Incidental Mutation 'R1836:Birc6'
ID 205350
Institutional Source Beutler Lab
Gene Symbol Birc6
Ensembl Gene ENSMUSG00000024073
Gene Name baculoviral IAP repeat-containing 6
Synonyms D630005A10Rik, A430032G04Rik, apollon, Bruce, A430040A19Rik
MMRRC Submission 039863-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R1836 (G1)
Quality Score 225
Status Not validated
Chromosome 17
Chromosomal Location 74835290-75010351 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 74921385 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Serine to Threonine at position 2155 (S2155T)
Ref Sequence ENSEMBL: ENSMUSP00000138693 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000180037] [ENSMUST00000182133] [ENSMUST00000182278] [ENSMUST00000182597] [ENSMUST00000182845] [ENSMUST00000182944] [ENSMUST00000183224]
AlphaFold no structure available at present
Predicted Effect unknown
Transcript: ENSMUST00000177957
AA Change: S854T
Predicted Effect probably benign
Transcript: ENSMUST00000180037
AA Change: S2161T

PolyPhen 2 Score 0.285 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000136329
Gene: ENSMUSG00000024073
AA Change: S2161T

DomainStartEndE-ValueType
low complexity region 24 54 N/A INTRINSIC
BIR 287 363 2.87e-24 SMART
low complexity region 472 493 N/A INTRINSIC
low complexity region 624 635 N/A INTRINSIC
low complexity region 674 685 N/A INTRINSIC
low complexity region 769 781 N/A INTRINSIC
low complexity region 1054 1071 N/A INTRINSIC
low complexity region 1369 1380 N/A INTRINSIC
coiled coil region 1620 1675 N/A INTRINSIC
low complexity region 1709 1726 N/A INTRINSIC
low complexity region 1993 1998 N/A INTRINSIC
low complexity region 2044 2059 N/A INTRINSIC
low complexity region 2142 2163 N/A INTRINSIC
low complexity region 2253 2266 N/A INTRINSIC
low complexity region 2491 2505 N/A INTRINSIC
low complexity region 2671 2688 N/A INTRINSIC
low complexity region 2893 2905 N/A INTRINSIC
low complexity region 2958 2970 N/A INTRINSIC
Pfam:DUF3643 3477 3632 1e-69 PFAM
low complexity region 3747 3772 N/A INTRINSIC
low complexity region 3900 3919 N/A INTRINSIC
low complexity region 3940 3958 N/A INTRINSIC
low complexity region 3963 3972 N/A INTRINSIC
low complexity region 4146 4157 N/A INTRINSIC
low complexity region 4307 4318 N/A INTRINSIC
low complexity region 4433 4444 N/A INTRINSIC
UBCc 4592 4756 1.04e-25 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000181387
Predicted Effect probably benign
Transcript: ENSMUST00000182133
AA Change: S2155T

PolyPhen 2 Score 0.407 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000138693
Gene: ENSMUSG00000024073
AA Change: S2155T

DomainStartEndE-ValueType
low complexity region 24 54 N/A INTRINSIC
BIR 287 363 2.87e-24 SMART
low complexity region 472 493 N/A INTRINSIC
low complexity region 624 635 N/A INTRINSIC
low complexity region 674 685 N/A INTRINSIC
low complexity region 769 781 N/A INTRINSIC
low complexity region 1054 1071 N/A INTRINSIC
low complexity region 1369 1380 N/A INTRINSIC
coiled coil region 1620 1675 N/A INTRINSIC
low complexity region 1709 1726 N/A INTRINSIC
low complexity region 1993 1998 N/A INTRINSIC
low complexity region 2044 2055 N/A INTRINSIC
low complexity region 2136 2157 N/A INTRINSIC
low complexity region 2247 2260 N/A INTRINSIC
low complexity region 2485 2499 N/A INTRINSIC
low complexity region 2665 2682 N/A INTRINSIC
low complexity region 2887 2899 N/A INTRINSIC
low complexity region 2952 2964 N/A INTRINSIC
Pfam:DUF3643 3470 3626 2.1e-71 PFAM
low complexity region 3741 3766 N/A INTRINSIC
low complexity region 3894 3913 N/A INTRINSIC
low complexity region 3934 3952 N/A INTRINSIC
low complexity region 3957 3966 N/A INTRINSIC
low complexity region 4140 4151 N/A INTRINSIC
low complexity region 4301 4312 N/A INTRINSIC
low complexity region 4427 4438 N/A INTRINSIC
UBCc 4586 4750 1.04e-25 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000182164
Predicted Effect noncoding transcript
Transcript: ENSMUST00000182206
Predicted Effect noncoding transcript
Transcript: ENSMUST00000182221
Predicted Effect probably benign
Transcript: ENSMUST00000182278
AA Change: S241T

PolyPhen 2 Score 0.099 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000138343
Gene: ENSMUSG00000024073
AA Change: S241T

DomainStartEndE-ValueType
low complexity region 79 84 N/A INTRINSIC
low complexity region 130 141 N/A INTRINSIC
low complexity region 222 243 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000182597
AA Change: S2161T

PolyPhen 2 Score 0.285 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000138333
Gene: ENSMUSG00000024073
AA Change: S2161T

