Mutagenetix > Incidental Mutation

Incidental Mutation 'R1835:Cep192'

205229

Institutional Source

Beutler Lab

Gene Symbol

Cep192

Ensembl Gene

ENSMUSG00000024542

Gene Name

centrosomal protein 192

Synonyms

4631422C13Rik, D430014P18Rik

MMRRC Submission

039862-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R1835 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

67800107-67885170 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 67804424 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Serine to Threonine at position 75 (S75T)

Ref Sequence

ENSEMBL: ENSMUSP00000025425 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000025425]

AlphaFold

E9Q4Y4

Predicted Effect

possibly damaging
Transcript: ENSMUST00000025425
AA Change: S75T

PolyPhen 2 Score 0.954 (Sensitivity: 0.79; Specificity: 0.95)

SMART Domains

Protein: ENSMUSP00000025425
Gene: ENSMUSG00000024542
AA Change: S75T

Domain	Start	End	E-Value	Type
low complexity region	70	84	N/A	INTRINSIC
low complexity region	195	217	N/A	INTRINSIC
low complexity region	975	991	N/A	INTRINSIC
low complexity region	1189	1204	N/A	INTRINSIC
low complexity region	2051	2069	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000224387

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000225077

Coding Region Coverage

1x: 97.4%
3x: 96.8%
10x: 94.9%
20x: 91.0%

Validation Efficiency

Allele List at MGI

Other mutations in this stock

Total: 97 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2610507B11Rik	G	T	11: 78,287,750	V1993F	probably damaging	Het
4933425L06Rik	C	A	13: 105,082,194	A12E	unknown	Het
Acss2	T	A	2: 155,558,630	Y530N	probably damaging	Het
Adam4	T	C	12: 81,419,559	I763V	probably benign	Het
Aipl1	T	G	11: 72,030,499	K190T	possibly damaging	Het
Alms1	T	A	6: 85,678,503	S3344T	possibly damaging	Het
Alpi	A	G	1: 87,099,414	V381A	possibly damaging	Het
Ankfn1	A	T	11: 89,447,618	S365R	probably benign	Het
Aox2	G	A	1: 58,308,991	A623T	probably benign	Het
Apc	T	A	18: 34,317,077	L2308Q	probably damaging	Het
Atp9b	C	T	18: 80,778,883	V501I	probably benign	Het
Baz2b	T	C	2: 59,901,819	E1994G	probably benign	Het
Cacna1a	T	C	8: 84,581,357		probably null	Het
Cacna1h	C	A	17: 25,392,076	V583L	probably benign	Het
Cd55	T	C	1: 130,447,609		probably benign	Het
Cfap54	T	A	10: 92,962,375	D1674V	probably benign	Het
Churc1	T	C	12: 76,773,297	F27L	possibly damaging	Het
Coro1c	A	G	5: 113,848,543	I280T	probably benign	Het
Creb1	C	T	1: 64,550,950	Q32*	probably null	Het
Cyp2b9	A	G	7: 26,200,783	T339A	probably benign	Het
Dctn3	T	C	4: 41,720,813	R51G	probably damaging	Het
Ddb1	T	C	19: 10,626,593	V888A	probably damaging	Het
Disp1	A	G	1: 183,089,000	Y619H	probably damaging	Het
Dnajc9	T	C	14: 20,388,334	D96G	possibly damaging	Het
Eepd1	A	G	9: 25,482,868	T143A	possibly damaging	Het
Eps8	T	A	6: 137,522,279	K204*	probably null	Het
Ercc5	T	A	1: 44,180,875	S1102R	probably benign	Het
Ergic2	T	A	6: 148,189,581	Y211F	possibly damaging	Het
Fam135b	G	T	15: 71,490,711	L274M	probably damaging	Het
Fat3	G	A	9: 15,998,088	T2206I	probably damaging	Het
Fat4	A	G	3: 38,983,571	I3791V	probably benign	Het
Gemin4	A	G	11: 76,213,296	M213T	possibly damaging	Het
Gnai3	T	C	3: 108,118,407	M119V	probably benign	Het
Heatr5b	A	T	17: 78,773,563	L1420Q	probably damaging	Het
