Incidental Mutation 'R1836:Pax9'
ID205318
Institutional Source Beutler Lab
Gene Symbol Pax9
Ensembl Gene ENSMUSG00000001497
Gene Namepaired box 9
SynonymsPax-9
MMRRC Submission 039863-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.949) question?
Stock #R1836 (G1)
Quality Score189
Status Not validated
Chromosome12
Chromosomal Location56691767-56712822 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 56700054 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 225 (E225G)
Ref Sequence ENSEMBL: ENSMUSP00000117928 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000001538] [ENSMUST00000153250]
Predicted Effect probably benign
Transcript: ENSMUST00000001538
AA Change: E225G

PolyPhen 2 Score 0.028 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000001538
Gene: ENSMUSG00000001497
AA Change: E225G

DomainStartEndE-ValueType
PAX 4 128 6.81e-90 SMART
low complexity region 265 274 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152848
Predicted Effect probably benign
Transcript: ENSMUST00000153250
AA Change: E225G

PolyPhen 2 Score 0.028 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000117928
Gene: ENSMUSG00000001497
AA Change: E225G

DomainStartEndE-ValueType
PAX 4 128 6.81e-90 SMART
low complexity region 265 274 N/A INTRINSIC
Coding Region Coverage
  • 1x: 97.4%
  • 3x: 96.8%
  • 10x: 95.1%
  • 20x: 91.8%
Validation Efficiency
MGI Phenotype FUNCTION: This gene is a member of the paired box (PAX) family of transcription factors. Members of this gene family typically contain a paired box domain, an octapeptide, and a paired-type homeodomain. These genes play critical roles during fetal development and cancer growth. Mice lacking this gene exhibit impaired development of organs, musculature and the skeleton, including absent and abnormally developed teeth, and neonatal lethality. Mutations in the human gene are associated with selective tooth agenesis-3. [provided by RefSeq, Sep 2015]
PHENOTYPE: Homozygous inactivation of this gene results in abnormal tooth development and absent teeth and may lead to lack of pharyngeal pouch derivatives, athymia, craniofacial and limb anomalies, a small tympanic ring, various defects of the skeleton and musculature, and neonatal lethality. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 108 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700029P11Rik T C 15: 81,980,867 V103A probably damaging Het
2210408I21Rik A G 13: 77,323,374 E966G probably benign Het
7420426K07Rik C A 9: 98,903,482 R67S probably benign Het
9330159F19Rik T C 10: 29,221,799 V64A probably damaging Het
Abcb5 G T 12: 118,867,961 Q1219K possibly damaging Het
Acox2 A T 14: 8,248,059 C408S possibly damaging Het
Acsf3 T A 8: 122,780,183 Y72N probably damaging Het
Acss2 T A 2: 155,558,630 Y530N probably damaging Het
Adam28 T C 14: 68,649,421 E48G possibly damaging Het
Adgrv1 A C 13: 81,504,113 M2957R probably benign Het
Adi1 C A 12: 28,679,563 D138E probably benign Het
Alk A C 17: 71,891,037 L1228R probably damaging Het
Alms1 T A 6: 85,678,503 S3344T possibly damaging Het
Aox2 G A 1: 58,308,991 A623T probably benign Het
Arhgef2 C T 3: 88,639,459 T545I probably damaging Het
Atp8a2 T A 14: 60,006,366 N630I possibly damaging Het
Bcl9 G T 3: 97,205,870 Q1090K probably damaging Het
Bdp1 A G 13: 100,035,145 S2152P probably benign Het
Birc6 T A 17: 74,614,390 S2155T probably benign Het
Camk2b T C 11: 5,972,384 E488G probably damaging Het
Capn9 T A 8: 124,605,565 probably null Het
Cd209f A G 8: 4,104,491 S119P probably damaging Het
Cep78 T C 19: 15,969,169 E433G probably damaging Het
Chid1 G T 7: 141,526,496 probably null Het
Cldnd2 T C 7: 43,442,925 S129P possibly damaging Het
Cobll1 A T 2: 65,126,236 F289Y probably damaging Het
Creb1 C T 1: 64,550,950 Q32* probably null Het
Creb3l4 G T 3: 90,238,903 S182Y probably benign Het
Dgcr2 A T 16: 17,849,720 C292S probably damaging Het
Dnah8 T C 17: 30,874,927 V4665A possibly damaging Het
Dnah9 A T 11: 66,118,841 M740K probably benign Het
Dnmt1 G A 9: 20,918,246 T687I probably damaging Het
Ece1 C T 4: 137,958,001 R601W probably damaging Het
Echdc2 C A 4: 108,165,535 R3S probably damaging Het
Ep400 A T 5: 110,705,054 L1275Q unknown Het
Epha6 A T 16: 60,205,745 W445R probably damaging Het
Ercc5 T A 1: 44,180,875 S1102R probably benign Het
Fam228a T G 12: 4,715,620 T264P probably damaging Het
Fzd6 T A 15: 39,033,920 I488N probably damaging Het
Gabrg3 T G 7: 56,729,641 N338H probably damaging Het
