Incidental Mutation 'R1836:Vmn2r51'
ID 205283
Institutional Source Beutler Lab
Gene Symbol Vmn2r51
Ensembl Gene ENSMUSG00000058685
Gene Name vomeronasal 2, receptor 51
Synonyms
MMRRC Submission 039863-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.068) question?
Stock # R1836 (G1)
Quality Score 111
Status Not validated
Chromosome 7
Chromosomal Location 9821125-9839586 bp(-) (GRCm39)
Type of Mutation nonsense
DNA Base Change (assembly) G to T at 9832091 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Tyrosine to Stop codon at position 498 (Y498*)
Ref Sequence ENSEMBL: ENSMUSP00000092459 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000094863]
AlphaFold L7N215
Predicted Effect probably null
Transcript: ENSMUST00000094863
AA Change: Y498*
SMART Domains Protein: ENSMUSP00000092459
Gene: ENSMUSG00000058685
AA Change: Y498*

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
Pfam:ANF_receptor 73 469 2.4e-31 PFAM
Pfam:NCD3G 512 565 8.1e-21 PFAM
Pfam:7tm_3 598 833 2.7e-54 PFAM
Coding Region Coverage
  • 1x: 97.4%
  • 3x: 96.8%
  • 10x: 95.1%
  • 20x: 91.8%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 107 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2210408I21Rik A G 13: 77,471,493 (GRCm39) E966G probably benign Het
9330159F19Rik T C 10: 29,097,795 (GRCm39) V64A probably damaging Het
Abcb5 G T 12: 118,831,696 (GRCm39) Q1219K possibly damaging Het
Acox2 A T 14: 8,248,059 (GRCm38) C408S possibly damaging Het
Acsf3 T A 8: 123,506,922 (GRCm39) Y72N probably damaging Het
Acss2 T A 2: 155,400,550 (GRCm39) Y530N probably damaging Het
Adam28 T C 14: 68,886,870 (GRCm39) E48G possibly damaging Het
Adgrv1 A C 13: 81,652,232 (GRCm39) M2957R probably benign Het
Adi1 C A 12: 28,729,562 (GRCm39) D138E probably benign Het
Alk A C 17: 72,198,032 (GRCm39) L1228R probably damaging Het
Alms1 T A 6: 85,655,485 (GRCm39) S3344T possibly damaging Het
Aox1 G A 1: 58,348,150 (GRCm39) A623T probably benign Het
Arhgef2 C T 3: 88,546,766 (GRCm39) T545I probably damaging Het
Atp8a2 T A 14: 60,243,815 (GRCm39) N630I possibly damaging Het
Bcl9 G T 3: 97,113,186 (GRCm39) Q1090K probably damaging Het
Bdp1 A G 13: 100,171,653 (GRCm39) S2152P probably benign Het
Birc6 T A 17: 74,921,385 (GRCm39) S2155T probably benign Het
Camk2b T C 11: 5,922,384 (GRCm39) E488G probably damaging Het
Capn9 T A 8: 125,332,304 (GRCm39) probably null Het
Cd209f A G 8: 4,154,491 (GRCm39) S119P probably damaging Het
Cep78 T C 19: 15,946,533 (GRCm39) E433G probably damaging Het
Chid1 G T 7: 141,106,409 (GRCm39) probably null Het
Cldnd2 T C 7: 43,092,349 (GRCm39) S129P possibly damaging Het
Cobll1 A T 2: 64,956,580 (GRCm39) F289Y probably damaging Het
Creb1 C T 1: 64,590,109 (GRCm39) Q32* probably null Het
