Incidental Mutation 'R1836:Pold2'
ID205308
Institutional Source Beutler Lab
Gene Symbol Pold2
Ensembl Gene ENSMUSG00000020471
Gene Namepolymerase (DNA directed), delta 2, regulatory subunit
Synonymsp50, 50kDa, po1D2
MMRRC Submission 039863-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R1836 (G1)
Quality Score225
Status Not validated
Chromosome11
Chromosomal Location5872180-5878292 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 5873454 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Proline at position 325 (L325P)
Ref Sequence ENSEMBL: ENSMUSP00000099986 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000102922] [ENSMUST00000102923] [ENSMUST00000109829] [ENSMUST00000153995]
Predicted Effect possibly damaging
Transcript: ENSMUST00000102922
AA Change: L325P

PolyPhen 2 Score 0.561 (Sensitivity: 0.88; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000099986
Gene: ENSMUSG00000020471
AA Change: L325P

DomainStartEndE-ValueType
Pfam:DNA_pol_E_B 196 412 1e-51 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000102923
SMART Domains Protein: ENSMUSP00000099987
Gene: ENSMUSG00000020473

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
low complexity region 33 46 N/A INTRINSIC
low complexity region 85 102 N/A INTRINSIC
low complexity region 113 159 N/A INTRINSIC
low complexity region 217 229 N/A INTRINSIC
low complexity region 264 290 N/A INTRINSIC
low complexity region 324 341 N/A INTRINSIC
FA58C 375 531 8.72e-46 SMART
Zn_pept 555 983 5.56e-43 SMART
low complexity region 1005 1029 N/A INTRINSIC
low complexity region 1035 1052 N/A INTRINSIC
low complexity region 1069 1089 N/A INTRINSIC
low complexity region 1092 1106 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000109829
SMART Domains Protein: ENSMUSP00000105454
Gene: ENSMUSG00000020473

DomainStartEndE-ValueType
FA58C 1 151 2.04e-37 SMART
Zn_pept 175 603 5.56e-43 SMART
low complexity region 625 649 N/A INTRINSIC
low complexity region 655 672 N/A INTRINSIC
low complexity region 689 709 N/A INTRINSIC
low complexity region 712 726 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134957
Predicted Effect noncoding transcript
Transcript: ENSMUST00000136714
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138103
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141907
Predicted Effect probably benign
Transcript: ENSMUST00000153995
SMART Domains Protein: ENSMUSP00000122906
Gene: ENSMUSG00000020471

