Incidental Mutation 'R0112:Pik3cg'
ID20535
Institutional Source Beutler Lab
Gene Symbol Pik3cg
Ensembl Gene ENSMUSG00000020573
Gene Namephosphatidylinositol-4,5-bisphosphate 3-kinase catalytic subunit gamma
SynonymsPI(3)Kgamma, p110gamma, 5830428L06Rik, PI3K, PI3Kgamma
MMRRC Submission 038398-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0112 (G1)
Quality Score225
Status Validated
Chromosome12
Chromosomal Location32173473-32208659 bp(-) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) A to G at 32195715 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000151400 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000053215] [ENSMUST00000085469] [ENSMUST00000156904] [ENSMUST00000217915] [ENSMUST00000220366]
Predicted Effect probably benign
Transcript: ENSMUST00000053215
SMART Domains Protein: ENSMUSP00000062864
Gene: ENSMUSG00000020573

DomainStartEndE-ValueType
PI3K_rbd 203 312 3.56e-43 SMART
PI3K_C2 349 452 1.15e-28 SMART
PI3Ka 541 733 4.41e-89 SMART
PI3Kc 829 1094 3.9e-131 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000085469
SMART Domains Protein: ENSMUSP00000082596
Gene: ENSMUSG00000020573

DomainStartEndE-ValueType
PI3K_rbd 203 312 3.56e-43 SMART
PI3K_C2 349 452 1.15e-28 SMART
PI3Ka 541 733 4.41e-89 SMART
PI3Kc 829 1094 3.9e-131 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126814
Predicted Effect probably benign
Transcript: ENSMUST00000156904
SMART Domains Protein: ENSMUSP00000123539
Gene: ENSMUSG00000020573

DomainStartEndE-ValueType
PI3K_rbd 203 312 3.56e-43 SMART
PI3K_C2 349 452 1.15e-28 SMART
PI3Ka 541 733 4.41e-89 SMART
PI3Kc 829 1094 3.9e-131 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000217915
Predicted Effect probably benign
Transcript: ENSMUST00000220366
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.1%
  • 10x: 96.0%
  • 20x: 91.8%
Validation Efficiency 100% (86/86)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Phosphoinositide 3-kinases (PI3Ks) phosphorylate inositol lipids and are involved in the immune response. The protein encoded by this gene is a class I catalytic subunit of PI3K. Like other class I catalytic subunits (p110-alpha p110-beta, and p110-delta), the encoded protein binds a p85 regulatory subunit to form PI3K. This gene is located in a commonly deleted segment of chromosome 7 previously identified in myeloid leukemias. Several transcript variants encoding the same protein have been found for this gene. [provided by RefSeq, Jun 2015]
PHENOTYPE: Mice homozygous for disruptions in this gene display defects in thymocyte development, T cell activation, and neutrophil migration. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 81 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930568D16Rik T A 2: 35,354,803 Y179F probably benign Het
Abcd4 A G 12: 84,612,899 probably benign Het
Abhd12b C T 12: 70,181,017 T191M probably benign Het
Adcy5 A G 16: 35,156,178 E27G possibly damaging Het
Adgb G A 10: 10,407,158 probably benign Het
Afdn T C 17: 13,884,637 S1186P probably damaging Het
Atf6b G T 17: 34,651,626 R351L probably damaging Het
Axin2 T C 11: 108,939,397 S348P possibly damaging Het
BC030499 T C 11: 78,291,681 probably benign Het
Bfsp1 A C 2: 143,827,643 probably null Het
Brd1 A G 15: 88,730,383 V103A probably benign Het
Ccdc13 C A 9: 121,813,481 K392N probably damaging Het
Ccdc18 A G 5: 108,173,761 K577R probably damaging Het
Csmd2 G T 4: 128,496,029 G2186C probably damaging Het
Cyp2j5 A T 4: 96,629,523 M484K probably benign Het
Defb3 T A 8: 19,293,407 L12Q probably null Het
