Incidental Mutation 'R1836:Lrrd1'
ID205271
Institutional Source Beutler Lab
Gene Symbol Lrrd1
Ensembl Gene ENSMUSG00000040367
Gene Nameleucine rich repeats and death domain containing 1
Synonyms4932412H11Rik
MMRRC Submission 039863-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.455) question?
Stock #R1836 (G1)
Quality Score225
Status Not validated
Chromosome5
Chromosomal Location3845173-3866596 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 3865709 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Serine at position 769 (T769S)
Ref Sequence ENSEMBL: ENSMUSP00000038675 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000044039]
Predicted Effect probably benign
Transcript: ENSMUST00000044039
AA Change: T769S

PolyPhen 2 Score 0.358 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000038675
Gene: ENSMUSG00000040367
AA Change: T769S

DomainStartEndE-ValueType
low complexity region 89 101 N/A INTRINSIC
low complexity region 155 165 N/A INTRINSIC
LRR 181 203 3.18e1 SMART
LRR 204 226 7.8e1 SMART
LRR 227 249 5.26e0 SMART
LRR 250 272 3.98e1 SMART
LRR 273 294 2.33e1 SMART
LRR 296 318 2.14e1 SMART
LRR_TYP 319 342 1.45e-2 SMART
LRR 365 388 4.44e0 SMART
LRR 389 410 2.76e1 SMART
LRR 411 433 8.73e1 SMART
LRR 434 457 3.55e1 SMART
LRR 480 503 1.45e1 SMART
LRR 526 548 1.31e0 SMART
LRR 549 571 3.65e1 SMART
LRR 572 594 6.22e0 SMART
LRR 595 618 2.68e1 SMART
LRR 644 665 1.15e1 SMART
LRR 667 689 8.01e0 SMART
LRR 690 713 1.53e-1 SMART
Coding Region Coverage
  • 1x: 97.4%
  • 3x: 96.8%
  • 10x: 95.1%
  • 20x: 91.8%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 108 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700029P11Rik T C 15: 81,980,867 V103A probably damaging Het
2210408I21Rik A G 13: 77,323,374 E966G probably benign Het
7420426K07Rik C A 9: 98,903,482 R67S probably benign Het
9330159F19Rik T C 10: 29,221,799 V64A probably damaging Het
Abcb5 G T 12: 118,867,961 Q1219K possibly damaging Het
Acox2 A T 14: 8,248,059 C408S possibly damaging Het
Acsf3 T A 8: 122,780,183 Y72N probably damaging Het
Acss2 T A 2: 155,558,630 Y530N probably damaging Het
Adam28 T C 14: 68,649,421 E48G possibly damaging Het
Adgrv1 A C 13: 81,504,113 M2957R probably benign Het
Adi1 C A 12: 28,679,563 D138E probably benign Het
Alk A C 17: 71,891,037 L1228R probably damaging Het
Alms1 T A 6: 85,678,503 S3344T possibly damaging Het
Aox2 G A 1: 58,308,991 A623T probably benign Het
Arhgef2 C T 3: 88,639,459 T545I probably damaging Het
Atp8a2 T A 14: 60,006,366 N630I possibly damaging Het
Bcl9 G T 3: 97,205,870 Q1090K probably damaging Het
Bdp1 A G 13: 100,035,145 S2152P probably benign Het
Birc6 T A 17: 74,614,390 S2155T probably benign Het
Camk2b T C 11: 5,972,384 E488G probably damaging Het
Capn9 T A 8: 124,605,565 probably null Het
Cd209f A G 8: 4,104,491 S119P probably damaging Het
Cep78 T C 19: 15,969,169 E433G probably damaging Het
Chid1 G T 7: 141,526,496 probably null Het
Cldnd2 T C 7: 43,442,925 S129P possibly damaging Het
Cobll1 A T 2: 65,126,236 F289Y probably damaging Het
Creb1 C T 1: 64,550,950 Q32* probably null Het
Creb3l4 G T 3: 90,238,903 S182Y probably benign Het
Dgcr2 A T 16: 17,849,720 C292S probably damaging Het
Dnah8 T C 17: 30,874,927 V4665A possibly damaging Het
Dnah9 A T 11: 66,118,841 M740K probably benign Het
Dnmt1 G A 9: 20,918,246 T687I probably damaging Het