Creb3l4 G T 3: 90,146,210 (GRCm39) S182Y probably benign Het
Dgcr2 A T 16: 17,667,584 (GRCm39) C292S probably damaging Het
Dnah8 T C 17: 31,093,901 (GRCm39) V4665A possibly damaging Het
Dnah9 A T 11: 66,009,667 (GRCm39) M740K probably benign Het
Dnmt1 G A 9: 20,829,542 (GRCm39) T687I probably damaging Het
Ece1 C T 4: 137,685,312 (GRCm39) R601W probably damaging Het
Echdc2 C A 4: 108,022,732 (GRCm39) R3S probably damaging Het
Ep400 A T 5: 110,852,920 (GRCm39) L1275Q unknown Het
Epha6 A T 16: 60,026,108 (GRCm39) W445R probably damaging Het
Ercc5 T A 1: 44,220,035 (GRCm39) S1102R probably benign Het
Fam228a T G 12: 4,765,620 (GRCm39) T264P probably damaging Het
Fzd6 T A 15: 38,897,315 (GRCm39) I488N probably damaging Het
Gabrg3 T G 7: 56,379,389 (GRCm39) N338H probably damaging Het
Gde1 A G 7: 118,294,357 (GRCm39) F39L possibly damaging Het
Gjb3 G A 4: 127,220,224 (GRCm39) R103W probably damaging Het
Gm4781 T A 10: 100,232,582 (GRCm39) noncoding transcript Het
Gm4846 T A 1: 166,311,492 (GRCm39) T456S probably benign Het
Gpx5 A G 13: 21,471,624 (GRCm39) I193T probably benign Het
H3c2 T A 13: 23,936,715 (GRCm39) V118D probably damaging Het
Herc2 A T 7: 55,804,853 (GRCm39) K2294* probably null Het
Iqgap3 T A 3: 88,015,675 (GRCm39) V19D probably damaging Het
Itga5 T C 15: 103,254,441 (GRCm39) I1006V probably damaging Het
Lamb1 C T 12: 31,351,093 (GRCm39) T781I probably benign Het
Lias A G 5: 65,549,686 (GRCm39) T57A probably benign Het
Lin37 C A 7: 30,256,368 (GRCm39) R108L probably damaging Het
Lrrd1 A T 5: 3,915,709 (GRCm39) T769S probably benign Het
Mamstr T C 7: 45,294,387 (GRCm39) W414R probably damaging Het
Mtmr11 T G 3: 96,072,103 (GRCm39) S233R probably damaging Het
Myh1 A T 11: 67,095,648 (GRCm39) I266F probably damaging Het
Myt1 C A 2: 181,439,068 (GRCm39) Q197K probably benign Het
Naip5 G T 13: 100,356,195 (GRCm39) T1140K probably benign Het
Ncf2 G A 1: 152,683,822 (GRCm39) V14M probably damaging Het
Ndufb11b T C 15: 81,865,068 (GRCm39) V103A probably damaging Het
Nhsl1 G T 10: 18,400,653 (GRCm39) R626S possibly damaging Het
Nol12 T A 15: 78,822,089 (GRCm39) V108E probably damaging Het
Nr1i2 G T 16: 38,069,644 (GRCm39) P420Q probably damaging Het
Nup155 A G 15: 8,184,464 (GRCm39) I1286M possibly damaging Het
Ocrl T A X: 47,050,993 (GRCm39) I74N probably damaging Het
Or4c10b A C 2: 89,711,629 (GRCm39) H153P probably damaging Het
Or51b17 A G 7: 103,542,592 (GRCm39) S117P probably damaging Het
Or5ak23 A G 2: 85,244,749 (GRCm39) V158A probably benign Het
Pard3b C T 1: 62,676,763 (GRCm39) S999L probably benign Het
Pax9 A G 12: 56,746,839 (GRCm39) E225G probably benign Het
Pdcd4 T G 19: 53,914,650 (GRCm39) L335R probably damaging Het