DomainStartEndE-ValueType
PDB:3E0J|G 1 241 1e-142 PDB
Coding Region Coverage
  • 1x: 97.4%
  • 3x: 96.8%
  • 10x: 95.1%
  • 20x: 91.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes the 50-kDa catalytic subunit of DNA polymerase delta. DNA polymerase delta possesses both polymerase and 3' to 5' exonuclease activity and plays a critical role in DNA replication and repair. The encoded protein is required for the stimulation of DNA polymerase delta activity by the processivity cofactor proliferating cell nuclear antigen (PCNA). Expression of this gene may be a marker for ovarian carcinomas. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene, and a pseudogene of this gene is located on the long arm of chromosome 5. [provided by RefSeq, Mar 2012]
Allele List at MGI
Other mutations in this stock
Total: 108 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700029P11Rik T C 15: 81,980,867 V103A probably damaging Het
2210408I21Rik A G 13: 77,323,374 E966G probably benign Het
7420426K07Rik C A 9: 98,903,482 R67S probably benign Het
9330159F19Rik T C 10: 29,221,799 V64A probably damaging Het
Abcb5 G T 12: 118,867,961 Q1219K possibly damaging Het
Acox2 A T 14: 8,248,059 C408S possibly damaging Het
Acsf3 T A 8: 122,780,183 Y72N probably damaging Het
Acss2 T A 2: 155,558,630 Y530N probably damaging Het
Adam28 T C 14: 68,649,421 E48G possibly damaging Het
Adgrv1 A C 13: 81,504,113 M2957R probably benign Het
Adi1 C A 12: 28,679,563 D138E probably benign Het
Alk A C 17: 71,891,037 L1228R probably damaging Het
Alms1 T A 6: 85,678,503 S3344T possibly damaging Het
Aox2 G A 1: 58,308,991 A623T probably benign Het
Arhgef2 C T 3: 88,639,459 T545I probably damaging Het
Atp8a2 T A 14: 60,006,366 N630I possibly damaging Het
Bcl9 G T 3: 97,205,870 Q1090K probably damaging Het
Bdp1 A G 13: 100,035,145 S2152P probably benign Het
Birc6 T A 17: 74,614,390 S2155T probably benign Het
Camk2b T C 11: 5,972,384 E488G probably damaging Het
Capn9 T A 8: 124,605,565 probably null Het
Cd209f A G 8: 4,104,491 S119P probably damaging Het
Cep78 T C 19: 15,969,169 E433G probably damaging Het
Chid1 G T 7: 141,526,496 probably null Het
Cldnd2 T C 7: 43,442,925 S129P possibly damaging Het
Cobll1 A T 2: 65,126,236 F289Y probably damaging Het
Creb1 C T 1: 64,550,950 Q32* probably null Het
Creb3l4 G T 3: 90,238,903 S182Y probably benign Het
Dgcr2 A T 16: 17,849,720 C292S probably damaging Het
Dnah8 T C 17: 30,874,927 V4665A possibly damaging Het
Dnah9 A T 11: 66,118,841 M740K probably benign Het
Dnmt1 G A 9: 20,918,246 T687I probably damaging Het
Ece1 C T 4: 137,958,001 R601W probably damaging Het
Echdc2 C A 4: 108,165,535 R3S probably damaging Het
Ep400 A T 5: 110,705,054 L1275Q unknown Het
Epha6 A T 16: 60,205,745 W445R probably damaging Het
Ercc5 T A 1: 44,180,875 S1102R probably benign Het
Fam228a T G 12: 4,715,620 T264P probably damaging Het
Fzd6 T A 15: 39,033,920 I488N probably damaging Het
Gabrg3 T G 7: 56,729,641 N338H probably damaging Het
Gde1 A G 7: 118,695,134 F39L possibly damaging Het
Gjb3 G A 4: 127,326,431 R103W probably damaging Het
Gm4781 T A 10: 100,396,720 noncoding transcript Het
Gm4846 T A 1: 166,483,923 T456S probably benign Het
Gm5415 T G 1: 32,545,677 D384A probably damaging Het
Gpx5 A G 13: 21,287,454 I193T probably benign Het
Herc2 A T 7: 56,155,105 K2294* probably null Het
Hist1h3b T A 13: 23,752,732 V118D probably damaging Het
Iqgap3 T A 3: 88,108,368 V19D probably damaging Het
Itga5 T C 15: 103,346,014 I1006V probably damaging Het
Lamb1 C T 12: 31,301,094 T781I probably benign Het
Lias A G 5: 65,392,343 T57A probably benign Het
Lin37 C A 7: 30,556,943 R108L probably damaging Het
Lrrd1 A T 5: 3,865,709 T769S probably benign Het
Mamstr T C 7: 45,644,963 W414R probably damaging Het
Mtmr11 T G 3: 96,164,786 S233R probably damaging Het
Myh1 A T 11: 67,204,822 I266F probably damaging Het
Myt1 C A 2: 181,797,275 Q197K probably benign Het