Ece1 C T 4: 137,958,001 R601W probably damaging Het
Echdc2 C A 4: 108,165,535 R3S probably damaging Het
Ep400 A T 5: 110,705,054 L1275Q unknown Het
Epha6 A T 16: 60,205,745 W445R probably damaging Het
Ercc5 T A 1: 44,180,875 S1102R probably benign Het
Fam228a T G 12: 4,715,620 T264P probably damaging Het
Fzd6 T A 15: 39,033,920 I488N probably damaging Het
Gabrg3 T G 7: 56,729,641 N338H probably damaging Het
Gde1 A G 7: 118,695,134 F39L possibly damaging Het
Gjb3 G A 4: 127,326,431 R103W probably damaging Het
Gm4781 T A 10: 100,396,720 noncoding transcript Het
Gm4846 T A 1: 166,483,923 T456S probably benign Het
Gm5415 T G 1: 32,545,677 D384A probably damaging Het
Gpx5 A G 13: 21,287,454 I193T probably benign Het
Herc2 A T 7: 56,155,105 K2294* probably null Het
Hist1h3b T A 13: 23,752,732 V118D probably damaging Het
Iqgap3 T A 3: 88,108,368 V19D probably damaging Het
Itga5 T C 15: 103,346,014 I1006V probably damaging Het
Lamb1 C T 12: 31,301,094 T781I probably benign Het
Lias A G 5: 65,392,343 T57A probably benign Het
Lin37 C A 7: 30,556,943 R108L probably damaging Het
Mamstr T C 7: 45,644,963 W414R probably damaging Het
Mtmr11 T G 3: 96,164,786 S233R probably damaging Het
Myh1 A T 11: 67,204,822 I266F probably damaging Het
Myt1 C A 2: 181,797,275 Q197K probably benign Het
Naip5 G T 13: 100,219,687 T1140K probably benign Het
Ncf2 G A 1: 152,808,071 V14M probably damaging Het
Nhsl1 G T 10: 18,524,905 R626S possibly damaging Het
Nol12 T A 15: 78,937,889 V108E probably damaging Het
Nr1i2 G T 16: 38,249,282 P420Q probably damaging Het
Nup155 A G 15: 8,154,980 I1286M possibly damaging Het
Ocrl T A X: 47,962,116 I74N probably damaging Het
Olfr1257 A C 2: 89,881,285 H153P probably damaging Het
Olfr64 A G 7: 103,893,385 S117P probably damaging Het
Olfr993 A G 2: 85,414,405 V158A probably benign Het
Pard3b C T 1: 62,637,604 S999L probably benign Het
Pax9 A G 12: 56,700,054 E225G probably benign Het
Pdcd4 T G 19: 53,926,219 L335R probably damaging Het
Pdgfra T A 5: 75,183,014 M732K possibly damaging Het
Pkhd1 G T 1: 20,117,069 Q3672K probably benign Het
Pold2 A G 11: 5,873,454 L325P possibly damaging Het
Pom121l2 A T 13: 21,983,784 T742S probably benign Het
Ppfia1 C T 7: 144,519,631 E208K probably benign Het
Prex2 A T 1: 11,136,780 R521W probably damaging Het
Rhpn2 T C 7: 35,372,388 L226P probably benign Het
Rps12 C A 10: 23,785,629 D95Y probably damaging Het
Sardh T A 2: 27,215,182 D643V possibly damaging Het
Sars T C 3: 108,435,944 D77G probably benign Het
Scin C A 12: 40,124,698 V129F probably damaging Het
Sftpa1 T A 14: 41,132,846 M66K possibly damaging Het
Sgo1 T C 17: 53,687,771 K28E probably damaging Het
Sim2 G T 16: 94,123,577 probably null Het
Srp54b T A 12: 55,250,160 probably null Het
Stard7 T C 2: 127,295,560 V310A probably benign Het
Tasp1 T C 2: 139,951,557 D233G probably damaging Het
Tdrd6 G T 17: 43,625,589 L1523M probably benign Het
Tle3 A G 9: 61,414,023 D639G probably damaging Het
Tmem128 A G 5: 38,260,406 D2G probably damaging Het
Tmem163 A G 1: 127,677,509 S41P probably benign Het
Ttn C T 2: 76,729,161 S29632N probably damaging Het
Tuba4a A G 1: 75,216,110 S287P probably benign Het
Ubn1 G C 16: 5,077,391 G767A probably benign Het
Ugdh A T 5: 65,420,291 C288* probably null Het
Upf2 T A 2: 6,050,324 probably null Het
Vmn1r2 T C 4: 3,172,836 S252P probably damaging Het
