Incidental Mutation 'R1835:Ankfn1'
ID 205199
Institutional Source Beutler Lab
Gene Symbol Ankfn1
Ensembl Gene ENSMUSG00000047773
Gene Name ankyrin-repeat and fibronectin type III domain containing 1
Synonyms LOC382543, 4932411E22Rik, nmf9, mWAKE
MMRRC Submission 039862-MU
Accession Numbers
Essential gene? Possibly non essential (E-score: 0.390) question?
Stock # R1835 (G1)
Quality Score 225
Status Not validated
Chromosome 11
Chromosomal Location 89280918-89668727 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 89338444 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Serine to Arginine at position 365 (S365R)
Ref Sequence ENSEMBL: ENSMUSP00000132133 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000128717] [ENSMUST00000169201]
AlphaFold A0A571BF63
Predicted Effect unknown
Transcript: ENSMUST00000128717
AA Change: S385R
SMART Domains Protein: ENSMUSP00000121290
Gene: ENSMUSG00000047773
AA Change: S385R

DomainStartEndE-ValueType
ANK 136 167 2.47e2 SMART
ANK 173 204 1.46e-2 SMART
coiled coil region 205 236 N/A INTRINSIC
FN3 271 356 1.66e-7 SMART
low complexity region 586 597 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000169201
AA Change: S365R

PolyPhen 2 Score 0.250 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000132133
Gene: ENSMUSG00000047773
AA Change: S365R

DomainStartEndE-ValueType
ANK 116 147 2.47e2 SMART
ANK 153 184 1.46e-2 SMART
coiled coil region 185 216 N/A INTRINSIC
FN3 251 336 1.66e-7 SMART
low complexity region 566 577 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000207815
AA Change: S319R
Coding Region Coverage
  • 1x: 97.4%
  • 3x: 96.8%
  • 10x: 94.9%
  • 20x: 91.0%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mutant mice exhibit a variable and subtle head nodding phenotype. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 97 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acss2 T A 2: 155,400,550 (GRCm39) Y530N probably damaging Het
Adam4 T C 12: 81,466,333 (GRCm39) I763V probably benign Het
Aipl1 T G 11: 71,921,325 (GRCm39) K190T possibly damaging Het
Alms1 T A 6: 85,655,485 (GRCm39) S3344T possibly damaging Het
Alpi A G 1: 87,027,136 (GRCm39) V381A possibly damaging Het
Aox1 G A 1: 58,348,150 (GRCm39) A623T probably benign Het
Apc T A 18: 34,450,130 (GRCm39) L2308Q probably damaging Het
Atp9b C T 18: 80,822,098 (GRCm39) V501I probably benign Het
Baz2b T C 2: 59,732,163 (GRCm39) E1994G probably benign Het
Bltp2 G T 11: 78,178,576 (GRCm39) V1993F probably damaging Het
Cacna1a T C 8: 85,307,986 (GRCm39) probably null Het
Cacna1h C A 17: 25,611,050 (GRCm39) V583L probably benign Het
Cd55 T C 1: 130,375,346 (GRCm39) probably benign Het
Cep192 T A 18: 67,937,494 (GRCm39) S75T possibly damaging Het
Cfap54 T A 10: 92,798,237 (GRCm39) D1674V probably benign Het
Churc1 T C 12: 76,820,071 (GRCm39) F27L possibly damaging Het
Coro1c A G 5: 113,986,604 (GRCm39) I280T probably benign Het
Creb1 C T 1: 64,590,109 (GRCm39) Q32* probably null Het
Cyp2b9 A G 7: 25,900,208 (GRCm39) T339A probably benign Het