DomainStartEndE-ValueType
low complexity region 24 54 N/A INTRINSIC
BIR 287 363 2.87e-24 SMART
low complexity region 472 493 N/A INTRINSIC
low complexity region 624 635 N/A INTRINSIC
low complexity region 674 685 N/A INTRINSIC
low complexity region 769 781 N/A INTRINSIC
low complexity region 1054 1071 N/A INTRINSIC
low complexity region 1369 1380 N/A INTRINSIC
coiled coil region 1620 1675 N/A INTRINSIC
low complexity region 1709 1726 N/A INTRINSIC
low complexity region 1993 1998 N/A INTRINSIC
low complexity region 2044 2059 N/A INTRINSIC
low complexity region 2142 2163 N/A INTRINSIC
low complexity region 2262 2275 N/A INTRINSIC
low complexity region 2500 2514 N/A INTRINSIC
low complexity region 2680 2697 N/A INTRINSIC
low complexity region 2902 2914 N/A INTRINSIC
low complexity region 2967 2979 N/A INTRINSIC
Pfam:DUF3643 3485 3641 2.2e-71 PFAM
low complexity region 3756 3781 N/A INTRINSIC
low complexity region 3909 3928 N/A INTRINSIC
low complexity region 3949 3967 N/A INTRINSIC
low complexity region 3972 3981 N/A INTRINSIC
low complexity region 4155 4166 N/A INTRINSIC
low complexity region 4316 4327 N/A INTRINSIC
low complexity region 4442 4453 N/A INTRINSIC
UBCc 4601 4765 1.04e-25 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000182845
AA Change: S334T

PolyPhen 2 Score 0.165 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000138717
Gene: ENSMUSG00000024073
AA Change: S334T

DomainStartEndE-ValueType
low complexity region 166 171 N/A INTRINSIC
low complexity region 217 232 N/A INTRINSIC
low complexity region 315 336 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000182944
AA Change: S2157T

PolyPhen 2 Score 0.285 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000138732
Gene: ENSMUSG00000024073
AA Change: S2157T

DomainStartEndE-ValueType
low complexity region 24 54 N/A INTRINSIC
BIR 287 363 2.87e-24 SMART
low complexity region 472 493 N/A INTRINSIC
low complexity region 624 635 N/A INTRINSIC
low complexity region 674 685 N/A INTRINSIC
low complexity region 769 781 N/A INTRINSIC
low complexity region 1054 1071 N/A INTRINSIC
low complexity region 1369 1380 N/A INTRINSIC
coiled coil region 1616 1671 N/A INTRINSIC
low complexity region 1705 1722 N/A INTRINSIC
low complexity region 1989 1994 N/A INTRINSIC
low complexity region 2040 2055 N/A INTRINSIC
low complexity region 2138 2159 N/A INTRINSIC
low complexity region 2249 2262 N/A INTRINSIC
low complexity region 2487 2501 N/A INTRINSIC
low complexity region 2667 2684 N/A INTRINSIC
low complexity region 2889 2901 N/A INTRINSIC
low complexity region 2954 2966 N/A INTRINSIC
Pfam:DUF3643 3472 3628 3.2e-71 PFAM
low complexity region 3743 3768 N/A INTRINSIC
low complexity region 3896 3915 N/A INTRINSIC
low complexity region 3936 3954 N/A INTRINSIC
low complexity region 3959 3968 N/A INTRINSIC
low complexity region 4142 4153 N/A INTRINSIC
low complexity region 4303 4314 N/A INTRINSIC
low complexity region 4429 4440 N/A INTRINSIC
UBCc 4588 4752 1.04e-25 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000183224
AA Change: S2141T

PolyPhen 2 Score 0.285 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000138270
Gene: ENSMUSG00000024073
AA Change: S2141T