Herc2	G	T	7: 56,206,765	G3918*	probably null	Het
Ints9	A	G	14: 65,032,256	Y465C	probably damaging	Het
Ist1	A	G	8: 109,678,883	V175A	probably damaging	Het
Kcnj12	T	C	11: 61,069,557	L227P	possibly damaging	Het
Kcnq5	T	C	1: 21,466,387	S416G	probably benign	Het
Kdm3a	T	A	6: 71,613,956	T295S	probably benign	Het
Kif1c	T	A	11: 70,708,971	M479K	probably damaging	Het
Kif20b	T	C	19: 34,956,038	L83P	probably damaging	Het
Kndc1	A	G	7: 139,927,711	E1194G	probably damaging	Het
Llgl1	A	G	11: 60,704,730	M81V	probably benign	Het
Map4k5	C	A	12: 69,824,662	M495I	probably damaging	Het
Mest	C	T	6: 30,742,791	R146C	probably benign	Het
Mettl24	T	A	10: 40,737,816		probably null	Het
Mical1	T	C	10: 41,483,535	S586P	probably benign	Het
Mrgpra3	G	T	7: 47,589,946	Y77*	probably null	Het
Mss51	A	T	14: 20,483,178	C408*	probably null	Het
Myh6	T	C	14: 54,957,401	T666A	probably benign	Het
Myo10	T	C	15: 25,805,587	C1685R	possibly damaging	Het
Naip5	A	T	13: 100,223,218	Y503*	probably null	Het
Neil1	A	C	9: 57,146,604	F144C	probably damaging	Het
Nipbl	T	A	15: 8,343,517	I1082F	possibly damaging	Het
Nkiras1	T	C	14: 18,276,732	V7A	probably damaging	Het
Ntng2	G	A	2: 29,197,057	Q384*	probably null	Het
Ocrl	T	A	X: 47,962,116	I74N	probably damaging	Het
Olfr137	A	T	17: 38,305,312	S50T	probably benign	Het
Olfr1385	A	T	11: 49,494,670	I46F	probably damaging	Het
Olfr1408	A	G	1: 173,130,815	V134A	probably benign	Het
Olfr381	A	C	11: 73,486,374	V150G	probably benign	Het
Olfr535	A	G	7: 140,492,709	S24G	probably benign	Het
Olfr761	C	T	17: 37,952,385	G213E	possibly damaging	Het
Patj	A	G	4: 98,491,590	D151G	probably benign	Het
Plpbp	T	C	8: 27,049,231	V126A	probably damaging	Het
Pold2	A	G	11: 5,873,454	L325P	possibly damaging	Het
Ppp1r12c	A	C	7: 4,483,651	S480A	probably damaging	Het
Pum1	T	C	4: 130,701,048	S124P	possibly damaging	Het
Pwp2	C	G	10: 78,179,091	G353A	probably damaging	Het
Reln	C	A	5: 21,979,002	Q1666H	probably damaging	Het
Rnf19a	T	C	15: 36,265,925	I9V	probably benign	Het
Ryr2	T	C	13: 11,769,878	H1063R	probably benign	Het
Samd14	C	G	11: 95,023,600	D361E	probably damaging	Het
Samd15	A	T	12: 87,201,843	N365I	probably damaging	Het
Sec16b	A	G	1: 157,531,312	H105R	probably benign	Het
Sez6	T	C	11: 77,953,503	S51P	probably benign	Het
Sh3bp1	T	A	15: 78,905,150	L236Q	probably damaging	Het
Sspo	C	T	6: 48,457,340	T991I	probably damaging	Het
Suco	A	T	1: 161,859,500	L97*	probably null	Het
Tab1	C	A	15: 80,148,296	R35S	probably benign	Het
Tet3	C	A	6: 83,404,163	S341I	possibly damaging	Het
Tlr1	A	T	5: 64,925,700	D511E	probably benign	Het
Tmem132b	A	C	5: 125,785,899	D656A	probably damaging	Het
Tmtc4	T	A	14: 122,941,988		probably null	Het
Trmo	T	C	4: 46,380,158	T404A	probably damaging	Het
Trpm1	A	G	7: 64,230,268	K790E	probably damaging	Het
Ulk4	C	A	9: 121,168,184	R774M	probably null	Het
Ush2a	C	T	1: 188,451,818	L1440F	probably benign	Het
Usp16	A	G	16: 87,480,907	K682E	probably damaging	Het
Virma	T	C	4: 11,540,511	S1471P	probably benign	Het
Vmn1r177	A	T	7: 23,865,686	I255N	probably damaging	Het
Vmn2r61	A	T	7: 42,266,652	R230*	probably null	Het
Vps13c	T	A	9: 67,993,013	F3671L	probably benign	Het
Washc5	T	C	15: 59,359,340	N358S	possibly damaging	Het
Wdr72	A	G	9: 74,151,617	K331E	probably damaging	Het
Zfp986	A	T	4: 145,899,235	K155I	probably benign	Het