Naip5 G T 13: 100,219,687 T1140K probably benign Het
Ncf2 G A 1: 152,808,071 V14M probably damaging Het
Nhsl1 G T 10: 18,524,905 R626S possibly damaging Het
Nol12 T A 15: 78,937,889 V108E probably damaging Het
Nr1i2 G T 16: 38,249,282 P420Q probably damaging Het
Nup155 A G 15: 8,154,980 I1286M possibly damaging Het
Ocrl T A X: 47,962,116 I74N probably damaging Het
Olfr1257 A C 2: 89,881,285 H153P probably damaging Het
Olfr64 A G 7: 103,893,385 S117P probably damaging Het
Olfr993 A G 2: 85,414,405 V158A probably benign Het
Pard3b C T 1: 62,637,604 S999L probably benign Het
Pax9 A G 12: 56,700,054 E225G probably benign Het
Pdcd4 T G 19: 53,926,219 L335R probably damaging Het
Pdgfra T A 5: 75,183,014 M732K possibly damaging Het
Pkhd1 G T 1: 20,117,069 Q3672K probably benign Het
Pom121l2 A T 13: 21,983,784 T742S probably benign Het
Ppfia1 C T 7: 144,519,631 E208K probably benign Het
Prex2 A T 1: 11,136,780 R521W probably damaging Het
Rhpn2 T C 7: 35,372,388 L226P probably benign Het
Rps12 C A 10: 23,785,629 D95Y probably damaging Het
Sardh T A 2: 27,215,182 D643V possibly damaging Het
Sars T C 3: 108,435,944 D77G probably benign Het
Scin C A 12: 40,124,698 V129F probably damaging Het
Sftpa1 T A 14: 41,132,846 M66K possibly damaging Het
Sgo1 T C 17: 53,687,771 K28E probably damaging Het
Sim2 G T 16: 94,123,577 probably null Het
Srp54b T A 12: 55,250,160 probably null Het
Stard7 T C 2: 127,295,560 V310A probably benign Het
Tasp1 T C 2: 139,951,557 D233G probably damaging Het
Tdrd6 G T 17: 43,625,589 L1523M probably benign Het
Tle3 A G 9: 61,414,023 D639G probably damaging Het
Tmem128 A G 5: 38,260,406 D2G probably damaging Het
Tmem163 A G 1: 127,677,509 S41P probably benign Het
Ttn C T 2: 76,729,161 S29632N probably damaging Het
Tuba4a A G 1: 75,216,110 S287P probably benign Het
Ubn1 G C 16: 5,077,391 G767A probably benign Het
Ugdh A T 5: 65,420,291 C288* probably null Het
Upf2 T A 2: 6,050,324 probably null Het
Vmn1r2 T C 4: 3,172,836 S252P probably damaging Het
Vmn1r28 A C 6: 58,265,252 T27P probably damaging Het
Vmn1r77 T C 7: 12,041,411 I38T probably benign Het
Vmn2r51 C A 7: 10,098,163 E499* probably null Het
Vmn2r51 G T 7: 10,098,164 Y498* probably null Het
Vmn2r53 A T 7: 12,600,885 W283R probably damaging Het
Vpreb1 T A 16: 16,869,069 T15S probably benign Het
Vps13b T C 15: 35,910,232 S3381P probably damaging Het
Wnt2 A T 6: 18,023,235 D138E probably damaging Het
Zdhhc22 A G 12: 86,983,430 V248A probably benign Het
Zfp30 T A 7: 29,793,380 I434N probably damaging Het
Zfp316 A G 5: 143,253,423 L947P probably damaging Het
Other mutations in Pold2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00783:Pold2 APN 11 5872412 missense probably benign 0.00
IGL00784:Pold2 APN 11 5872412 missense probably benign 0.00
IGL01014:Pold2 APN 11 5872293 missense probably benign
R0056:Pold2 UTSW 11 5872338 missense possibly damaging 0.82
R0111:Pold2 UTSW 11 5876760 missense probably damaging 1.00
R0392:Pold2 UTSW 11 5876776 missense possibly damaging 0.57
R1023:Pold2 UTSW 11 5875140 missense probably benign 0.01
R1496:Pold2 UTSW 11 5874175 missense possibly damaging 0.91
R1521:Pold2 UTSW 11 5876833 missense probably damaging 0.99
R1835:Pold2 UTSW 11 5873454 missense possibly damaging 0.56
R2032:Pold2 UTSW 11 5876757 missense probably benign
R2055:Pold2 UTSW 11 5873516 nonsense probably null
R5288:Pold2 UTSW 11 5876760 missense probably damaging 1.00
R5384:Pold2 UTSW 11 5876760 missense probably damaging 1.00
R5385:Pold2 UTSW 11 5876760 missense probably damaging 1.00
R5469:Pold2 UTSW 11 5873048 missense probably damaging 1.00
R5470:Pold2 UTSW 11 5873048 missense probably damaging 1.00
R6232:Pold2 UTSW 11 5873691 missense probably benign 0.03
R7147:Pold2 UTSW 11 5873095 missense probably benign 0.41
Predicted Primers PCR Primer
(F):5'- ACTATCTGAGATCCCACCTGATG -3'
(R):5'- AACTGAGTGTAAGCAGCCTG -3'

Sequencing Primer
(F):5'- CACCTGATGGCCTTGTGG -3'
(R):5'- ACTTGCAACTGGGGTAGC -3'
Posted On2014-06-23