DomainStartEndE-ValueType
low complexity region 2 26 N/A INTRINSIC
BIR 259 335 2.87e-24 SMART
low complexity region 444 465 N/A INTRINSIC
low complexity region 596 607 N/A INTRINSIC
low complexity region 646 657 N/A INTRINSIC
low complexity region 741 753 N/A INTRINSIC
low complexity region 1026 1043 N/A INTRINSIC
low complexity region 1355 1366 N/A INTRINSIC
coiled coil region 1606 1661 N/A INTRINSIC
low complexity region 1695 1712 N/A INTRINSIC
low complexity region 1979 1984 N/A INTRINSIC
low complexity region 2030 2041 N/A INTRINSIC
low complexity region 2122 2143 N/A INTRINSIC
low complexity region 2233 2246 N/A INTRINSIC
low complexity region 2471 2485 N/A INTRINSIC
low complexity region 2651 2668 N/A INTRINSIC
low complexity region 2873 2885 N/A INTRINSIC
low complexity region 2938 2950 N/A INTRINSIC
Pfam:DUF3643 3456 3612 3.2e-71 PFAM
low complexity region 3727 3752 N/A INTRINSIC
low complexity region 3880 3899 N/A INTRINSIC
low complexity region 3920 3938 N/A INTRINSIC
low complexity region 3943 3952 N/A INTRINSIC
low complexity region 4126 4137 N/A INTRINSIC
low complexity region 4287 4298 N/A INTRINSIC
low complexity region 4413 4424 N/A INTRINSIC
UBCc 4572 4736 1.04e-25 SMART
Coding Region Coverage
  • 1x: 97.4%
  • 3x: 96.8%
  • 10x: 95.1%
  • 20x: 91.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein with a BIR (baculoviral inhibition of apoptosis protein repeat) domain and a UBCc (ubiquitin-conjugating enzyme E2, catalytic) domain. This protein inhibits apoptosis by facilitating the degradation of apoptotic proteins by ubiquitination. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous mice exhibit perinatal lethality and exhibit placental defects. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 108 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2210408I21Rik A G 13: 77,471,493 (GRCm39) E966G probably benign Het
9330159F19Rik T C 10: 29,097,795 (GRCm39) V64A probably damaging Het
Abcb5 G T 12: 118,831,696 (GRCm39) Q1219K possibly damaging Het
Acox2 A T 14: 8,248,059 (GRCm38) C408S possibly damaging Het
Acsf3 T A 8: 123,506,922 (GRCm39) Y72N probably damaging Het
Acss2 T A 2: 155,400,550 (GRCm39) Y530N probably damaging Het
Adam28 T C 14: 68,886,870 (GRCm39) E48G possibly damaging Het
Adgrv1 A C 13: 81,652,232 (GRCm39) M2957R probably benign Het
Adi1 C A 12: 28,729,562 (GRCm39) D138E probably benign Het
Alk A C 17: 72,198,032 (GRCm39) L1228R probably damaging Het
Alms1 T A 6: 85,655,485 (GRCm39) S3344T possibly damaging Het
Aox1 G A 1: 58,348,150 (GRCm39) A623T probably benign Het
Arhgef2 C T 3: 88,546,766 (GRCm39) T545I probably damaging Het
Atp8a2 T A 14: 60,243,815 (GRCm39) N630I possibly damaging Het
Bcl9 G T 3: 97,113,186 (GRCm39) Q1090K probably damaging Het
Bdp1 A G 13: 100,171,653 (GRCm39) S2152P probably benign Het
Camk2b T C 11: 5,922,384 (GRCm39) E488G probably damaging Het
Capn9 T A 8: 125,332,304 (GRCm39) probably null Het
Cd209f A G 8: 4,154,491 (GRCm39) S119P probably damaging Het
Cep78 T C 19: 15,946,533 (GRCm39) E433G probably damaging Het
Chid1 G T 7: 141,106,409 (GRCm39) probably null Het
Cldnd2 T C 7: 43,092,349 (GRCm39) S129P possibly damaging Het
Cobll1 A T 2: 64,956,580 (GRCm39) F289Y probably damaging Het
Creb1 C T 1: 64,590,109 (GRCm39) Q32* probably null Het
Creb3l4 G T 3: 90,146,210 (GRCm39) S182Y probably benign Het
Dgcr2 A T 16: 17,667,584 (GRCm39) C292S probably damaging Het
Dnah8 T C 17: 31,093,901 (GRCm39) V4665A possibly damaging Het
Dnah9 A T 11: 66,009,667 (GRCm39) M740K probably benign Het
Dnmt1 G A 9: 20,829,542 (GRCm39) T687I probably damaging Het
Ece1 C T 4: 137,685,312 (GRCm39) R601W probably damaging Het
Echdc2 C A 4: 108,022,732 (GRCm39) R3S probably damaging Het
Ep400 A T 5: 110,852,920 (GRCm39) L1275Q unknown Het
Epha6 A T 16: 60,026,108 (GRCm39) W445R probably damaging Het
Ercc5 T A 1: 44,220,035 (GRCm39) S1102R probably benign Het
Fam228a T G 12: 4,765,620 (GRCm39) T264P probably damaging Het
Fzd6 T A 15: 38,897,315 (GRCm39) I488N probably damaging Het
Gabrg3 T G 7: 56,379,389 (GRCm39) N338H probably damaging Het
Gde1 A G 7: 118,294,357 (GRCm39) F39L possibly damaging Het
Gjb3 G A 4: 127,220,224 (GRCm39) R103W probably damaging Het
Gm4781 T A 10: 100,232,582 (GRCm39) noncoding transcript Het
Gm4846 T A 1: 166,311,492 (GRCm39) T456S probably benign Het
Gpx5 A G 13: 21,471,624 (GRCm39) I193T probably benign Het
H3c2 T A 13: 23,936,715 (GRCm39) V118D probably damaging Het
Herc2 A T 7: 55,804,853 (GRCm39) K2294* probably null Het
Iqgap3 T A 3: 88,015,675 (GRCm39) V19D probably damaging Het
Itga5 T C 15: 103,254,441 (GRCm39) I1006V probably damaging Het