Dctn3 T C 4: 41,720,813 (GRCm39) R51G probably damaging Het
Ddb1 T C 19: 10,603,957 (GRCm39) V888A probably damaging Het
Disp1 A G 1: 182,870,564 (GRCm39) Y619H probably damaging Het
Dnajc9 T C 14: 20,438,402 (GRCm39) D96G possibly damaging Het
Eepd1 A G 9: 25,394,164 (GRCm39) T143A possibly damaging Het
Eps8 T A 6: 137,499,277 (GRCm39) K204* probably null Het
Ercc5 T A 1: 44,220,035 (GRCm39) S1102R probably benign Het
Ergic2 T A 6: 148,091,079 (GRCm39) Y211F possibly damaging Het
Fam135b G T 15: 71,362,560 (GRCm39) L274M probably damaging Het
Fat3 G A 9: 15,909,384 (GRCm39) T2206I probably damaging Het
Fat4 A G 3: 39,037,720 (GRCm39) I3791V probably benign Het
Gemin4 A G 11: 76,104,122 (GRCm39) M213T possibly damaging Het
Gnai3 T C 3: 108,025,723 (GRCm39) M119V probably benign Het
Heatr5b A T 17: 79,080,992 (GRCm39) L1420Q probably damaging Het
Herc2 G T 7: 55,856,513 (GRCm39) G3918* probably null Het
Ints9 A G 14: 65,269,705 (GRCm39) Y465C probably damaging Het
Ist1 A G 8: 110,405,515 (GRCm39) V175A probably damaging Het
Kcnj12 T C 11: 60,960,383 (GRCm39) L227P possibly damaging Het
Kcnq5 T C 1: 21,536,611 (GRCm39) S416G probably benign Het
Kdm3a T A 6: 71,590,940 (GRCm39) T295S probably benign Het
Kif1c T A 11: 70,599,797 (GRCm39) M479K probably damaging Het
Kif20b T C 19: 34,933,438 (GRCm39) L83P probably damaging Het
Kndc1 A G 7: 139,507,624 (GRCm39) E1194G probably damaging Het
Llgl1 A G 11: 60,595,556 (GRCm39) M81V probably benign Het
Map4k5 C A 12: 69,871,436 (GRCm39) M495I probably damaging Het
Mest C T 6: 30,742,790 (GRCm39) R146C probably benign Het
Mettl24 T A 10: 40,613,812 (GRCm39) probably null Het
Mical1 T C 10: 41,359,531 (GRCm39) S586P probably benign Het
Mrgpra3 G T 7: 47,239,694 (GRCm39) Y77* probably null Het
Mss51 A T 14: 20,533,246 (GRCm39) C408* probably null Het
Myh6 T C 14: 55,194,858 (GRCm39) T666A probably benign Het
Myo10 T C 15: 25,805,673 (GRCm39) C1685R possibly damaging Het
Naip5 A T 13: 100,359,726 (GRCm39) Y503* probably null Het
Neil1 A C 9: 57,053,888 (GRCm39) F144C probably damaging Het
Nipbl T A 15: 8,373,001 (GRCm39) I1082F possibly damaging Het
Nkiras1 T C 14: 18,276,732 (GRCm38) V7A probably damaging Het
Nt5el C A 13: 105,218,702 (GRCm39) A12E unknown Het
Ntng2 G A 2: 29,087,069 (GRCm39) Q384* probably null Het
Ocrl T A X: 47,050,993 (GRCm39) I74N probably damaging Het
Or10j27 A G 1: 172,958,382 (GRCm39) V134A probably benign Het
Or13a22 A G 7: 140,072,622 (GRCm39) S24G probably benign Het
Or14j8 C T 17: 38,263,276 (GRCm39) G213E possibly damaging Het
Or1e22 A C 11: 73,377,200 (GRCm39) V150G probably benign Het
Or2j3 A T 17: 38,616,203 (GRCm39) S50T probably benign Het
Or2y1 A T 11: 49,385,497 (GRCm39) I46F probably damaging Het
Patj A G 4: 98,379,827 (GRCm39) D151G probably benign Het
Plpbp T C 8: 27,539,259 (GRCm39) V126A probably damaging Het
Pold2 A G 11: 5,823,454 (GRCm39) L325P possibly damaging Het
Ppp1r12c A C 7: 4,486,650 (GRCm39) S480A probably damaging Het
Pum1 T C 4: 130,428,359 (GRCm39) S124P possibly damaging Het