Other mutations in Cep192

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00156:Cep192	APN	18	67820336	missense	probably damaging	1.00
IGL00163:Cep192	APN	18	67880800	missense	possibly damaging	0.61
IGL00509:Cep192	APN	18	67858868	missense	possibly damaging	0.78
IGL01012:Cep192	APN	18	67812406	missense	possibly damaging	0.95
IGL01143:Cep192	APN	18	67804375	missense	probably damaging	0.97
IGL01302:Cep192	APN	18	67858903	missense	probably benign	0.03
IGL01653:Cep192	APN	18	67852972	missense	possibly damaging	0.57
IGL02202:Cep192	APN	18	67803137	missense	possibly damaging	0.83
IGL02448:Cep192	APN	18	67869447	missense	probably benign	0.25
IGL02494:Cep192	APN	18	67804383	missense	probably benign	0.00
IGL02574:Cep192	APN	18	67841279	missense	probably damaging	0.99
IGL02624:Cep192	APN	18	67880795	missense	probably benign	0.20
IGL02646:Cep192	APN	18	67862477	missense	probably damaging	1.00
IGL02652:Cep192	APN	18	67858850	splice site	probably benign
IGL02684:Cep192	APN	18	67834563	missense	probably damaging	0.99
IGL02977:Cep192	APN	18	67852905	missense	probably damaging	0.97
IGL03000:Cep192	APN	18	67852044	missense	probably damaging	1.00
IGL03133:Cep192	APN	18	67810105	missense	probably benign	0.00
IGL03139:Cep192	APN	18	67828476	critical splice donor site	probably null
IGL03213:Cep192	APN	18	67865637	missense	probably damaging	1.00
IGL03250:Cep192	APN	18	67807355	missense	probably benign	0.01
IGL03259:Cep192	APN	18	67820412	missense	probably damaging	1.00
R0117:Cep192	UTSW	18	67850737	critical splice donor site	probably null
R0180:Cep192	UTSW	18	67835488	missense	probably damaging	1.00
R0281:Cep192	UTSW	18	67828482	splice site	probably benign
R0374:Cep192	UTSW	18	67818883	nonsense	probably null
R0420:Cep192	UTSW	18	67813893	missense	possibly damaging	0.91
R0479:Cep192	UTSW	18	67858018	missense	probably damaging	1.00
R0652:Cep192	UTSW	18	67807265	missense	probably benign	0.04
R1024:Cep192	UTSW	18	67838054	missense	probably benign	0.37
R1382:Cep192	UTSW	18	67856299	missense	possibly damaging	0.74
R1394:Cep192	UTSW	18	67858921	missense	probably damaging	1.00
R1395:Cep192	UTSW	18	67858921	missense	probably damaging	1.00
R1641:Cep192	UTSW	18	67847433	missense	probably damaging	1.00
R1704:Cep192	UTSW	18	67856256	missense	probably damaging	1.00
R1793:Cep192	UTSW	18	67851767	missense	possibly damaging	0.74
R1978:Cep192	UTSW	18	67803158	critical splice donor site	probably null
R2164:Cep192	UTSW	18	67820360	missense	probably damaging	0.99
R2180:Cep192	UTSW	18	67824742	missense	possibly damaging	0.82
R2307:Cep192	UTSW	18	67813899	missense	probably benign	0.07
R2442:Cep192	UTSW	18	67824688	missense	possibly damaging	0.89
R2897:Cep192	UTSW	18	67855270	splice site	probably null
R2898:Cep192	UTSW	18	67855270	splice site	probably null
R2901:Cep192	UTSW	18	67869441	missense	possibly damaging	0.94
R3433:Cep192	UTSW	18	67834892	missense	probably benign	0.08