Lamb1 C T 12: 31,351,093 (GRCm39) T781I probably benign Het
Lias A G 5: 65,549,686 (GRCm39) T57A probably benign Het
Lin37 C A 7: 30,256,368 (GRCm39) R108L probably damaging Het
Lrrd1 A T 5: 3,915,709 (GRCm39) T769S probably benign Het
Mamstr T C 7: 45,294,387 (GRCm39) W414R probably damaging Het
Mtmr11 T G 3: 96,072,103 (GRCm39) S233R probably damaging Het
Myh1 A T 11: 67,095,648 (GRCm39) I266F probably damaging Het
Myt1 C A 2: 181,439,068 (GRCm39) Q197K probably benign Het
Naip5 G T 13: 100,356,195 (GRCm39) T1140K probably benign Het
Ncf2 G A 1: 152,683,822 (GRCm39) V14M probably damaging Het
Ndufb11b T C 15: 81,865,068 (GRCm39) V103A probably damaging Het
Nhsl1 G T 10: 18,400,653 (GRCm39) R626S possibly damaging Het
Nol12 T A 15: 78,822,089 (GRCm39) V108E probably damaging Het
Nr1i2 G T 16: 38,069,644 (GRCm39) P420Q probably damaging Het
Nup155 A G 15: 8,184,464 (GRCm39) I1286M possibly damaging Het
Ocrl T A X: 47,050,993 (GRCm39) I74N probably damaging Het
Or4c10b A C 2: 89,711,629 (GRCm39) H153P probably damaging Het
Or51b17 A G 7: 103,542,592 (GRCm39) S117P probably damaging Het
Or5ak23 A G 2: 85,244,749 (GRCm39) V158A probably benign Het
Pard3b C T 1: 62,676,763 (GRCm39) S999L probably benign Het
Pax9 A G 12: 56,746,839 (GRCm39) E225G probably benign Het
Pdcd4 T G 19: 53,914,650 (GRCm39) L335R probably damaging Het
Pdgfra T A 5: 75,343,675 (GRCm39) M732K possibly damaging Het
Pkhd1 G T 1: 20,187,293 (GRCm39) Q3672K probably benign Het
Pold2 A G 11: 5,823,454 (GRCm39) L325P possibly damaging Het
Pom121l2 A T 13: 22,167,954 (GRCm39) T742S probably benign Het
Ppfia1 C T 7: 144,073,368 (GRCm39) E208K probably benign Het
Prex2 A T 1: 11,207,004 (GRCm39) R521W probably damaging Het
Prr23a4 C A 9: 98,785,535 (GRCm39) R67S probably benign Het
Rhpn2 T C 7: 35,071,813 (GRCm39) L226P probably benign Het
Rps12 C A 10: 23,661,527 (GRCm39) D95Y probably damaging Het
Sardh T A 2: 27,105,194 (GRCm39) D643V possibly damaging Het
Sars1 T C 3: 108,343,260 (GRCm39) D77G probably benign Het
Scin C A 12: 40,174,697 (GRCm39) V129F probably damaging Het
Semp2l1 T G 1: 32,584,758 (GRCm39) D384A probably damaging Het
Sftpa1 T A 14: 40,854,803 (GRCm39) M66K possibly damaging Het
Sgo1 T C 17: 53,994,799 (GRCm39) K28E probably damaging Het
Sim2 G T 16: 93,924,436 (GRCm39) probably null Het
Srp54b T A 12: 55,296,945 (GRCm39) probably null Het
Stard7 T C 2: 127,137,480 (GRCm39) V310A probably benign Het
Tasp1 T C 2: 139,793,477 (GRCm39) D233G probably damaging Het
Tdrd6 G T 17: 43,936,480 (GRCm39) L1523M probably benign Het
Tle3 A G 9: 61,321,305 (GRCm39) D639G probably damaging Het
Tmem128 A G 5: 38,417,750 (GRCm39) D2G probably damaging Het
Tmem163 A G 1: 127,605,246 (GRCm39) S41P probably benign Het
Ttn C T 2: 76,559,505 (GRCm39) S29632N probably damaging Het
Tuba4a A G 1: 75,192,754 (GRCm39) S287P probably benign Het
Ubn1 G C 16: 4,895,255 (GRCm39) G767A probably benign Het
Ugdh A T 5: 65,577,634 (GRCm39) C288* probably null Het
Upf2 T A 2: 6,055,135 (GRCm39) probably null Het
Vmn1r2 T C 4: 3,172,836 (GRCm39) S252P probably damaging Het
Vmn1r28 A C 6: 58,242,237 (GRCm39) T27P probably damaging Het
Vmn1r77 T C 7: 11,775,338 (GRCm39) I38T probably benign Het
Vmn2r51 C A 7: 9,832,090 (GRCm39) E499* probably null Het
Vmn2r51 G T 7: 9,832,091 (GRCm39) Y498* probably null Het
Vmn2r53 A T 7: 12,334,812 (GRCm39) W283R probably damaging Het
Vpreb1a T A 16: 16,686,933 (GRCm39) T15S probably benign Het
Vps13b T C 15: 35,910,378 (GRCm39) S3381P probably damaging Het
Wnt2 A T 6: 18,023,234 (GRCm39) D138E probably damaging Het
Zdhhc22 A G 12: 87,030,204 (GRCm39) V248A probably benign Het
Zfp30 T A 7: 29,492,805 (GRCm39) I434N probably damaging Het
Zfp316 A G 5: 143,239,178 (GRCm39) L947P probably damaging Het
Other mutations in Birc6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00402:Birc6 APN 17 74,880,558 (GRCm39) splice site probably benign
IGL00542:Birc6 APN 17 74,930,766 (GRCm39) splice site probably null
IGL00659:Birc6 APN 17 74,967,648 (GRCm39) missense probably damaging 1.00
IGL00710:Birc6 APN 17 74,916,084 (GRCm39) missense probably benign 0.37
IGL00806:Birc6 APN 17 74,918,524 (GRCm39) missense possibly damaging 0.85
IGL00848:Birc6 APN 17 75,003,388 (GRCm39) nonsense probably null
IGL01071:Birc6 APN 17 74,873,127 (GRCm39) missense possibly damaging 0.84
IGL01071:Birc6 APN 17 74,938,696 (GRCm39) missense probably damaging 1.00
IGL01121:Birc6 APN 17 74,938,033 (GRCm39) missense probably benign 0.08
IGL01132:Birc6 APN 17 74,910,055 (GRCm39) missense probably damaging 1.00
IGL01323:Birc6 APN 17 74,929,920 (GRCm39) missense probably damaging 1.00
