Incidental Mutation 'R0112:Olfr1383'
ID20525
Institutional Source Beutler Lab
Gene Symbol Olfr1383
Ensembl Gene ENSMUSG00000107417
Gene Nameolfactory receptor 1383
SynonymsMOR256-56, GA_x6K02T2QP88-5912627-5911692
MMRRC Submission 038398-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.154) question?
Stock #R0112 (G1)
Quality Score153
Status Validated (trace)
Chromosome11
Chromosomal Location49519648-49527199 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 49524134 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Leucine at position 137 (H137L)
Ref Sequence ENSEMBL: ENSMUSP00000145258 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000077143] [ENSMUST00000204706] [ENSMUST00000213152] [ENSMUST00000213707] [ENSMUST00000213899] [ENSMUST00000217564]
Predicted Effect possibly damaging
Transcript: ENSMUST00000077143
AA Change: H137L

PolyPhen 2 Score 0.696 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000076390
Gene: ENSMUSG00000107417
AA Change: H137L

DomainStartEndE-ValueType
Pfam:7tm_4 31 307 1.4e-44 PFAM
Pfam:7tm_1 41 289 3e-22 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000204706
AA Change: H137L

PolyPhen 2 Score 0.696 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000145258
Gene: ENSMUSG00000107417
AA Change: H137L