R3620:Cep192	UTSW	18	67829857	missense	probably benign	0.00
R3621:Cep192	UTSW	18	67829857	missense	probably benign	0.00
R3712:Cep192	UTSW	18	67820329	missense	probably benign	0.00
R4559:Cep192	UTSW	18	67871513	missense	probably damaging	1.00
R4590:Cep192	UTSW	18	67816791	nonsense	probably null
R4591:Cep192	UTSW	18	67834968	missense	probably damaging	0.99
R4604:Cep192	UTSW	18	67815922	missense	possibly damaging	0.64
R4627:Cep192	UTSW	18	67812369	missense	probably benign	0.03
R4725:Cep192	UTSW	18	67816766	missense	probably benign
R4738:Cep192	UTSW	18	67884830	nonsense	probably null
R4739:Cep192	UTSW	18	67851732	missense	probably benign	0.02
R4927:Cep192	UTSW	18	67835124	missense	probably benign	0.16
R4948:Cep192	UTSW	18	67816804	missense	probably benign	0.00
R5090:Cep192	UTSW	18	67860546	missense	possibly damaging	0.60
R5105:Cep192	UTSW	18	67866541	missense	probably benign	0.08
R5154:Cep192	UTSW	18	67850684	missense	probably damaging	1.00
R5192:Cep192	UTSW	18	67835004	missense	probably benign	0.03
R5735:Cep192	UTSW	18	67880795	missense	probably benign	0.20
R5812:Cep192	UTSW	18	67851737	missense	possibly damaging	0.49
R5869:Cep192	UTSW	18	67815864	missense	probably benign	0.01
R5981:Cep192	UTSW	18	67860590	missense	probably damaging	1.00
R6131:Cep192	UTSW	18	67837997	missense	possibly damaging	0.65
R6335:Cep192	UTSW	18	67834713	missense	probably damaging	1.00
R6849:Cep192	UTSW	18	67812435	missense	probably benign	0.00
R6861:Cep192	UTSW	18	67841628	missense	probably benign	0.43
R7192:Cep192	UTSW	18	67850528	missense	probably damaging	0.99
R7264:Cep192	UTSW	18	67820355	missense	probably damaging	1.00
R7397:Cep192	UTSW	18	67856197	missense	probably damaging	1.00
R7409:Cep192	UTSW	18	67834803	missense	possibly damaging	0.76
R7696:Cep192	UTSW	18	67820363	missense	probably damaging	1.00
R7756:Cep192	UTSW	18	67856313	missense	possibly damaging	0.92
R7758:Cep192	UTSW	18	67856313	missense	possibly damaging	0.92
R8247:Cep192	UTSW	18	67841117	missense	probably benign	0.02
R8695:Cep192	UTSW	18	67818887	nonsense	probably null
R8865:Cep192	UTSW	18	67834632	missense	probably benign	0.01
R8935:Cep192	UTSW	18	67862472	missense	probably damaging	1.00
R9453:Cep192	UTSW	18	67856283	nonsense	probably null
R9571:Cep192	UTSW	18	67819038	missense	probably damaging	0.98
R9581:Cep192	UTSW	18	67847394	missense	probably damaging	1.00
R9599:Cep192	UTSW	18	67835454	missense	probably benign	0.19
R9779:Cep192	UTSW	18	67835277	missense	probably damaging	1.00
RF003:Cep192	UTSW	18	67837956	missense	probably benign	0.44
X0066:Cep192	UTSW	18	67812449	splice site	probably null
Z1176:Cep192	UTSW	18	67881288	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- GTAACACTGGGGCTTCTGTG -3'
(R):5'- CCATTGTCATCTTAACAACTGCCAG -3'

Sequencing Primer
(F):5'- TACCATGCCCAGAGTGTGTAG -3'
(R):5'- CATTTTCCCCAAGTCTAAGG -3'

Posted On

2014-06-23