IGL01444:Birc6 APN 17 74,938,682 (GRCm39) missense probably damaging 1.00
IGL01511:Birc6 APN 17 74,933,998 (GRCm39) nonsense probably null
IGL01576:Birc6 APN 17 74,984,365 (GRCm39) missense possibly damaging 0.80
IGL01578:Birc6 APN 17 74,955,192 (GRCm39) missense probably benign 0.08
IGL01649:Birc6 APN 17 74,911,541 (GRCm39) missense probably benign 0.03
IGL01657:Birc6 APN 17 74,967,606 (GRCm39) missense probably damaging 1.00
IGL01739:Birc6 APN 17 74,966,216 (GRCm39) missense probably benign
IGL01756:Birc6 APN 17 74,947,203 (GRCm39) missense probably benign 0.00
IGL01807:Birc6 APN 17 74,938,032 (GRCm39) missense probably benign
IGL01885:Birc6 APN 17 74,911,511 (GRCm39) missense possibly damaging 0.51
IGL01906:Birc6 APN 17 74,945,353 (GRCm39) missense probably damaging 1.00
IGL01915:Birc6 APN 17 74,938,715 (GRCm39) missense probably benign 0.34
IGL01998:Birc6 APN 17 74,886,880 (GRCm39) missense probably benign 0.06
IGL02084:Birc6 APN 17 74,915,277 (GRCm39) missense probably benign 0.45
IGL02086:Birc6 APN 17 74,946,822 (GRCm39) missense probably damaging 1.00
IGL02161:Birc6 APN 17 74,855,832 (GRCm39) missense probably damaging 0.99
IGL02195:Birc6 APN 17 75,004,376 (GRCm39) splice site probably benign
IGL02283:Birc6 APN 17 74,906,935 (GRCm39) missense probably benign
IGL02476:Birc6 APN 17 75,003,386 (GRCm39) missense possibly damaging 0.81
IGL02493:Birc6 APN 17 74,959,054 (GRCm39) unclassified probably benign
IGL02547:Birc6 APN 17 74,886,640 (GRCm39) missense probably benign 0.21
IGL02678:Birc6 APN 17 74,956,898 (GRCm39) missense probably damaging 1.00
IGL02713:Birc6 APN 17 74,886,319 (GRCm39) missense probably benign
IGL02851:Birc6 APN 17 74,916,184 (GRCm39) missense probably damaging 1.00
IGL02875:Birc6 APN 17 74,896,713 (GRCm39) missense probably damaging 1.00
IGL02985:Birc6 APN 17 74,947,185 (GRCm39) missense probably benign 0.00
IGL03004:Birc6 APN 17 74,919,180 (GRCm39) missense probably benign 0.10
IGL03053:Birc6 APN 17 74,872,967 (GRCm39) missense probably damaging 1.00
IGL03085:Birc6 APN 17 74,903,945 (GRCm39) missense probably damaging 0.97
IGL03109:Birc6 APN 17 74,886,329 (GRCm39) missense possibly damaging 0.71
IGL03143:Birc6 APN 17 74,905,994 (GRCm39) missense possibly damaging 0.89
IGL03180:Birc6 APN 17 74,966,226 (GRCm39) missense probably benign
IGL03221:Birc6 APN 17 74,934,002 (GRCm39) missense probably benign 0.00
IGL03230:Birc6 APN 17 74,918,065 (GRCm39) missense probably damaging 1.00
IGL03294:Birc6 APN 17 74,956,881 (GRCm39) missense probably benign 0.02
IGL03399:Birc6 APN 17 74,901,368 (GRCm39) missense probably benign 0.01
Badlands UTSW 17 74,910,031 (GRCm39) missense probably damaging 1.00
Big_sky UTSW 17 74,835,533 (GRCm39) missense probably null 0.33
bitterroot UTSW 17 74,956,691 (GRCm39) missense probably damaging 1.00
Black_hills UTSW 17 74,999,327 (GRCm39) missense probably damaging 1.00
bottomlands UTSW 17 74,916,654 (GRCm39) missense probably damaging 1.00
Chai UTSW 17 74,977,369 (GRCm39) missense probably damaging 1.00
Dakota UTSW 17 74,932,099 (GRCm39) critical splice acceptor site probably null
Sempervirens UTSW 17 74,949,499 (GRCm39) missense probably damaging 1.00
E0370:Birc6 UTSW 17 74,984,352 (GRCm39) missense probably damaging 1.00
G1citation:Birc6 UTSW 17 74,905,039 (GRCm39) missense probably damaging 1.00
G1citation:Birc6 UTSW 17 74,887,377 (GRCm39) missense possibly damaging 0.82
PIT4494001:Birc6 UTSW 17 74,933,975 (GRCm39) missense probably damaging 1.00
R0081:Birc6 UTSW 17 74,950,436 (GRCm39) missense probably benign 0.01
R0086:Birc6 UTSW 17 74,900,161 (GRCm39) missense possibly damaging 0.54
R0089:Birc6 UTSW 17 74,945,371 (GRCm39) missense possibly damaging 0.90
R0116:Birc6 UTSW 17 74,930,741 (GRCm39) splice site probably benign
R0129:Birc6 UTSW 17 74,835,755 (GRCm39) missense probably benign 0.05
R0196:Birc6 UTSW 17 74,887,282 (GRCm39) missense possibly damaging 0.57
R0201:Birc6 UTSW 17 74,916,322 (GRCm39) missense possibly damaging 0.92
R0207:Birc6 UTSW 17 74,969,827 (GRCm39) splice site probably benign
R0295:Birc6 UTSW 17 74,920,357 (GRCm39) intron probably benign
R0386:Birc6 UTSW 17 74,906,335 (GRCm39) missense probably damaging 0.99
R0423:Birc6 UTSW 17 75,003,292 (GRCm39) missense probably damaging 1.00
R0449:Birc6 UTSW 17 74,999,290 (GRCm39) missense probably damaging 1.00
R0453:Birc6 UTSW 17 74,956,749 (GRCm39) missense probably damaging 1.00
R0457:Birc6 UTSW 17 74,969,620 (GRCm39) missense probably damaging 1.00
R0457:Birc6 UTSW 17 74,959,023 (GRCm39) missense probably benign
R0564:Birc6 UTSW 17 74,932,238 (GRCm39) splice site probably benign
