Incidental Mutation 'R1836:Cd209f'
ID205297
Institutional Source Beutler Lab
Gene Symbol Cd209f
Ensembl Gene ENSMUSG00000051906
Gene NameCD209f antigen
Synonyms1810029C22Rik, SIGNR8
MMRRC Submission 039863-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.091) question?
Stock #R1836 (G1)
Quality Score185
Status Not validated
Chromosome8
Chromosomal Location4102787-4105835 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 4104491 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 119 (S119P)
Ref Sequence ENSEMBL: ENSMUSP00000116355 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000138439] [ENSMUST00000145007]
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128568
Predicted Effect probably damaging
Transcript: ENSMUST00000138439
AA Change: S119P

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000119810
Gene: ENSMUSG00000051906
AA Change: S119P

DomainStartEndE-ValueType
transmembrane domain 45 67 N/A INTRINSIC
low complexity region 76 88 N/A INTRINSIC
low complexity region 105 112 N/A INTRINSIC
CLECT 146 265 1.6e-32 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000145007
AA Change: S119P

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000116355
Gene: ENSMUSG00000051906
AA Change: S119P

DomainStartEndE-ValueType
transmembrane domain 45 67 N/A INTRINSIC
low complexity region 76 88 N/A INTRINSIC
low complexity region 105 112 N/A INTRINSIC
CLECT 127 246 1.6e-32 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156276
Predicted Effect noncoding transcript
Transcript: ENSMUST00000207294
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 97.4%
  • 3x: 96.8%
  • 10x: 95.1%
  • 20x: 91.8%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 108 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700029P11Rik T C 15: 81,980,867 V103A probably damaging Het
2210408I21Rik A G 13: 77,323,374 E966G probably benign Het
7420426K07Rik C A 9: 98,903,482 R67S probably benign Het
9330159F19Rik T C 10: 29,221,799 V64A probably damaging Het
Abcb5 G T 12: 118,867,961 Q1219K possibly damaging Het
Acox2 A T 14: 8,248,059 C408S possibly damaging Het
Acsf3 T A 8: 122,780,183 Y72N probably damaging Het
Acss2 T A 2: 155,558,630 Y530N probably damaging Het
Adam28 T C 14: 68,649,421 E48G possibly damaging Het
Adgrv1 A C 13: 81,504,113 M2957R probably benign Het
Adi1 C A 12: 28,679,563 D138E probably benign Het
Alk A C 17: 71,891,037 L1228R probably damaging Het
Alms1 T A 6: 85,678,503 S3344T possibly damaging Het
Aox2 G A 1: 58,308,991 A623T probably benign Het
Arhgef2 C T 3: 88,639,459 T545I probably damaging Het
Atp8a2 T A 14: 60,006,366 N630I possibly damaging Het
Bcl9 G T 3: 97,205,870 Q1090K probably damaging Het
Bdp1 A G 13: 100,035,145 S2152P probably benign Het
Birc6 T A 17: 74,614,390 S2155T probably benign Het
Camk2b T C 11: 5,972,384 E488G probably damaging Het
Capn9 T A 8: 124,605,565 probably null Het
Cep78 T C 19: 15,969,169 E433G probably damaging Het
Chid1 G T 7: 141,526,496 probably null Het
Cldnd2 T C 7: 43,442,925 S129P possibly damaging Het
Cobll1 A T 2: 65,126,236 F289Y probably damaging Het
Creb1 C T 1: 64,550,950 Q32* probably null Het
Creb3l4 G T 3: 90,238,903 S182Y probably benign Het
Dgcr2 A T 16: 17,849,720 C292S probably damaging Het
Dnah8 T C 17: 30,874,927 V4665A possibly damaging Het
Dnah9 A T 11: 66,118,841 M740K probably benign Het
Dnmt1 G A 9: 20,918,246 T687I probably damaging Het
Ece1 C T 4: 137,958,001 R601W probably damaging Het
Echdc2 C A 4: 108,165,535 R3S probably damaging Het
Ep400 A T 5: 110,705,054 L1275Q unknown Het
Epha6 A T 16: 60,205,745 W445R probably damaging Het
Ercc5 T A 1: 44,180,875 S1102R probably benign Het
Fam228a T G 12: 4,715,620 T264P probably damaging Het
Fzd6 T A 15: 39,033,920 I488N probably damaging Het
Gabrg3 T G 7: 56,729,641 N338H probably damaging Het
Gde1 A G 7: 118,695,134 F39L possibly damaging Het
Gjb3 G A 4: 127,326,431 R103W probably damaging Het
Gm4781 T A 10: 100,396,720 noncoding transcript Het
Gm4846 T A 1: 166,483,923 T456S probably benign Het
Gm5415 T G 1: 32,545,677 D384A probably damaging Het
Gpx5 A G 13: 21,287,454 I193T probably benign Het
Herc2 A T 7: 56,155,105 K2294* probably null Het
Hist1h3b T A 13: 23,752,732 V118D probably damaging Het
