A G 7: 140,492,709 S24G probably benign Het
Olfr761 C T 17: 37,952,385 G213E possibly damaging Het
Patj A G 4: 98,491,590 D151G probably benign Het
Plpbp T C 8: 27,049,231 V126A probably damaging Het
Pold2 A G 11: 5,873,454 L325P possibly damaging Het
Ppp1r12c A C 7: 4,483,651 S480A probably damaging Het
Pum1 T C 4: 130,701,048 S124P possibly damaging Het
Pwp2 C G 10: 78,179,091 G353A probably damaging Het
Reln C A 5: 21,979,002 Q1666H probably damaging Het
Rnf19a T C 15: 36,265,925 I9V probably benign Het
Ryr2 T C 13: 11,769,878 H1063R probably benign Het
Samd14 C G 11: 95,023,600 D361E probably damaging Het
Samd15 A T 12: 87,201,843 N365I probably damaging Het
Sec16b A G 1: 157,531,312 H105R probably benign Het
Sh3bp1 T A 15: 78,905,150 L236Q probably damaging Het
Sspo C T 6: 48,457,340 T991I probably damaging Het
Suco A T 1: 161,859,500 L97* probably null Het
Tab1 C A 15: 80,148,296 R35S probably benign Het
Tet3 C A 6: 83,404,163 S341I possibly damaging Het
Tlr1 A T 5: 64,925,700 D511E probably benign Het
Tmem132b A C 5: 125,785,899 D656A probably damaging Het
Tmtc4 T A 14: 122,941,988 probably null Het
Trmo T C 4: 46,380,158 T404A probably damaging Het
Trpm1 A G 7: 64,230,268 K790E probably damaging Het
Ulk4 C A 9: 121,168,184 R774M probably null Het
Ush2a C T 1: 188,451,818 L1440F probably benign Het
Usp16 A G 16: 87,480,907 K682E probably damaging Het
Virma T C 4: 11,540,511 S1471P probably benign Het
Vmn1r177 A T 7: 23,865,686 I255N probably damaging Het
Vmn2r61 A T 7: 42,266,652 R230* probably null Het
Vps13c T A 9: 67,993,013 F3671L probably benign Het
Washc5 T C 15: 59,359,340 N358S possibly damaging Het
Wdr72 A G 9: 74,151,617 K331E probably damaging Het
Zfp986 A T 4: 145,899,235 K155I probably benign Het
Other mutations in Sez6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01125:Sez6 APN 11 77977289 splice site probably benign
IGL01142:Sez6 APN 11 77973816 missense probably damaging 1.00
IGL02252:Sez6 APN 11 77974513 missense probably damaging 1.00
IGL02332:Sez6 APN 11 77954742 splice site probably benign
IGL02366:Sez6 APN 11 77976882 missense probably damaging 0.98
IGL02479:Sez6 APN 11 77978026 missense possibly damaging 0.84
IGL02963:Sez6 APN 11 77962949 missense possibly damaging 0.93
R0054:Sez6 UTSW 11 77953873 missense possibly damaging 0.94
R0054:Sez6 UTSW 11 77953873 missense possibly damaging 0.94
R0089:Sez6 UTSW 11 77974344 splice site probably benign
R0485:Sez6 UTSW 11 77953813 missense probably damaging 1.00
R0598:Sez6 UTSW 11 77977821 missense possibly damaging 0.88
R0729:Sez6 UTSW 11 77976585 missense probably benign 0.01
R1117:Sez6 UTSW 11 77974514 missense probably damaging 1.00
R1199:Sez6 UTSW 11 77953885 missense probably benign
R1534:Sez6 UTSW 11 77963045 missense probably damaging 1.00
R1840:Sez6 UTSW 11 77953717 missense possibly damaging 0.79
R1929:Sez6 UTSW 11 77972932 missense probably damaging 1.00
R1970:Sez6 UTSW 11 77954068 critical splice donor site probably null
R3156:Sez6 UTSW 11 77953779 missense possibly damaging 0.63
R3930:Sez6 UTSW 11 77976882 missense probably damaging 0.98
R3931:Sez6 UTSW 11 77976882 missense probably damaging 0.98
R4894:Sez6 UTSW 11 77975260 missense probably damaging 1.00
R4904:Sez6 UTSW 11 77975254 missense probably damaging 1.00
R5026:Sez6 UTSW 11 77968989 missense probably damaging 1.00
R5040:Sez6 UTSW 11 77969089 critical splice donor site probably null
R5057:Sez6 UTSW 11 77973153 missense probably damaging 1.00
R5093:Sez6 UTSW 11 77976562 missense possibly damaging 0.88
R5640:Sez6 UTSW 11 77973759 intron probably benign
R6013:Sez6 UTSW 11 77973797 missense probably damaging 1.00
R6126:Sez6 UTSW 11 77973804 missense probably damaging 1.00
R6153:Sez6 UTSW 11 77977822 missense probably damaging 0.99
R6279:Sez6 UTSW 11 77976541 missense possibly damaging 0.63
R6300:Sez6 UTSW 11 77976541 missense possibly damaging 0.63
R6475:Sez6 UTSW 11 77973844
R6722:Sez6 UTSW 11 77953702 missense probably damaging 1.00
R6897:Sez6 UTSW 11 77953559 missense probably damaging 1.00
R6910:Sez6 UTSW 11 77953869 missense possibly damaging 0.85
R7012:Sez6 UTSW 11 77977795 missense probably benign 0.04
R7233:Sez6 UTSW 11 77973137 missense probably damaging 1.00
R7265:Sez6 UTSW 11 77962865 missense probably damaging 0.96
R7289:Sez6 UTSW 11 77974323 missense possibly damaging 0.96
R7405:Sez6 UTSW 11 77962891 missense probably benign 0.10
R7408:Sez6 UTSW 11 77953530 missense probably damaging 1.00
R7485:Sez6 UTSW 11 77973885 missense probably benign 0.01
R7592:Sez6 UTSW 11 77978050 missense probably damaging 0.99
R7778:Sez6 UTSW 11 77974549 missense probably damaging 1.00
R7793:Sez6 UTSW 11 77977600 missense probably damaging 1.00
R7818:Sez6 UTSW 11 77976902 missense probably damaging 1.00
R7824:Sez6 UTSW 11 77974549 missense probably damaging 1.00
R8008:Sez6 UTSW 11 77973256 nonsense probably null
X0013:Sez6 UTSW 11 77954780 missense probably benign 0.01
X0067:Sez6 UTSW 11 77974438 critical splice acceptor site probably null
Z1088:Sez6 UTSW 11 77973197 missense possibly damaging 0.95
Predicted Primers PCR Primer
(F):5'- GCAAGATGGATCTCCTCCTG -3'
(R):5'- CTGGAGTCGGACTGGTAAAGAC -3'

Sequencing Primer
(F):5'- GATGGATCTCCTCCTGCCTGC -3'
(R):5'- TAAAGACGGGGCGGTTGTCC -3'
Posted On2014-06-23