Vmn1r28 A C 6: 58,265,252 T27P probably damaging Het
Vmn1r77 T C 7: 12,041,411 I38T probably benign Het
Vmn2r51 C A 7: 10,098,163 E499* probably null Het
Vmn2r51 G T 7: 10,098,164 Y498* probably null Het
Vmn2r53 A T 7: 12,600,885 W283R probably damaging Het
Vpreb1 T A 16: 16,869,069 T15S probably benign Het
Vps13b T C 15: 35,910,232 S3381P probably damaging Het
Wnt2 A T 6: 18,023,235 D138E probably damaging Het
Zdhhc22 A G 12: 86,983,430 V248A probably benign Het
Zfp30 T A 7: 29,793,380 I434N probably damaging Het
Zfp316 A G 5: 143,253,423 L947P probably damaging Het
Other mutations in Lrrd1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00235:Lrrd1 APN 5 3850573 missense possibly damaging 0.94
IGL00329:Lrrd1 APN 5 3850081 missense possibly damaging 0.94
IGL00674:Lrrd1 APN 5 3849773 missense possibly damaging 0.92
IGL00691:Lrrd1 APN 5 3863929 missense probably damaging 0.98
IGL00839:Lrrd1 APN 5 3850017 missense probably benign 0.00
IGL00911:Lrrd1 APN 5 3865689 missense probably benign 0.07
IGL01754:Lrrd1 APN 5 3851432 missense probably damaging 1.00
IGL01981:Lrrd1 APN 5 3851267 missense probably damaging 1.00
IGL02003:Lrrd1 APN 5 3849857 missense probably damaging 0.99
IGL02223:Lrrd1 APN 5 3850211 missense probably benign
IGL02477:Lrrd1 APN 5 3865770 missense probably benign
IGL02609:Lrrd1 APN 5 3858803 missense probably benign 0.26
IGL02833:Lrrd1 APN 5 3850709 missense probably damaging 0.98
IGL02886:Lrrd1 APN 5 3851534 missense probably benign 0.00
IGL02896:Lrrd1 APN 5 3851473 missense probably benign 0.08
R0045:Lrrd1 UTSW 5 3866418 missense possibly damaging 0.50
R0138:Lrrd1 UTSW 5 3851345 missense probably benign 0.04
R0305:Lrrd1 UTSW 5 3865707 missense probably damaging 1.00
R0346:Lrrd1 UTSW 5 3850215 missense probably benign 0.03
R0455:Lrrd1 UTSW 5 3866425 missense probably benign 0.21
R1717:Lrrd1 UTSW 5 3850580 missense probably damaging 0.99
R1719:Lrrd1 UTSW 5 3850483 unclassified probably null
R1951:Lrrd1 UTSW 5 3851488 missense probably damaging 1.00
R2199:Lrrd1 UTSW 5 3866478 missense possibly damaging 0.86
R3751:Lrrd1 UTSW 5 3850282 missense probably benign 0.37
R3752:Lrrd1 UTSW 5 3850282 missense probably benign 0.37
R3837:Lrrd1 UTSW 5 3850204 missense possibly damaging 0.73
R3862:Lrrd1 UTSW 5 3851248 missense probably benign 0.00
R3863:Lrrd1 UTSW 5 3851248 missense probably benign 0.00
R3864:Lrrd1 UTSW 5 3851248 missense probably benign 0.00
R4816:Lrrd1 UTSW 5 3851126 nonsense probably null
R5225:Lrrd1 UTSW 5 3858735 missense probably benign 0.00
R5721:Lrrd1 UTSW 5 3850619 missense probably benign 0.13
R5791:Lrrd1 UTSW 5 3851254 missense probably benign 0.11
R6077:Lrrd1 UTSW 5 3850837 missense probably benign 0.01
R6229:Lrrd1 UTSW 5 3863887 missense probably damaging 1.00
R6330:Lrrd1 UTSW 5 3850629 missense probably damaging 1.00
R6588:Lrrd1 UTSW 5 3851386 missense probably benign 0.19
R6734:Lrrd1 UTSW 5 3850226 missense possibly damaging 0.95
R6932:Lrrd1 UTSW 5 3851395 missense probably benign 0.06
R7180:Lrrd1 UTSW 5 3851459 missense probably damaging 1.00
R7771:Lrrd1 UTSW 5 3866476 missense possibly damaging 0.84
Predicted Primers PCR Primer
(F):5'- TCAGACTCTAGAAATAACAGGATGG -3'
(R):5'- AGGCCATCATCCACAGTAGC -3'

Sequencing Primer
(F):5'- GAAGACAGTTCAGCGCTATATTG -3'
(R):5'- GGCCATCATCCACAGTAGCATTATG -3'
Posted On2014-06-23