Mutagenetix > Incidental Mutations

Incidental Mutation 'R0112:Grin2c'

20533

Institutional Source

Beutler Lab

Gene Symbol

Grin2c

Ensembl Gene

ENSMUSG00000020734

Gene Name

glutamate receptor, ionotropic, NMDA2C (epsilon 3)

Synonyms

NR2C, GluRepsilon3, NMDAR2C

MMRRC Submission

038398-MU

Accession Numbers

Is this an essential gene?

Possibly non essential (E-score: 0.327) question?

Stock #

R0112 (G1)

Quality Score

202

Status

Validated (trace)

Chromosome

Chromosomal Location

115249169-115267243 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 115251134 bp

Zygosity

Heterozygous

Amino Acid Change

Tyrosine to Histidine at position 820 (Y820H)

Ref Sequence

ENSEMBL: ENSMUSP00000102164 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000003351] [ENSMUST00000061450] [ENSMUST00000100235] [ENSMUST00000106554]

Predicted Effect

probably damaging
Transcript: ENSMUST00000003351
AA Change: Y820H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000003351
Gene: ENSMUSG00000020734
AA Change: Y820H

Domain	Start	End	E-Value	Type
signal peptide	1	24	N/A	INTRINSIC
Pfam:ANF_receptor	99	299	5.1e-12	PFAM
PBPe	440	796	1.11e-79	SMART
Lig_chan-Glu_bd	448	500	2.79e-18	SMART
transmembrane domain	816	835	N/A	INTRINSIC
Pfam:NMDAR2_C	837	924	6.8e-15	PFAM
low complexity region	941	975	N/A	INTRINSIC
low complexity region	1041	1058	N/A	INTRINSIC
low complexity region	1063	1076	N/A	INTRINSIC
low complexity region	1173	1182	N/A	INTRINSIC
low complexity region	1194	1203	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000061450

SMART Domains

Protein: ENSMUSP00000056805
Gene: ENSMUSG00000045980

Domain	Start	End	E-Value	Type
Pfam:Aa_trans	13	77	3.4e-10	PFAM
low complexity region	84	100	N/A	INTRINSIC
Pfam:Aa_trans	128	487	4.5e-15	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000100235

SMART Domains

Protein: ENSMUSP00000097807
Gene: ENSMUSG00000045980

Domain	Start	End	E-Value	Type
Pfam:Aa_trans	13	81	5.5e-11	PFAM
low complexity region	84	100	N/A	INTRINSIC
Pfam:Aa_trans	127	485	1.2e-14	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000106554
AA Change: Y820H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000102164
Gene: ENSMUSG00000020734
AA Change: Y820H

Domain	Start	End	E-Value	Type
signal peptide	1	24	N/A	INTRINSIC
Pfam:ANF_receptor	100	306	6.9e-10	PFAM
PBPe	440	796	1.11e-79	SMART
Lig_chan-Glu_bd	448	500	2.79e-18	SMART
transmembrane domain	816	835	N/A	INTRINSIC
Pfam:NMDAR2_C	837	926	1.1e-13	PFAM
low complexity region	941	975	N/A	INTRINSIC
low complexity region	1041	1058	N/A	INTRINSIC
low complexity region	1063	1076	N/A	INTRINSIC
low complexity region	1173	1182	N/A	INTRINSIC
low complexity region	1194	1203	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000158919