Defb7 G T 8: 19,495,170 probably null Het
Dhx35 T A 2: 158,840,620 M491K probably damaging Het
Dnah17 T C 11: 118,074,434 S2261G possibly damaging Het
Dnah5 A C 15: 28,263,679 E853D probably benign Het
Dner C A 1: 84,583,053 A23S probably benign Het
Dock5 A C 14: 67,819,641 S539A probably benign Het
Dsg2 T A 18: 20,583,042 F317I probably benign Het
Enox1 A T 14: 77,699,198 I539F possibly damaging Het
Eogt G A 6: 97,135,284 probably benign Het
Fbxo22 A G 9: 55,223,346 T300A probably benign Het
Fes T C 7: 80,384,005 D166G probably damaging Het
Fn1 A G 1: 71,609,653 S1366P probably damaging Het
Fndc3a A T 14: 72,540,495 probably benign Het
Foxh1 T C 15: 76,669,010 H168R probably benign Het
Galnt14 T G 17: 73,574,984 probably benign Het
Gdf6 A G 4: 9,844,482 D2G probably damaging Het
Gp6 C A 7: 4,370,184 A247S probably benign Het
Gp6 G C 7: 4,371,627 P232A probably benign Het
Grin2c A G 11: 115,251,134 Y820H probably damaging Het
Gtf2h4 T C 17: 35,670,448 T198A possibly damaging Het
Helz T C 11: 107,672,948 probably benign Het
Htr1d A G 4: 136,443,000 E180G probably benign Het
Igsf10 A G 3: 59,326,008 V1768A probably benign Het
Ints10 A T 8: 68,827,302 T694S probably damaging Het
Krt81 C A 15: 101,463,627 R24L possibly damaging Het
Lipc T A 9: 70,820,427 Y131F probably damaging Het
Litaf G T 16: 10,966,511 T45K probably damaging Het
Lmo7 A T 14: 101,887,193 R363* probably null Het
Lrrc37a A T 11: 103,500,913 Y1229N probably benign Het
Man2a2 C T 7: 80,358,276 A943T probably damaging Het
Mtor A G 4: 148,480,923 Y1030C probably damaging Het
Naalad2 G T 9: 18,351,447 Y384* probably null Het
Nat2 C T 8: 67,501,726 Q163* probably null Het
Nell2 A G 15: 95,431,681 probably benign Het
Nphp3 C T 9: 104,037,348 H102Y possibly damaging Het
Olfr1383 A T 11: 49,524,134 H137L possibly damaging Het
Olfr1442 C T 19: 12,674,757 T184I probably benign Het
Olfr686 A T 7: 105,203,659 M228K probably benign Het
Olr1 T C 6: 129,488,906 S46G possibly damaging Het
Parg C A 14: 32,202,433 A63E probably damaging Het
Ripk4 A G 16: 97,743,561 C629R probably benign Het
Rnf145 A G 11: 44,564,151 T620A probably benign Het
Samd9l T G 6: 3,376,031 D410A possibly damaging Het
Serpinb9f A T 13: 33,327,951 probably benign Het
Slc19a1 T C 10: 77,042,165 I178T probably benign Het
Slco1b2 A T 6: 141,671,111 Y390F probably benign Het
Speg A G 1: 75,385,032 E230G possibly damaging Het
Tbc1d9 C A 8: 83,264,837 probably benign Het
Tmem131l G A 3: 83,940,587 Q324* probably null Het
Trf A G 9: 103,226,956 probably benign Het
Trp53 T G 11: 69,588,679 Y202D probably damaging Het
Trpv1 T A 11: 73,253,272 M618K probably damaging Het
Trrap C A 5: 144,822,761 Y2250* probably null Het
Ttc3 A G 16: 94,385,322 probably benign Het
Ubtfl1 T G 9: 18,409,787 S204A probably benign Het
Uck2 A T 1: 167,227,771 Y203N probably damaging Het
Utrn A T 10: 12,686,465 L1280* probably null Het
Vmn1r178 A T 7: 23,894,184 H146L possibly damaging Het
Vmn2r100 C A 17: 19,522,120 P252Q possibly damaging Het
Vmn2r108 T C 17: 20,471,635 M209V probably benign Het
Vmn2r9 G A 5: 108,843,125 T790I probably damaging Het
Vmn2r94 C A 17: 18,243,604 R808L probably benign Het
Zbtb7c A T 18: 76,136,891 S17C probably damaging Het
Zfp811 C T 17: 32,797,764 R434Q probably damaging Het
Zkscan6 A T 11: 65,814,863 probably benign Het
Other mutations in Pik3cg
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00489:Pik3cg APN 12 32205149 missense probably damaging 1.00
IGL02182:Pik3cg APN 12 32205273 missense possibly damaging 0.90
IGL02273:Pik3cg APN 12 32176810 missense probably damaging 1.00