R0575:Birc6 UTSW 17 74,996,232 (GRCm39) missense probably damaging 1.00
R0582:Birc6 UTSW 17 74,950,332 (GRCm39) missense probably damaging 1.00
R0624:Birc6 UTSW 17 74,887,344 (GRCm39) missense probably benign 0.20
R0973:Birc6 UTSW 17 74,872,856 (GRCm39) missense probably damaging 0.99
R1061:Birc6 UTSW 17 74,996,307 (GRCm39) missense probably damaging 1.00
R1378:Birc6 UTSW 17 74,967,450 (GRCm39) missense probably damaging 1.00
R1402:Birc6 UTSW 17 75,004,528 (GRCm39) splice site probably benign
R1436:Birc6 UTSW 17 74,959,700 (GRCm39) missense probably damaging 1.00
R1456:Birc6 UTSW 17 74,916,285 (GRCm39) missense probably benign 0.35
R1465:Birc6 UTSW 17 74,930,853 (GRCm39) missense probably benign 0.03
R1465:Birc6 UTSW 17 74,930,853 (GRCm39) missense probably benign 0.03
R1474:Birc6 UTSW 17 74,886,673 (GRCm39) missense probably damaging 0.98
R1479:Birc6 UTSW 17 74,941,848 (GRCm39) missense probably damaging 1.00
R1486:Birc6 UTSW 17 74,946,815 (GRCm39) missense probably damaging 1.00
R1499:Birc6 UTSW 17 74,919,314 (GRCm39) missense probably damaging 1.00
R1515:Birc6 UTSW 17 74,835,631 (GRCm39) nonsense probably null
R1549:Birc6 UTSW 17 74,969,737 (GRCm39) missense probably damaging 1.00
R1559:Birc6 UTSW 17 74,999,232 (GRCm39) missense probably damaging 1.00
R1573:Birc6 UTSW 17 74,967,685 (GRCm39) splice site probably benign
R1615:Birc6 UTSW 17 74,916,404 (GRCm39) splice site probably null
R1621:Birc6 UTSW 17 74,977,245 (GRCm39) missense probably benign
R1680:Birc6 UTSW 17 74,855,741 (GRCm39) missense probably benign 0.01
R1743:Birc6 UTSW 17 74,886,751 (GRCm39) missense possibly damaging 0.95
R1774:Birc6 UTSW 17 74,947,008 (GRCm39) missense probably damaging 1.00
R1775:Birc6 UTSW 17 74,919,281 (GRCm39) missense probably damaging 1.00
R1818:Birc6 UTSW 17 74,956,844 (GRCm39) missense probably damaging 1.00
R1931:Birc6 UTSW 17 74,872,977 (GRCm39) missense probably damaging 0.99
R1939:Birc6 UTSW 17 74,977,332 (GRCm39) missense probably damaging 1.00
R1964:Birc6 UTSW 17 74,941,880 (GRCm39) missense possibly damaging 0.94
R1994:Birc6 UTSW 17 74,905,057 (GRCm39) missense probably benign 0.01
R2000:Birc6 UTSW 17 74,911,614 (GRCm39) missense possibly damaging 0.46
R2042:Birc6 UTSW 17 74,916,654 (GRCm39) missense probably damaging 1.00
R2090:Birc6 UTSW 17 74,969,791 (GRCm39) missense probably benign
R2130:Birc6 UTSW 17 74,966,149 (GRCm39) splice site probably benign
R2144:Birc6 UTSW 17 74,967,408 (GRCm39) missense possibly damaging 0.71
R2145:Birc6 UTSW 17 74,967,408 (GRCm39) missense possibly damaging 0.71
R2166:Birc6 UTSW 17 74,942,790 (GRCm39) missense probably benign 0.02
R2180:Birc6 UTSW 17 74,919,146 (GRCm39) missense probably benign 0.03
R2271:Birc6 UTSW 17 74,909,966 (GRCm39) missense probably benign 0.06
R2272:Birc6 UTSW 17 74,909,966 (GRCm39) missense probably benign 0.06
R2416:Birc6 UTSW 17 74,915,214 (GRCm39) missense possibly damaging 0.83
R2420:Birc6 UTSW 17 74,967,609 (GRCm39) missense probably damaging 1.00
R2421:Birc6 UTSW 17 74,967,609 (GRCm39) missense probably damaging 1.00
R2422:Birc6 UTSW 17 74,967,609 (GRCm39) missense probably damaging 1.00
R2513:Birc6 UTSW 17 74,954,724 (GRCm39) missense probably damaging 0.97
R2912:Birc6 UTSW 17 74,999,201 (GRCm39) missense probably damaging 1.00
R3024:Birc6 UTSW 17 74,915,214 (GRCm39) missense possibly damaging 0.83
R3771:Birc6 UTSW 17 74,925,424 (GRCm39) splice site probably benign
R3772:Birc6 UTSW 17 74,925,424 (GRCm39) splice site probably benign
R3829:Birc6 UTSW 17 74,962,173 (GRCm39) missense probably damaging 1.00
R3913:Birc6 UTSW 17 74,880,608 (GRCm39) nonsense probably null
R3915:Birc6 UTSW 17 74,886,603 (GRCm39) missense probably benign 0.12
R3921:Birc6 UTSW 17 74,934,014 (GRCm39) missense probably damaging 0.98
R3928:Birc6 UTSW 17 74,945,404 (GRCm39) missense probably damaging 1.00
R3928:Birc6 UTSW 17 74,918,170 (GRCm39) missense possibly damaging 0.91
R4111:Birc6 UTSW 17 74,873,010 (GRCm39) missense probably damaging 1.00
R4155:Birc6 UTSW 17 74,903,934 (GRCm39) missense probably benign 0.00
R4163:Birc6 UTSW 17 74,933,975 (GRCm39) missense probably damaging 1.00
R4226:Birc6 UTSW 17 74,926,835 (GRCm39) critical splice donor site probably null
R4227:Birc6 UTSW 17 74,926,835 (GRCm39) critical splice donor site probably null
R4358:Birc6 UTSW 17 74,926,663 (GRCm39) splice site probably null
R4524:Birc6 UTSW 17 74,948,772 (GRCm39) missense probably damaging 1.00
R4605:Birc6 UTSW 17 74,946,929 (GRCm39) missense probably damaging 1.00
R4619:Birc6 UTSW 17 74,947,145 (GRCm39) missense probably benign 0.18
R4620:Birc6 UTSW 17 74,947,145 (GRCm39) missense probably benign 0.18