Meta Mutation Damage Score

0.8718

Coding Region Coverage

1x: 99.0%
3x: 98.1%
10x: 96.0%
20x: 91.8%

Validation Efficiency

100% (86/86)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a subunit of the N-methyl-D-aspartate (NMDA) receptor, which is a subtype of ionotropic glutamate receptor. NMDA receptors are found in the central nervous system, are permeable to cations and have an important role in physiological processes such as learning, memory, and synaptic development. The receptor is a tetramer of different subunits (typically heterodimer of subunit 1 with one or more of subunits 2A-D), forming a channel that is permeable to calcium, potassium, and sodium, and whose properties are determined by subunit composition. Alterations in the subunit composition of the receptor are associated with pathophysiological conditions such as Parkinson's disease, Alzheimer's disease, depression, and schizophrenia. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jun 2013]
PHENOTYPE: Homozygotes for targeted null mutations exhibit deficits in motor coordination and reduced granule cell responses to N-methy-D-aspartate in brain slices. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 81 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4930568D16Rik	T	A	2: 35,354,803	Y179F	probably benign	Het
Abcd4	A	G	12: 84,612,899		probably benign	Het
Abhd12b	C	T	12: 70,181,017	T191M	probably benign	Het
Adcy5	A	G	16: 35,156,178	E27G	possibly damaging	Het
Adgb	G	A	10: 10,407,158		probably benign	Het
Afdn	T	C	17: 13,884,637	S1186P	probably damaging	Het
Atf6b	G	T	17: 34,651,626	R351L	probably damaging	Het
Axin2	T	C	11: 108,939,397	S348P	possibly damaging	Het
BC030499	T	C	11: 78,291,681		probably benign	Het
Bfsp1	A	C	2: 143,827,643		probably null	Het
Brd1	A	G	15: 88,730,383	V103A	probably benign	Het
Ccdc13	C	A	9: 121,813,481	K392N	probably damaging	Het
Ccdc18	A	G	5: 108,173,761	K577R	probably damaging	Het
Csmd2	G	T	4: 128,496,029	G2186C	probably damaging	Het
Cyp2j5	A	T	4: 96,629,523	M484K	probably benign	Het
Defb3	T	A	8: 19,293,407	L12Q	probably null	Het
Defb7	G	T	8: 19,495,170		probably null	Het
Dhx35	T	A	2: 158,840,620	M491K	probably damaging	Het
Dnah17	T	C	11: 118,074,434	S2261G	possibly damaging	Het
Dnah5	A	C	15: 28,263,679	E853D	probably benign	Het
Dner	C	A	1: 84,583,053	A23S	probably benign	Het
Dock5	A	C	14: 67,819,641	S539A	probably benign	Het
Dsg2	T	A	18: 20,583,042	F317I	probably benign	Het
Enox1	A	T	14: 77,699,198	I539F	possibly damaging	Het
Eogt	G	A	6: 97,135,284		probably benign	Het
Fbxo22	A	G	9: 55,223,346	T300A	probably benign	Het
Fes	T	C	7: 80,384,005	D166G	probably damaging	Het
Fn1	A	G	1: 71,609,653	S1366P	probably damaging	Het