IGL02312:Pik3cg APN 12 32194821 missense possibly damaging 0.55
IGL02752:Pik3cg APN 12 32204263 missense probably damaging 1.00
IGL03107:Pik3cg APN 12 32200595 missense probably damaging 1.00
IGL03139:Pik3cg APN 12 32192223 missense probably damaging 1.00
IGL03267:Pik3cg APN 12 32205308 missense possibly damaging 0.94
IGL03367:Pik3cg APN 12 32192121 missense probably benign 0.01
PIT4283001:Pik3cg UTSW 12 32205865 missense probably damaging 1.00
PIT4472001:Pik3cg UTSW 12 32204984 missense probably damaging 0.99
PIT4514001:Pik3cg UTSW 12 32204903 missense probably damaging 1.00
R0145:Pik3cg UTSW 12 32204322 missense probably benign 0.20
R0279:Pik3cg UTSW 12 32204791 missense probably damaging 1.00
R0471:Pik3cg UTSW 12 32194771 missense probably damaging 0.99
R0494:Pik3cg UTSW 12 32204546 missense possibly damaging 0.84
R0573:Pik3cg UTSW 12 32197197 missense probably damaging 1.00
R0631:Pik3cg UTSW 12 32205203 missense probably benign
R0699:Pik3cg UTSW 12 32197342 splice site probably benign
R0826:Pik3cg UTSW 12 32195673 missense possibly damaging 0.78
R1076:Pik3cg UTSW 12 32195714 splice site probably benign
R1101:Pik3cg UTSW 12 32195646 missense probably null 0.98
R1459:Pik3cg UTSW 12 32204984 missense probably damaging 0.99
R1625:Pik3cg UTSW 12 32194742 missense probably damaging 1.00
R1971:Pik3cg UTSW 12 32192153 missense probably damaging 1.00
R1992:Pik3cg UTSW 12 32204025 missense possibly damaging 0.83
R2109:Pik3cg UTSW 12 32193710 missense possibly damaging 0.75
R2319:Pik3cg UTSW 12 32176736 missense probably damaging 0.99
R3421:Pik3cg UTSW 12 32204739 missense probably damaging 1.00
R3422:Pik3cg UTSW 12 32204739 missense probably damaging 1.00
R3740:Pik3cg UTSW 12 32205224 missense probably damaging 1.00
R3777:Pik3cg UTSW 12 32194709 missense probably damaging 0.98
R4300:Pik3cg UTSW 12 32176672 missense probably damaging 1.00
R4395:Pik3cg UTSW 12 32204092 missense probably damaging 1.00
R4725:Pik3cg UTSW 12 32193597 critical splice donor site probably null
R4785:Pik3cg UTSW 12 32205199 missense probably damaging 0.97
R4809:Pik3cg UTSW 12 32204081 missense possibly damaging 0.46
R4981:Pik3cg UTSW 12 32204104 missense possibly damaging 0.77
R5033:Pik3cg UTSW 12 32199196 splice site probably null
R5161:Pik3cg UTSW 12 32204978 missense possibly damaging 0.92
R5806:Pik3cg UTSW 12 32204953 missense possibly damaging 0.88
R6136:Pik3cg UTSW 12 32204359 missense probably benign 0.00
R6746:Pik3cg UTSW 12 32194758 missense probably damaging 1.00
R6895:Pik3cg UTSW 12 32204347 missense possibly damaging 0.87
R7000:Pik3cg UTSW 12 32192129 missense probably damaging 1.00
R7089:Pik3cg UTSW 12 32176846 missense probably benign 0.00
R7113:Pik3cg UTSW 12 32205667 missense probably damaging 0.98
R7372:Pik3cg UTSW 12 32197197 missense probably damaging 1.00
R7483:Pik3cg UTSW 12 32195648 missense probably damaging 0.99
R7596:Pik3cg UTSW 12 32204741 missense probably damaging 1.00
R7771:Pik3cg UTSW 12 32204014 missense probably benign
R7910:Pik3cg UTSW 12 32200517 missense probably benign 0.16
R7974:Pik3cg UTSW 12 32204032 missense probably benign 0.00
R8084:Pik3cg UTSW 12 32195688 missense probably benign 0.30
R8352:Pik3cg UTSW 12 32193640 missense probably damaging 1.00
R8452:Pik3cg UTSW 12 32193640 missense probably damaging 1.00
Z1176:Pik3cg UTSW 12 32204795 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CTTTTAAAGCCAGCAGAGTGCTGTG -3'
(R):5'- TGGAGCCCACTATGCACTGAAAC -3'

Sequencing Primer
(F):5'- AGTGCTGTGCCGCTCATC -3'
(R):5'- TCCTGTACCACTGAATGGAAATAGC -3'
Posted On2013-04-11