Pwp2 C G 10: 78,014,925 (GRCm39) G353A probably damaging Het
Reln C A 5: 22,184,000 (GRCm39) Q1666H probably damaging Het
Rnf19a T C 15: 36,266,071 (GRCm39) I9V probably benign Het
Ryr2 T C 13: 11,784,764 (GRCm39) H1063R probably benign Het
Samd14 C G 11: 94,914,426 (GRCm39) D361E probably damaging Het
Samd15 A T 12: 87,248,617 (GRCm39) N365I probably damaging Het
Sec16b A G 1: 157,358,882 (GRCm39) H105R probably benign Het
Sez6 T C 11: 77,844,329 (GRCm39) S51P probably benign Het
Sh3bp1 T A 15: 78,789,350 (GRCm39) L236Q probably damaging Het
Sspo C T 6: 48,434,274 (GRCm39) T991I probably damaging Het
Suco A T 1: 161,687,069 (GRCm39) L97* probably null Het
Tab1 C A 15: 80,032,497 (GRCm39) R35S probably benign Het
Tet3 C A 6: 83,381,145 (GRCm39) S341I possibly damaging Het
Tlr1 A T 5: 65,083,043 (GRCm39) D511E probably benign Het
Tmem132b A C 5: 125,862,963 (GRCm39) D656A probably damaging Het
Tmtc4 T A 14: 123,179,400 (GRCm39) probably null Het
Trmo T C 4: 46,380,158 (GRCm39) T404A probably damaging Het
Trpm1 A G 7: 63,880,016 (GRCm39) K790E probably damaging Het
Ulk4 C A 9: 120,997,250 (GRCm39) R774M probably null Het
Ush2a C T 1: 188,184,015 (GRCm39) L1440F probably benign Het
Usp16 A G 16: 87,277,795 (GRCm39) K682E probably damaging Het
Virma T C 4: 11,540,511 (GRCm39) S1471P probably benign Het
Vmn1r177 A T 7: 23,565,111 (GRCm39) I255N probably damaging Het
Vmn2r61 A T 7: 41,916,076 (GRCm39) R230* probably null Het
Vps13c T A 9: 67,900,295 (GRCm39) F3671L probably benign Het
Washc5 T C 15: 59,231,189 (GRCm39) N358S possibly damaging Het
Wdr72 A G 9: 74,058,899 (GRCm39) K331E probably damaging Het
Zfp986 A T 4: 145,625,805 (GRCm39) K155I probably benign Het
Other mutations in Ankfn1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01527:Ankfn1 APN 11 89,282,465 (GRCm39) missense probably benign 0.01
IGL02519:Ankfn1 APN 11 89,296,504 (GRCm39) missense probably benign
IGL02695:Ankfn1 APN 11 89,282,645 (GRCm39) missense probably damaging 0.99
IGL02818:Ankfn1 APN 11 89,429,292 (GRCm39) missense probably benign
IGL02821:Ankfn1 APN 11 89,282,442 (GRCm39) missense probably benign 0.00
IGL03166:Ankfn1 APN 11 89,429,264 (GRCm39) missense probably benign 0.19
R0056:Ankfn1 UTSW 11 89,282,502 (GRCm39) missense possibly damaging 0.71
R0070:Ankfn1 UTSW 11 89,283,128 (GRCm39) missense probably damaging 0.99
R0070:Ankfn1 UTSW 11 89,283,128 (GRCm39) missense probably damaging 0.99
R0200:Ankfn1 UTSW 11 89,332,792 (GRCm39) missense possibly damaging 0.67
R0427:Ankfn1 UTSW 11 89,296,423 (GRCm39) missense probably damaging 0.99
R0755:Ankfn1 UTSW 11 89,282,913 (GRCm39) missense probably benign
R1240:Ankfn1 UTSW 11 89,282,960 (GRCm39) missense probably damaging 0.99
R1534:Ankfn1 UTSW 11 89,413,977 (GRCm39) missense probably damaging 1.00
R1539:Ankfn1 UTSW 11 89,332,217 (GRCm39) missense probably damaging 1.00
R1548:Ankfn1 UTSW 11 89,417,367 (GRCm39) missense probably damaging 0.98
R1595:Ankfn1 UTSW 11 89,313,593 (GRCm39) critical splice donor site probably null
R1776:Ankfn1 UTSW 11 89,417,300 (GRCm39) missense possibly damaging 0.74