Fndc3a	A	T	14: 72,540,495		probably benign	Het
Foxh1	T	C	15: 76,669,010	H168R	probably benign	Het
Galnt14	T	G	17: 73,574,984		probably benign	Het
Gdf6	A	G	4: 9,844,482	D2G	probably damaging	Het
Gp6	C	A	7: 4,370,184	A247S	probably benign	Het
Gp6	G	C	7: 4,371,627	P232A	probably benign	Het
Gtf2h4	T	C	17: 35,670,448	T198A	possibly damaging	Het
Helz	T	C	11: 107,672,948		probably benign	Het
Htr1d	A	G	4: 136,443,000	E180G	probably benign	Het
Igsf10	A	G	3: 59,326,008	V1768A	probably benign	Het
Ints10	A	T	8: 68,827,302	T694S	probably damaging	Het
Krt81	C	A	15: 101,463,627	R24L	possibly damaging	Het
Lipc	T	A	9: 70,820,427	Y131F	probably damaging	Het
Litaf	G	T	16: 10,966,511	T45K	probably damaging	Het
Lmo7	A	T	14: 101,887,193	R363*	probably null	Het
Lrrc37a	A	T	11: 103,500,913	Y1229N	probably benign	Het
Man2a2	C	T	7: 80,358,276	A943T	probably damaging	Het
Mtor	A	G	4: 148,480,923	Y1030C	probably damaging	Het
Naalad2	G	T	9: 18,351,447	Y384*	probably null	Het
Nat2	C	T	8: 67,501,726	Q163*	probably null	Het
Nell2	A	G	15: 95,431,681		probably benign	Het
Nphp3	C	T	9: 104,037,348	H102Y	possibly damaging	Het
Olfr1383	A	T	11: 49,524,134	H137L	possibly damaging	Het
Olfr1442	C	T	19: 12,674,757	T184I	probably benign	Het
Olfr686	A	T	7: 105,203,659	M228K	probably benign	Het
Olr1	T	C	6: 129,488,906	S46G	possibly damaging	Het
Parg	C	A	14: 32,202,433	A63E	probably damaging	Het
Pik3cg	A	G	12: 32,195,715		probably benign	Het
Ripk4	A	G	16: 97,743,561	C629R	probably benign	Het
Rnf145	A	G	11: 44,564,151	T620A	probably benign	Het
Samd9l	T	G	6: 3,376,031	D410A	possibly damaging	Het
Serpinb9f	A	T	13: 33,327,951		probably benign	Het
Slc19a1	T	C	10: 77,042,165	I178T	probably benign	Het
Slco1b2	A	T	6: 141,671,111	Y390F	probably benign	Het
Speg	A	G	1: 75,385,032	E230G	possibly damaging	Het
Tbc1d9	C	A	8: 83,264,837		probably benign	Het
Tmem131l	G	A	3: 83,940,587	Q324*	probably null	Het
Trf	A	G	9: 103,226,956		probably benign	Het
Trp53	T	G	11: 69,588,679	Y202D	probably damaging	Het
Trpv1	T	A	11: 73,253,272	M618K	probably damaging	Het
Trrap	C	A	5: 144,822,761	Y2250*	probably null	Het
Ttc3	A	G	16: 94,385,322		probably benign	Het
Ubtfl1	T	G	9: 18,409,787	S204A	probably benign	Het
Uck2	A	T	1: 167,227,771	Y203N	probably damaging	Het
Utrn	A	T	10: 12,686,465	L1280*	probably null	Het
Vmn1r178	A	T	7: 23,894,184	H146L	possibly damaging	Het
Vmn2r100	C	A	17: 19,522,120	P252Q	possibly damaging	Het
Vmn2r108	T	C	17: 20,471,635	M209V	probably benign	Het
Vmn2r9	G	A	5: 108,843,125	T790I	probably damaging	Het
Vmn2r94	C	A	17: 18,243,604	R808L	probably benign	Het
Zbtb7c	A	T	18: 76,136,891	S17C	probably damaging	Het
Zfp811	C	T	17: 32,797,764	R434Q	probably damaging	Het
Zkscan6	A	T	11: 65,814,863		probably benign	Het