R4762:Birc6 UTSW 17 74,936,484 (GRCm39) missense probably damaging 1.00
R4814:Birc6 UTSW 17 74,956,667 (GRCm39) missense probably damaging 1.00
R4849:Birc6 UTSW 17 74,954,383 (GRCm39) missense probably damaging 0.99
R4869:Birc6 UTSW 17 74,893,007 (GRCm39) missense probably benign 0.05
R4912:Birc6 UTSW 17 74,872,900 (GRCm39) missense probably damaging 1.00
R4921:Birc6 UTSW 17 74,957,094 (GRCm39) missense probably damaging 1.00
R4942:Birc6 UTSW 17 74,930,045 (GRCm39) missense probably damaging 1.00
R4954:Birc6 UTSW 17 74,919,026 (GRCm39) missense probably damaging 1.00
R4992:Birc6 UTSW 17 74,996,251 (GRCm39) missense probably benign 0.44
R4994:Birc6 UTSW 17 74,901,319 (GRCm39) intron probably benign
R5018:Birc6 UTSW 17 74,947,054 (GRCm39) missense probably damaging 1.00
R5022:Birc6 UTSW 17 74,999,327 (GRCm39) missense probably damaging 1.00
R5054:Birc6 UTSW 17 74,962,320 (GRCm39) missense probably damaging 1.00
R5068:Birc6 UTSW 17 74,872,967 (GRCm39) missense probably damaging 1.00
R5069:Birc6 UTSW 17 74,872,967 (GRCm39) missense probably damaging 1.00
R5070:Birc6 UTSW 17 74,872,967 (GRCm39) missense probably damaging 1.00
R5196:Birc6 UTSW 17 74,913,136 (GRCm39) splice site probably benign
R5209:Birc6 UTSW 17 74,977,369 (GRCm39) missense probably damaging 1.00
R5212:Birc6 UTSW 17 74,977,369 (GRCm39) missense probably damaging 1.00
R5216:Birc6 UTSW 17 74,920,465 (GRCm39) missense probably damaging 1.00
R5279:Birc6 UTSW 17 74,957,042 (GRCm39) missense probably damaging 0.98
R5286:Birc6 UTSW 17 74,977,242 (GRCm39) missense probably damaging 1.00
R5399:Birc6 UTSW 17 74,911,573 (GRCm39) missense possibly damaging 0.75
R5482:Birc6 UTSW 17 74,969,685 (GRCm39) missense probably damaging 1.00
R5482:Birc6 UTSW 17 74,948,777 (GRCm39) missense possibly damaging 0.86
R5492:Birc6 UTSW 17 74,977,369 (GRCm39) missense probably damaging 1.00
R5504:Birc6 UTSW 17 74,962,208 (GRCm39) missense probably damaging 1.00
R5519:Birc6 UTSW 17 74,887,173 (GRCm39) missense probably benign
R5544:Birc6 UTSW 17 74,977,369 (GRCm39) missense probably damaging 1.00
R5608:Birc6 UTSW 17 74,920,539 (GRCm39) missense probably damaging 0.99
R5623:Birc6 UTSW 17 74,835,651 (GRCm39) missense probably damaging 0.99
R5701:Birc6 UTSW 17 75,004,420 (GRCm39) missense possibly damaging 0.59
R5707:Birc6 UTSW 17 75,003,399 (GRCm39) missense probably damaging 1.00
R5715:Birc6 UTSW 17 74,938,615 (GRCm39) missense probably damaging 1.00
R5734:Birc6 UTSW 17 74,925,419 (GRCm39) splice site probably benign
R5792:Birc6 UTSW 17 74,938,048 (GRCm39) missense probably benign 0.05
R5809:Birc6 UTSW 17 74,977,369 (GRCm39) missense probably damaging 1.00
R5810:Birc6 UTSW 17 74,977,369 (GRCm39) missense probably damaging 1.00
R5813:Birc6 UTSW 17 74,953,497 (GRCm39) missense probably damaging 1.00
R5933:Birc6 UTSW 17 74,906,232 (GRCm39) missense probably damaging 1.00
R5933:Birc6 UTSW 17 74,906,233 (GRCm39) missense probably damaging 0.98
R5960:Birc6 UTSW 17 74,835,760 (GRCm39) missense probably damaging 0.97
R5961:Birc6 UTSW 17 74,953,596 (GRCm39) missense probably damaging 1.00
R5967:Birc6 UTSW 17 74,967,434 (GRCm39) missense probably damaging 0.99
R5970:Birc6 UTSW 17 74,925,497 (GRCm39) missense possibly damaging 0.95
R5977:Birc6 UTSW 17 74,910,031 (GRCm39) missense probably damaging 1.00
R5982:Birc6 UTSW 17 74,955,153 (GRCm39) missense probably benign
R6023:Birc6 UTSW 17 74,961,372 (GRCm39) missense probably benign 0.24
R6034:Birc6 UTSW 17 74,922,278 (GRCm39) missense probably damaging 1.00
R6034:Birc6 UTSW 17 74,922,278 (GRCm39) missense probably damaging 1.00
R6243:Birc6 UTSW 17 74,916,382 (GRCm39) missense probably damaging 0.96
R6294:Birc6 UTSW 17 74,996,252 (GRCm39) missense probably benign 0.00
R6327:Birc6 UTSW 17 74,969,774 (GRCm39) missense probably damaging 1.00
R6501:Birc6 UTSW 17 74,886,276 (GRCm39) missense probably damaging 1.00
R6810:Birc6 UTSW 17 74,919,215 (GRCm39) missense possibly damaging 0.63
R6822:Birc6 UTSW 17 74,905,039 (GRCm39) missense probably damaging 1.00
R6822:Birc6 UTSW 17 74,887,377 (GRCm39) missense possibly damaging 0.82
R6835:Birc6 UTSW 17 74,949,499 (GRCm39) missense probably damaging 1.00
R6945:Birc6 UTSW 17 74,886,526 (GRCm39) missense probably benign 0.04
R6957:Birc6 UTSW 17 74,886,486 (GRCm39) missense probably benign
R6989:Birc6 UTSW 17 74,937,984 (GRCm39) missense probably benign 0.18
R6991:Birc6 UTSW 17 74,869,090 (GRCm39) missense probably damaging 1.00
R7019:Birc6 UTSW 17 74,916,340 (GRCm39) missense probably benign 0.01
R7092:Birc6 UTSW 17 74,953,740 (GRCm39) missense probably damaging 1.00
R7158:Birc6 UTSW 17 74,901,371 (GRCm39) missense probably benign 0.25