DomainStartEndE-ValueType
Pfam:7tm_4 31 307 1.4e-44 PFAM
Pfam:7tm_1 41 289 3e-22 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000213152
Predicted Effect probably benign
Transcript: ENSMUST00000213707
Predicted Effect probably benign
Transcript: ENSMUST00000213899
Predicted Effect probably benign
Transcript: ENSMUST00000217564
Meta Mutation Damage Score 0.4951 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.1%
  • 10x: 96.0%
  • 20x: 91.8%
Validation Efficiency 100% (86/86)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 81 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930568D16Rik T A 2: 35,354,803 Y179F probably benign Het
Abcd4 A G 12: 84,612,899 probably benign Het
Abhd12b C T 12: 70,181,017 T191M probably benign Het
Adcy5 A G 16: 35,156,178 E27G possibly damaging Het
Adgb G A 10: 10,407,158 probably benign Het
Afdn T C 17: 13,884,637 S1186P probably damaging Het
Atf6b G T 17: 34,651,626 R351L probably damaging Het
Axin2 T C 11: 108,939,397 S348P possibly damaging Het
BC030499 T C 11: 78,291,681 probably benign Het
Bfsp1 A C 2: 143,827,643 probably null Het
Brd1 A G 15: 88,730,383 V103A probably benign Het
Ccdc13 C A 9: 121,813,481 K392N probably damaging Het
Ccdc18 A G 5: 108,173,761 K577R probably damaging Het
Csmd2 G T 4: 128,496,029 G2186C probably damaging Het
Cyp2j5 A T 4: 96,629,523 M484K probably benign Het
Defb3 T A 8: 19,293,407 L12Q probably null Het
Defb7 G T 8: 19,495,170 probably null Het
Dhx35 T A 2: 158,840,620 M491K probably damaging Het
Dnah17 T C 11: 118,074,434 S2261G possibly damaging Het
Dnah5 A C 15: 28,263,679 E853D probably benign Het
Dner C A 1: 84,583,053 A23S probably benign Het
Dock5 A C 14: 67,819,641 S539A probably benign Het
Dsg2 T A 18: 20,583,042 F317I probably benign Het
Enox1 A T 14: 77,699,198 I539F possibly damaging Het
Eogt G A 6: 97,135,284 probably benign Het
Fbxo22 A G 9: 55,223,346 T300A probably benign Het
Fes T C 7: 80,384,005 D166G probably damaging Het
Fn1 A G 1: 71,609,653 S1366P probably damaging Het
Fndc3a A T 14: 72,540,495 probably benign Het
Foxh1 T C 15: 76,669,010 H168R probably benign Het
Galnt14 T G 17: 73,574,984 probably benign Het
Gdf6 A G 4: 9,844,482 D2G probably damaging Het
Gp6 C A 7: 4,370,184 A247S probably benign Het
Gp6 G C 7: 4,371,627 P232A probably benign Het
Grin2c A G 11: 115,251,134 Y820H probably damaging Het
Gtf2h4 T C 17: 35,670,448 T198A possibly damaging Het
Helz T C 11: 107,672,948 probably benign Het
Htr1d A G 4: 136,443,000 E180G probably benign Het
Igsf10 A G 3: 59,326,008 V1768A probably benign Het
Ints10 A T 8: 68,827,302 T694S probably damaging Het
Krt81 C A 15: 101,463,627 R24L possibly damaging Het
Lipc T A 9: 70,820,427 Y131F probably damaging Het
Litaf G T 16: 10,966,511 T45K probably damaging Het
Lmo7 A T 14: 101,887,193 R363* probably null Het
Lrrc37a A T 11: 103,500,913 Y1229N probably benign Het
Man2a2 C T 7: 80,358,276 A943T probably damaging Het
Mtor A G 4: 148,480,923 Y1030C probably damaging Het
Naalad2 G T 9: 18,351,447 Y384* probably null Het
Nat2 C T 8: 67,501,726 Q163* probably null Het
Nell2 A G 15: 95,431,681 probably benign Het
Nphp3 C T 9: 104,037,348 H102Y possibly damaging Het
Olfr1442 C T 19: 12,674,757 T184I probably benign Het
Olfr686 A T 7: 105,203,659 M228K probably benign Het
Olr1 T C 6: 129,488,906 S46G possibly damaging Het
Parg C A 14: 32,202,433 A63E probably damaging Het
Pik3cg A G 12: 32,195,715 probably benign Het
Ripk4 A G 16: 97,743,561 C629R probably benign Het
Rnf145 A G 11: 44,564,151 T620A probably benign Het
Samd9l T G 6: 3,376,031 D410A possibly damaging Het
Serpinb9f A T 13: 33,327,951 probably benign Het
Slc19a1 T C 10: 77,042,165 I178T probably benign Het
Slco1b2 A T 6: 141,671,111 Y390F probably benign Het
Speg A G 1: 75,385,032 E230G possibly damaging Het
Tbc1d9 C A 8: 83,264,837 probably benign Het
Tmem131l G A 3: 83,940,587 Q324* probably null Het
Trf A G 9: 103,226,956 probably benign Het
Trp53 T G 11: 69,588,679 Y202D probably damaging Het
Trpv1 T A 11: 73,253,272 M618K probably damaging Het
Trrap C A 5: 144,822,761 Y2250* probably null Het
Ttc3 A G 16: 94,385,322 probably benign Het
Ubtfl1 T G 9: 18,409,787 S204A probably benign Het
Uck2 A T 1: 167,227,771 Y203N probably damaging Het
Utrn A T 10: 12,686,465 L1280* probably null Het
Vmn1r178 A T 7: 23,894,184 H146L possibly damaging Het
Vmn2r100 C A 17: 19,522,120 P252Q possibly damaging Het
Vmn2r108 T C 17: 20,471,635 M209V probably benign Het
Vmn2r9 G A 5: 108,843,125 T790I probably damaging Het
Vmn2r94 C A 17: 18,243,604 R808L probably benign Het
Zbtb7c A T 18: 76,136,891 S17C probably damaging Het
Zfp811 C T 17: 32,797,764 R434Q probably damaging Het
Zkscan6 A T 11: 65,814,863 probably benign Het
Other mutations in Olfr1383
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02193:Olfr1383 APN 11 49523744 missense possibly damaging 0.56
IGL03178:Olfr1383 APN 11 49523990 missense possibly damaging 0.90
R0089:Olfr1383 UTSW 11 49524206 missense possibly damaging 0.67
R0243:Olfr1383 UTSW 11 49523912 missense probably damaging 1.00
R0445:Olfr1383 UTSW 11 49523957 missense probably damaging 1.00
R0646:Olfr1383 UTSW 11 49524578 missense probably damaging 1.00
R1695:Olfr1383 UTSW 11 49524335 missense probably benign 0.32
R2142:Olfr1383 UTSW 11 49523839 missense probably benign 0.00
R3898:Olfr1383 UTSW 11 49524559 missense probably damaging 0.98
R4085:Olfr1383 UTSW 11 49524128 missense probably benign 0.23
R5677:Olfr1383 UTSW 11 49523944 missense probably damaging 0.98
R6187:Olfr1383 UTSW 11 49523511 unclassified probably benign
R6272:Olfr1383 UTSW 11 49524126 missense possibly damaging 0.67
R6287:Olfr1383 UTSW 11 49524245 missense probably damaging 0.99
R6898:Olfr1383 UTSW 11 49523709 unclassified probably benign
R7007:Olfr1383 UTSW 11 49524184 missense probably benign 0.15
R7452:Olfr1383 UTSW 11 49524381 missense probably benign 0.03
R7699:Olfr1383 UTSW 11 49524554 missense probably damaging 1.00
R7700:Olfr1383 UTSW 11 49524554 missense probably damaging 1.00
X0017:Olfr1383 UTSW 11 49524002 missense probably benign 0.05
Predicted Primers PCR Primer
(F):5'- ACAATCTCACGAATGGATCAGCGAC -3'
(R):5'- AGCTTCAGGAGAACAAGCATCTCAC -3'

Sequencing Primer
(F):5'- TCTGCTACACCACCAGCATTG -3'
(R):5'- GCATCTCACAGAAGAAGTGGTTC -3'
Posted On2013-04-11