Other mutations in Grin2c

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01019:Grin2c	APN	11	115258110	missense	possibly damaging	0.94
IGL01306:Grin2c	APN	11	115256194	missense	probably benign	0.01
IGL01408:Grin2c	APN	11	115260882	missense	probably damaging	1.00
IGL01539:Grin2c	APN	11	115250106	missense	probably benign	0.32
IGL01931:Grin2c	APN	11	115253910	missense	probably damaging	1.00
IGL01964:Grin2c	APN	11	115253847	missense	probably damaging	1.00
IGL02796:Grin2c	APN	11	115250717	splice site	probably benign
IGL02956:Grin2c	APN	11	115257959	missense	possibly damaging	0.86
IGL03221:Grin2c	APN	11	115254044	splice site	probably benign
ANU23:Grin2c	UTSW	11	115256194	missense	probably benign	0.01
BB007:Grin2c	UTSW	11	115256237	missense	probably benign	0.01
BB017:Grin2c	UTSW	11	115256237	missense	probably benign	0.01
PIT4362001:Grin2c	UTSW	11	115249633	missense	probably benign
R0011:Grin2c	UTSW	11	115255750	missense	probably damaging	1.00
R0011:Grin2c	UTSW	11	115255750	missense	probably damaging	1.00
R0355:Grin2c	UTSW	11	115260728	splice site	probably benign
R0681:Grin2c	UTSW	11	115249653	missense	probably benign
R0791:Grin2c	UTSW	11	115250646	missense	probably damaging	1.00
R0792:Grin2c	UTSW	11	115250646	missense	probably damaging	1.00
R1512:Grin2c	UTSW	11	115253850	missense	probably damaging	1.00
R1572:Grin2c	UTSW	11	115256074	missense	possibly damaging	0.92
R1654:Grin2c	UTSW	11	115260853	missense	probably benign	0.21
R1803:Grin2c	UTSW	11	115260732	critical splice donor site	probably null
R1982:Grin2c	UTSW	11	115260905	missense	possibly damaging	0.96
R2050:Grin2c	UTSW	11	115257419	missense	possibly damaging	0.89
R2196:Grin2c	UTSW	11	115250666	missense	probably benign	0.34
R2442:Grin2c	UTSW	11	115251134	missense	probably damaging	1.00
R2509:Grin2c	UTSW	11	115251068	nonsense	probably null
R3440:Grin2c	UTSW	11	115250643	missense	probably damaging	1.00
R3965:Grin2c	UTSW	11	115260994	missense	probably damaging	1.00
R4618:Grin2c	UTSW	11	115252747	missense	probably damaging	1.00
R4735:Grin2c	UTSW	11	115249596	missense	possibly damaging	0.63
R4856:Grin2c	UTSW	11	115260790	missense	probably damaging	1.00
R4886:Grin2c	UTSW	11	115260790	missense	probably damaging	1.00
R5277:Grin2c	UTSW	11	115253813	missense	probably damaging	1.00
R5334:Grin2c	UTSW	11	115256055	missense	possibly damaging	0.76
R5553:Grin2c	UTSW	11	115252725	missense	probably null	0.96
R5711:Grin2c	UTSW	11	115250289	missense	probably benign	0.32
R5784:Grin2c	UTSW	11	115258295	missense	possibly damaging	0.94
R5849:Grin2c	UTSW	11	115260991	missense	probably benign
R6421:Grin2c	UTSW	11	115251130	missense	probably damaging	1.00
R6461:Grin2c	UTSW	11	115255696	missense	possibly damaging	0.96
R6658:Grin2c	UTSW	11	115258282	missense	possibly damaging	0.64
R7205:Grin2c	UTSW	11	115251050	missense	probably damaging	0.99
R7611:Grin2c	UTSW	11	115252685	missense	probably damaging	1.00
R7637:Grin2c	UTSW	11	115256259	splice site	probably null
R7751:Grin2c	UTSW	11	115253870	missense	probably damaging	1.00
R7847:Grin2c	UTSW	11	115260978	missense	possibly damaging	0.68
R7920:Grin2c	UTSW	11	115254144	missense	probably benign	0.33
R7930:Grin2c	UTSW	11	115256237	missense	probably benign	0.01
R7940:Grin2c	UTSW	11	115255281	missense	probably damaging	1.00
R7956:Grin2c	UTSW	11	115250148	missense	probably benign	0.16
R8081:Grin2c	UTSW	11	115249893	missense	probably damaging	0.98
R8249:Grin2c	UTSW	11	115253837	missense	probably damaging	0.98
R8447:Grin2c	UTSW	11	115257389	missense	probably benign	0.01

Predicted Primers

PCR Primer
(F):5'- AGGATTCAAAGCCCCACCATGCTG -3'
(R):5'- TCCCGACTAGGAAACAAGGATGCC -3'

Sequencing Primer
(F):5'- TATAAATGGGTCTACCGCCAG -3'
(R):5'- CAAGGATGCCTAACTGTCCTC -3'

Posted On

2013-04-11