Pdgfra T A 5: 75,343,675 (GRCm39) M732K possibly damaging Het
Pkhd1 G T 1: 20,187,293 (GRCm39) Q3672K probably benign Het
Pold2 A G 11: 5,823,454 (GRCm39) L325P possibly damaging Het
Pom121l2 A T 13: 22,167,954 (GRCm39) T742S probably benign Het
Ppfia1 C T 7: 144,073,368 (GRCm39) E208K probably benign Het
Prex2 A T 1: 11,207,004 (GRCm39) R521W probably damaging Het
Prr23a4 C A 9: 98,785,535 (GRCm39) R67S probably benign Het
Rhpn2 T C 7: 35,071,813 (GRCm39) L226P probably benign Het
Rps12 C A 10: 23,661,527 (GRCm39) D95Y probably damaging Het
Sardh T A 2: 27,105,194 (GRCm39) D643V possibly damaging Het
Sars1 T C 3: 108,343,260 (GRCm39) D77G probably benign Het
Scin C A 12: 40,174,697 (GRCm39) V129F probably damaging Het
Semp2l1 T G 1: 32,584,758 (GRCm39) D384A probably damaging Het
Sftpa1 T A 14: 40,854,803 (GRCm39) M66K possibly damaging Het
Sgo1 T C 17: 53,994,799 (GRCm39) K28E probably damaging Het
Sim2 G T 16: 93,924,436 (GRCm39) probably null Het
Srp54b T A 12: 55,296,945 (GRCm39) probably null Het
Stard7 T C 2: 127,137,480 (GRCm39) V310A probably benign Het
Tasp1 T C 2: 139,793,477 (GRCm39) D233G probably damaging Het
Tdrd6 G T 17: 43,936,480 (GRCm39) L1523M probably benign Het
Tle3 A G 9: 61,321,305 (GRCm39) D639G probably damaging Het
Tmem128 A G 5: 38,417,750 (GRCm39) D2G probably damaging Het
Tmem163 A G 1: 127,605,246 (GRCm39) S41P probably benign Het
Ttn C T 2: 76,559,505 (GRCm39) S29632N probably damaging Het
Tuba4a A G 1: 75,192,754 (GRCm39) S287P probably benign Het
Ubn1 G C 16: 4,895,255 (GRCm39) G767A probably benign Het
Ugdh A T 5: 65,577,634 (GRCm39) C288* probably null Het
Upf2 T A 2: 6,055,135 (GRCm39) probably null Het
Vmn1r2 T C 4: 3,172,836 (GRCm39) S252P probably damaging Het
Vmn1r28 A C 6: 58,242,237 (GRCm39) T27P probably damaging Het
Vmn1r77 T C 7: 11,775,338 (GRCm39) I38T probably benign Het
Vmn2r53 A T 7: 12,334,812 (GRCm39) W283R probably damaging Het
Vpreb1a T A 16: 16,686,933 (GRCm39) T15S probably benign Het
Vps13b T C 15: 35,910,378 (GRCm39) S3381P probably damaging Het
Wnt2 A T 6: 18,023,234 (GRCm39) D138E probably damaging Het
Zdhhc22 A G 12: 87,030,204 (GRCm39) V248A probably benign Het
Zfp30 T A 7: 29,492,805 (GRCm39) I434N probably damaging Het
Zfp316 A G 5: 143,239,178 (GRCm39) L947P probably damaging Het
Other mutations in Vmn2r51
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01398:Vmn2r51 APN 7 9,836,341 (GRCm39) missense probably benign
IGL01574:Vmn2r51 APN 7 9,836,381 (GRCm39) missense probably damaging 1.00
IGL01743:Vmn2r51 APN 7 9,834,154 (GRCm39) missense probably damaging 0.98
IGL01820:Vmn2r51 APN 7 9,839,409 (GRCm39) missense probably damaging 1.00
IGL02563:Vmn2r51 APN 7 9,834,243 (GRCm39) missense probably benign 0.00