R2012:Ankfn1 UTSW 11 89,296,423 (GRCm39) missense probably damaging 0.99
R2037:Ankfn1 UTSW 11 89,346,946 (GRCm39) missense probably benign 0.13
R2175:Ankfn1 UTSW 11 89,417,363 (GRCm39) missense probably damaging 1.00
R2876:Ankfn1 UTSW 11 89,282,462 (GRCm39) missense possibly damaging 0.90
R3778:Ankfn1 UTSW 11 89,332,220 (GRCm39) missense probably damaging 1.00
R4720:Ankfn1 UTSW 11 89,332,252 (GRCm39) missense possibly damaging 0.50
R5001:Ankfn1 UTSW 11 89,332,268 (GRCm39) missense possibly damaging 0.85
R5318:Ankfn1 UTSW 11 89,282,754 (GRCm39) missense probably damaging 0.96
R5412:Ankfn1 UTSW 11 89,396,007 (GRCm39) missense probably benign 0.17
R5434:Ankfn1 UTSW 11 89,344,013 (GRCm39) missense probably damaging 1.00
R5458:Ankfn1 UTSW 11 89,325,636 (GRCm39) missense probably benign 0.00
R5710:Ankfn1 UTSW 11 89,394,751 (GRCm39) missense probably benign 0.02
R6457:Ankfn1 UTSW 11 89,282,670 (GRCm39) missense probably benign 0.00
R7026:Ankfn1 UTSW 11 89,530,403 (GRCm39) makesense probably null
R7356:Ankfn1 UTSW 11 89,325,599 (GRCm39) missense probably damaging 0.97
R7499:Ankfn1 UTSW 11 89,282,576 (GRCm39) missense probably benign 0.12
R7572:Ankfn1 UTSW 11 89,312,097 (GRCm39) missense probably benign
R7577:Ankfn1 UTSW 11 89,394,797 (GRCm39) missense probably benign 0.04
R7582:Ankfn1 UTSW 11 89,417,445 (GRCm39) missense probably benign 0.04
R7820:Ankfn1 UTSW 11 89,311,956 (GRCm39) missense probably damaging 0.99
R7908:Ankfn1 UTSW 11 89,296,360 (GRCm39) missense probably damaging 1.00
R7992:Ankfn1 UTSW 11 89,413,859 (GRCm39) missense probably benign 0.02
R8137:Ankfn1 UTSW 11 89,344,003 (GRCm39) missense probably benign 0.00
R8242:Ankfn1 UTSW 11 89,417,271 (GRCm39) critical splice donor site probably null
R8295:Ankfn1 UTSW 11 89,302,923 (GRCm39) missense probably benign 0.02
R8556:Ankfn1 UTSW 11 89,332,268 (GRCm39) missense possibly damaging 0.95
R8708:Ankfn1 UTSW 11 89,394,756 (GRCm39) missense possibly damaging 0.50
R8815:Ankfn1 UTSW 11 89,282,602 (GRCm39) missense probably damaging 0.96
R8835:Ankfn1 UTSW 11 89,429,379 (GRCm39) missense probably benign 0.00
R8928:Ankfn1 UTSW 11 89,429,279 (GRCm39) missense possibly damaging 0.67
R9011:Ankfn1 UTSW 11 89,417,444 (GRCm39) missense probably benign 0.00
R9062:Ankfn1 UTSW 11 89,325,583 (GRCm39) missense probably benign 0.32
R9129:Ankfn1 UTSW 11 89,312,042 (GRCm39) missense
R9153:Ankfn1 UTSW 11 89,302,845 (GRCm39) missense probably damaging 1.00
R9179:Ankfn1 UTSW 11 89,414,011 (GRCm39) missense probably benign 0.01
R9272:Ankfn1 UTSW 11 89,413,875 (GRCm39) missense probably benign 0.10
R9377:Ankfn1 UTSW 11 89,332,284 (GRCm39) missense possibly damaging 0.90
R9624:Ankfn1 UTSW 11 89,414,033 (GRCm39) missense probably benign 0.19
R9643:Ankfn1 UTSW 11 89,396,167 (GRCm39) missense probably benign 0.01
X0012:Ankfn1 UTSW 11 89,316,370 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCTGTAAAGTGATTCCAGATGTAC -3'
(R):5'- AATGGCAGCTTCCAAACTGG -3'

Sequencing Primer
(F):5'- CTGCTAAAATTACCGGCG -3'
(R):5'- TTCCAAACTGGCGGCATC -3'
Posted On 2014-06-23