Iqgap3 T A 3: 88,108,368 V19D probably damaging Het
Itga5 T C 15: 103,346,014 I1006V probably damaging Het
Lamb1 C T 12: 31,301,094 T781I probably benign Het
Lias A G 5: 65,392,343 T57A probably benign Het
Lin37 C A 7: 30,556,943 R108L probably damaging Het
Lrrd1 A T 5: 3,865,709 T769S probably benign Het
Mamstr T C 7: 45,644,963 W414R probably damaging Het
Mtmr11 T G 3: 96,164,786 S233R probably damaging Het
Myh1 A T 11: 67,204,822 I266F probably damaging Het
Myt1 C A 2: 181,797,275 Q197K probably benign Het
Naip5 G T 13: 100,219,687 T1140K probably benign Het
Ncf2 G A 1: 152,808,071 V14M probably damaging Het
Nhsl1 G T 10: 18,524,905 R626S possibly damaging Het
Nol12 T A 15: 78,937,889 V108E probably damaging Het
Nr1i2 G T 16: 38,249,282 P420Q probably damaging Het
Nup155 A G 15: 8,154,980 I1286M possibly damaging Het
Ocrl T A X: 47,962,116 I74N probably damaging Het
Olfr1257 A C 2: 89,881,285 H153P probably damaging Het
Olfr64 A G 7: 103,893,385 S117P probably damaging Het
Olfr993 A G 2: 85,414,405 V158A probably benign Het
Pard3b C T 1: 62,637,604 S999L probably benign Het
Pax9 A G 12: 56,700,054 E225G probably benign Het
Pdcd4 T G 19: 53,926,219 L335R probably damaging Het
Pdgfra T A 5: 75,183,014 M732K possibly damaging Het
Pkhd1 G T 1: 20,117,069 Q3672K probably benign Het
Pold2 A G 11: 5,873,454 L325P possibly damaging Het
Pom121l2 A T 13: 21,983,784 T742S probably benign Het
Ppfia1 C T 7: 144,519,631 E208K probably benign Het
Prex2 A T 1: 11,136,780 R521W probably damaging Het
Rhpn2 T C 7: 35,372,388 L226P probably benign Het
Rps12 C A 10: 23,785,629 D95Y probably damaging Het
Sardh T A 2: 27,215,182 D643V possibly damaging Het
Sars T C 3: 108,435,944 D77G probably benign Het
Scin C A 12: 40,124,698 V129F probably damaging Het
Sftpa1 T A 14: 41,132,846 M66K possibly damaging Het
Sgo1 T C 17: 53,687,771 K28E probably damaging Het
Sim2 G T 16: 94,123,577 probably null Het
Srp54b T A 12: 55,250,160 probably null Het
Stard7 T C 2: 127,295,560 V310A probably benign Het
Tasp1 T C 2: 139,951,557 D233G probably damaging Het
Tdrd6 G T 17: 43,625,589 L1523M probably benign Het
Tle3 A G 9: 61,414,023 D639G probably damaging Het
Tmem128 A G 5: 38,260,406 D2G probably damaging Het
Tmem163 A G 1: 127,677,509 S41P probably benign Het
Ttn C T 2: 76,729,161 S29632N probably damaging Het
Tuba4a A G 1: 75,216,110 S287P probably benign Het
Ubn1 G C 16: 5,077,391 G767A probably benign Het
Ugdh A T 5: 65,420,291 C288* probably null Het
Upf2 T A 2: 6,050,324 probably null Het
Vmn1r2 T C 4: 3,172,836 S252P probably damaging Het
Vmn1r28 A C 6: 58,265,252 T27P probably damaging Het
Vmn1r77 T C 7: 12,041,411 I38T probably benign Het
Vmn2r51 C A 7: 10,098,163 E499* probably null Het
Vmn2r51 G T 7: 10,098,164 Y498* probably null Het
Vmn2r53 A T 7: 12,600,885 W283R probably damaging Het
Vpreb1 T A 16: 16,869,069 T15S probably benign Het
Vps13b T C 15: 35,910,232 S3381P probably damaging Het
Wnt2 A T 6: 18,023,235 D138E probably damaging Het
Zdhhc22 A G 12: 86,983,430 V248A probably benign Het
Zfp30 T A 7: 29,793,380 I434N probably damaging Het
Zfp316 A G 5: 143,253,423 L947P probably damaging Het
Other mutations in Cd209f
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01393:Cd209f APN 8 4103154 missense probably damaging 1.00
IGL02339:Cd209f APN 8 4104483 critical splice donor site probably null
IGL02713:Cd209f APN 8 4103732 missense probably benign 0.13
R0481:Cd209f UTSW 8 4105558 splice site probably null
R1666:Cd209f UTSW 8 4104862 nonsense probably null
R1834:Cd209f UTSW 8 4104491 missense probably damaging 1.00
R1880:Cd209f UTSW 8 4105464 critical splice donor site probably null
R2096:Cd209f UTSW 8 4105537 missense probably benign 0.03
R4672:Cd209f UTSW 8 4103685 missense probably damaging 1.00
R4931:Cd209f UTSW 8 4103688 missense probably damaging 1.00
R5263:Cd209f UTSW 8 4104506 missense probably benign 0.42
R6894:Cd209f UTSW 8 4105477 missense probably benign 0.01
R7011:Cd209f UTSW 8 4104859 missense probably benign 0.32
Predicted Primers PCR Primer
(F):5'- CCTTCTGCCTTGGACCTTAGAG -3'
(R):5'- AGACTCAGTGCTGTGGTCTG -3'

Sequencing Primer
(F):5'- TTGGACCTTAGAGCCCAGAG -3'
(R):5'- AAATGGGGTCCTGGGGTCAATATG -3'
Posted On2014-06-23