R7204:Birc6 UTSW 17 74,947,103 (GRCm39) missense probably damaging 1.00
R7267:Birc6 UTSW 17 74,892,980 (GRCm39) missense probably benign 0.00
R7316:Birc6 UTSW 17 74,911,489 (GRCm39) missense probably damaging 0.99
R7341:Birc6 UTSW 17 74,919,069 (GRCm39) missense probably damaging 1.00
R7404:Birc6 UTSW 17 74,946,789 (GRCm39) missense possibly damaging 0.73
R7449:Birc6 UTSW 17 75,009,336 (GRCm39) missense probably benign
R7498:Birc6 UTSW 17 74,967,465 (GRCm39) missense probably damaging 1.00
R7539:Birc6 UTSW 17 74,956,691 (GRCm39) missense probably damaging 1.00
R7569:Birc6 UTSW 17 74,905,077 (GRCm39) missense possibly damaging 0.71
R7574:Birc6 UTSW 17 74,886,879 (GRCm39) missense probably benign
R7611:Birc6 UTSW 17 74,969,713 (GRCm39) missense probably damaging 0.98
R7653:Birc6 UTSW 17 74,954,729 (GRCm39) missense possibly damaging 0.91
R7716:Birc6 UTSW 17 74,869,056 (GRCm39) missense probably damaging 0.99
R7728:Birc6 UTSW 17 74,929,100 (GRCm39) missense probably benign 0.01
R7810:Birc6 UTSW 17 74,855,815 (GRCm39) missense probably damaging 0.98
R7828:Birc6 UTSW 17 74,886,501 (GRCm39) missense probably damaging 0.97
R7881:Birc6 UTSW 17 74,948,666 (GRCm39) missense probably damaging 0.99
R7896:Birc6 UTSW 17 74,929,077 (GRCm39) missense probably damaging 0.99
R7950:Birc6 UTSW 17 74,900,095 (GRCm39) missense probably damaging 1.00
R7988:Birc6 UTSW 17 74,906,368 (GRCm39) splice site probably null
R8073:Birc6 UTSW 17 74,910,080 (GRCm39) missense probably damaging 1.00
R8128:Birc6 UTSW 17 74,916,253 (GRCm39) missense probably damaging 1.00
R8167:Birc6 UTSW 17 74,950,389 (GRCm39) missense probably damaging 1.00
R8236:Birc6 UTSW 17 74,918,126 (GRCm39) missense probably damaging 1.00
R8237:Birc6 UTSW 17 74,918,126 (GRCm39) missense probably damaging 1.00
R8255:Birc6 UTSW 17 74,969,775 (GRCm39) missense probably damaging 0.99
R8259:Birc6 UTSW 17 74,905,073 (GRCm39) missense probably benign 0.01
R8297:Birc6 UTSW 17 74,932,099 (GRCm39) critical splice acceptor site probably null
R8376:Birc6 UTSW 17 74,896,635 (GRCm39) missense probably benign 0.18
R8413:Birc6 UTSW 17 74,853,388 (GRCm39) missense possibly damaging 0.54
R8503:Birc6 UTSW 17 74,999,239 (GRCm39) missense probably damaging 1.00
R8504:Birc6 UTSW 17 74,959,000 (GRCm39) missense probably damaging 0.98
R8543:Birc6 UTSW 17 74,872,860 (GRCm39) missense probably damaging 1.00
R8550:Birc6 UTSW 17 74,864,949 (GRCm39) missense probably benign 0.37
R8551:Birc6 UTSW 17 74,864,949 (GRCm39) missense probably benign 0.37
R8556:Birc6 UTSW 17 74,864,949 (GRCm39) missense probably benign 0.37
R8683:Birc6 UTSW 17 74,916,114 (GRCm39) missense possibly damaging 0.74
R8751:Birc6 UTSW 17 74,955,135 (GRCm39) missense probably damaging 0.98
R8803:Birc6 UTSW 17 74,959,033 (GRCm39) missense probably damaging 0.99
R8806:Birc6 UTSW 17 74,949,311 (GRCm39) missense probably damaging 1.00
R8825:Birc6 UTSW 17 74,920,500 (GRCm39) missense probably damaging 0.99
R8888:Birc6 UTSW 17 74,835,533 (GRCm39) missense probably null 0.33
R8972:Birc6 UTSW 17 75,009,313 (GRCm39) missense probably benign 0.05
R9069:Birc6 UTSW 17 74,868,260 (GRCm39) splice site probably benign
R9111:Birc6 UTSW 17 74,966,340 (GRCm39) missense probably damaging 0.99
R9130:Birc6 UTSW 17 74,919,146 (GRCm39) missense
R9352:Birc6 UTSW 17 74,965,347 (GRCm39) critical splice donor site probably null
R9354:Birc6 UTSW 17 74,921,401 (GRCm39) missense probably benign
R9432:Birc6 UTSW 17 74,966,216 (GRCm39) missense probably benign
R9446:Birc6 UTSW 17 74,925,491 (GRCm39) missense probably damaging 1.00
R9485:Birc6 UTSW 17 74,945,398 (GRCm39) missense probably damaging 1.00
R9499:Birc6 UTSW 17 74,916,064 (GRCm39) missense probably benign 0.05
R9551:Birc6 UTSW 17 74,916,064 (GRCm39) missense probably benign 0.05
R9552:Birc6 UTSW 17 74,916,064 (GRCm39) missense probably benign 0.05
R9585:Birc6 UTSW 17 74,916,265 (GRCm39) missense probably damaging 1.00
R9647:Birc6 UTSW 17 74,999,305 (GRCm39) missense probably damaging 1.00
R9648:Birc6 UTSW 17 74,938,696 (GRCm39) missense probably damaging 1.00
R9667:Birc6 UTSW 17 75,004,420 (GRCm39) missense possibly damaging 0.59
R9696:Birc6 UTSW 17 74,947,292 (GRCm39) missense probably damaging 0.99
RF016:Birc6 UTSW 17 74,996,319 (GRCm39) missense probably damaging 1.00
Z1088:Birc6 UTSW 17 74,918,537 (GRCm39) missense probably damaging 0.99
Z1177:Birc6 UTSW 17 74,954,275 (GRCm39) missense probably benign 0.10
Predicted Primers PCR Primer
(F):5'- CAGGCAAACATGCTTTATAACAGTTCC -3'
(R):5'- GCTCAAATGAAACCTATCACTGG -3'

Sequencing Primer
(F):5'- ACATGCTTTATAACAGTTCCTATGTG -3'
(R):5'- GCAGCCTGGTCTACATAATGAGC -3'
Posted On 2014-06-23