Gde1 A G 7: 118,695,134 F39L possibly damaging Het
Gjb3 G A 4: 127,326,431 R103W probably damaging Het
Gm4781 T A 10: 100,396,720 noncoding transcript Het
Gm4846 T A 1: 166,483,923 T456S probably benign Het
Gm5415 T G 1: 32,545,677 D384A probably damaging Het
Gpx5 A G 13: 21,287,454 I193T probably benign Het
Herc2 A T 7: 56,155,105 K2294* probably null Het
Hist1h3b T A 13: 23,752,732 V118D probably damaging Het
Iqgap3 T A 3: 88,108,368 V19D probably damaging Het
Itga5 T C 15: 103,346,014 I1006V probably damaging Het
Lamb1 C T 12: 31,301,094 T781I probably benign Het
Lias A G 5: 65,392,343 T57A probably benign Het
Lin37 C A 7: 30,556,943 R108L probably damaging Het
Lrrd1 A T 5: 3,865,709 T769S probably benign Het
Mamstr T C 7: 45,644,963 W414R probably damaging Het
Mtmr11 T G 3: 96,164,786 S233R probably damaging Het
Myh1 A T 11: 67,204,822 I266F probably damaging Het
Myt1 C A 2: 181,797,275 Q197K probably benign Het
Naip5 G T 13: 100,219,687 T1140K probably benign Het
Ncf2 G A 1: 152,808,071 V14M probably damaging Het
Nhsl1 G T 10: 18,524,905 R626S possibly damaging Het
Nol12 T A 15: 78,937,889 V108E probably damaging Het
Nr1i2 G T 16: 38,249,282 P420Q probably damaging Het
Nup155 A G 15: 8,154,980 I1286M possibly damaging Het
Ocrl T A X: 47,962,116 I74N probably damaging Het
Olfr1257 A C 2: 89,881,285 H153P probably damaging Het
Olfr64 A G 7: 103,893,385 S117P probably damaging Het
Olfr993 A G 2: 85,414,405 V158A probably benign Het
Pard3b C T 1: 62,637,604 S999L probably benign Het
Pdcd4 T G 19: 53,926,219 L335R probably damaging Het
Pdgfra T A 5: 75,183,014 M732K possibly damaging Het
Pkhd1 G T 1: 20,117,069 Q3672K probably benign Het
Pold2 A G 11: 5,873,454 L325P possibly damaging Het
Pom121l2 A T 13: 21,983,784 T742S probably benign Het
Ppfia1 C T 7: 144,519,631 E208K probably benign Het
Prex2 A T 1: 11,136,780 R521W probably damaging Het
Rhpn2 T C 7: 35,372,388 L226P probably benign Het
Rps12 C A 10: 23,785,629 D95Y probably damaging Het
Sardh T A 2: 27,215,182 D643V possibly damaging Het
Sars T C 3: 108,435,944 D77G probably benign Het
Scin C A 12: 40,124,698 V129F probably damaging Het
Sftpa1 T A 14: 41,132,846 M66K possibly damaging Het
Sgo1 T C 17: 53,687,771 K28E probably damaging Het
Sim2 G T 16: 94,123,577 probably null Het
Srp54b T A 12: 55,250,160 probably null Het
Stard7 T C 2: 127,295,560 V310A probably benign Het
Tasp1 T C 2: 139,951,557 D233G probably damaging Het
Tdrd6 G T 17: 43,625,589 L1523M probably benign Het
Tle3 A G 9: 61,414,023 D639G probably damaging Het
Tmem128 A G 5: 38,260,406 D2G probably damaging Het
Tmem163 A G 1: 127,677,509 S41P probably benign Het
Ttn C T 2: 76,729,161 S29632N probably damaging Het
Tuba4a A G 1: 75,216,110 S287P probably benign Het
Ubn1 G C 16: 5,077,391 G767A probably benign Het
Ugdh A T 5: 65,420,291 C288* probably null Het
Upf2 T A 2: 6,050,324 probably null Het
Vmn1r2 T C 4: 3,172,836 S252P probably damaging Het
Vmn1r28 A C 6: 58,265,252 T27P probably damaging Het
Vmn1r77 T C 7: 12,041,411 I38T probably benign Het
Vmn2r51 C A 7: 10,098,163 E499* probably null Het
Vmn2r51 G T 7: 10,098,164 Y498* probably null Het
Vmn2r53 A T 7: 12,600,885 W283R probably damaging Het
Vpreb1 T A 16: 16,869,069 T15S probably benign Het
Vps13b T C 15: 35,910,232 S3381P probably damaging Het
Wnt2 A T 6: 18,023,235 D138E probably damaging Het
Zdhhc22 A G 12: 86,983,430 V248A probably benign Het
Zfp30 T A 7: 29,793,380 I434N probably damaging Het
Zfp316 A G 5: 143,253,423 L947P probably damaging Het
Other mutations in Pax9
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00087:Pax9 APN 12 56700075 missense probably benign
IGL02724:Pax9 APN 12 56709819 missense possibly damaging 0.76
R0008:Pax9 UTSW 12 56709743 missense probably benign
R0008:Pax9 UTSW 12 56709743 missense probably benign
R1916:Pax9 UTSW 12 56697138 missense possibly damaging 0.60
R2907:Pax9 UTSW 12 56709744 missense probably benign 0.03
R3778:Pax9 UTSW 12 56696748 missense probably damaging 1.00
R4905:Pax9 UTSW 12 56696626 missense probably damaging 1.00
R6247:Pax9 UTSW 12 56709695 missense probably benign
R6469:Pax9 UTSW 12 56696863 missense probably damaging 1.00
R6693:Pax9 UTSW 12 56709731 missense probably benign 0.08
R7343:Pax9 UTSW 12 56695862 start codon destroyed probably null 0.48
Predicted Primers PCR Primer
(F):5'- AGTCTATGCTTAGGCCCAGC -3'
(R):5'- CCTTGGCTTGACTAAACCCG -3'

Sequencing Primer
(F):5'- TTAGGCCCAGCGTCCCTAG -3'
(R):5'- TTGACTAAACCCGGCTGGC -3'
Posted On2014-06-23