IGL02825:Vmn2r51 APN 7 9,832,046 (GRCm39) splice site probably benign
IGL02834:Vmn2r51 APN 7 9,832,063 (GRCm39) nonsense probably null
R0617:Vmn2r51 UTSW 7 9,834,396 (GRCm39) missense possibly damaging 0.65
R0967:Vmn2r51 UTSW 7 9,834,012 (GRCm39) missense probably damaging 0.97
R1465:Vmn2r51 UTSW 7 9,834,249 (GRCm39) missense probably damaging 1.00
R1465:Vmn2r51 UTSW 7 9,834,249 (GRCm39) missense probably damaging 1.00
R1559:Vmn2r51 UTSW 7 9,836,373 (GRCm39) missense possibly damaging 0.87
R1559:Vmn2r51 UTSW 7 9,836,372 (GRCm39) missense possibly damaging 0.58
R1598:Vmn2r51 UTSW 7 9,839,432 (GRCm39) missense probably benign
R1754:Vmn2r51 UTSW 7 9,833,873 (GRCm39) missense probably benign 0.04
R1836:Vmn2r51 UTSW 7 9,832,090 (GRCm39) nonsense probably null
R3151:Vmn2r51 UTSW 7 9,833,968 (GRCm39) missense probably damaging 1.00
R4566:Vmn2r51 UTSW 7 9,836,341 (GRCm39) missense probably benign
R4933:Vmn2r51 UTSW 7 9,832,247 (GRCm39) missense probably damaging 1.00
R5004:Vmn2r51 UTSW 7 9,821,932 (GRCm39) missense probably benign
R5050:Vmn2r51 UTSW 7 9,834,349 (GRCm39) missense probably damaging 0.99
R5510:Vmn2r51 UTSW 7 9,836,545 (GRCm39) missense possibly damaging 0.95
R5559:Vmn2r51 UTSW 7 9,826,128 (GRCm39) missense probably damaging 1.00
R6127:Vmn2r51 UTSW 7 9,839,558 (GRCm39) missense probably damaging 1.00
R6154:Vmn2r51 UTSW 7 9,821,921 (GRCm39) missense possibly damaging 0.74
R6304:Vmn2r51 UTSW 7 9,832,164 (GRCm39) missense probably benign 0.00
R6370:Vmn2r51 UTSW 7 9,832,143 (GRCm39) missense probably damaging 1.00
R6471:Vmn2r51 UTSW 7 9,836,510 (GRCm39) missense possibly damaging 0.48
R6800:Vmn2r51 UTSW 7 9,832,191 (GRCm39) missense probably damaging 0.99
R6883:Vmn2r51 UTSW 7 9,834,025 (GRCm39) missense possibly damaging 0.75
R7191:Vmn2r51 UTSW 7 9,834,480 (GRCm39) missense probably null 1.00
R7246:Vmn2r51 UTSW 7 9,836,428 (GRCm39) missense probably benign 0.00
R8939:Vmn2r51 UTSW 7 9,833,953 (GRCm39) missense possibly damaging 0.85
R9154:Vmn2r51 UTSW 7 9,839,480 (GRCm39) missense probably damaging 0.96
R9428:Vmn2r51 UTSW 7 9,833,712 (GRCm39) critical splice donor site probably benign
R9451:Vmn2r51 UTSW 7 9,833,816 (GRCm39) missense probably damaging 1.00
R9729:Vmn2r51 UTSW 7 9,839,479 (GRCm39) missense probably benign 0.00
R9767:Vmn2r51 UTSW 7 9,839,407 (GRCm39) missense probably benign 0.09
Z1176:Vmn2r51 UTSW 7 9,833,835 (GRCm39) missense probably benign 0.12
Z1176:Vmn2r51 UTSW 7 9,821,984 (GRCm39) missense possibly damaging 0.76
Predicted Primers PCR Primer
(F):5'- TGGTTCTGATATGACAAAGGCATACTG -3'
(R):5'- GACCTACTTCACTAATCCTCTTGGG -3'

Sequencing Primer
(F):5'- GTTGCCGTGTATTCATCTG -3'
(R):5'- TGGGGACAAAGTGTTTATGAAGC -3'
Posted On 2014-06-23