Incidental Mutation 'R1837:Alg9'
ID205405
Institutional Source Beutler Lab
Gene Symbol Alg9
Ensembl Gene ENSMUSG00000032059
Gene Nameasparagine-linked glycosylation 9 (alpha 1,2 mannosyltransferase)
SynonymsB430313H07Rik, 8230402H15Rik, Dibd1
MMRRC Submission 039864-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R1837 (G1)
Quality Score225
Status Validated
Chromosome9
Chromosomal Location50775019-50843542 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 50806315 bp
ZygosityHeterozygous
Amino Acid Change Valine to Aspartic acid at position 83 (V83D)
Ref Sequence ENSEMBL: ENSMUSP00000134818 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034561] [ENSMUST00000162073] [ENSMUST00000177320]
Predicted Effect probably damaging
Transcript: ENSMUST00000034561
AA Change: V466D

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000034561
Gene: ENSMUSG00000032059
AA Change: V466D

DomainStartEndE-ValueType
Pfam:Glyco_transf_22 60 482 3.5e-127 PFAM
low complexity region 598 611 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000162073
SMART Domains Protein: ENSMUSP00000125425
Gene: ENSMUSG00000032059

DomainStartEndE-ValueType
Pfam:Glyco_transf_22 60 167 7.5e-31 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000175728
Predicted Effect probably damaging
Transcript: ENSMUST00000177320
AA Change: V83D

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000134818
Gene: ENSMUSG00000032059
AA Change: V83D

DomainStartEndE-ValueType
Pfam:Glyco_transf_22 2 99 4.3e-15 PFAM
Meta Mutation Damage Score 0.9735 question?
Coding Region Coverage
  • 1x: 97.4%
  • 3x: 96.8%
  • 10x: 94.9%
  • 20x: 91.6%
Validation Efficiency 99% (86/87)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an alpha-1,2-mannosyltransferase enzyme that functions in lipid-linked oligosaccharide assembly. Mutations in this gene result in congenital disorder of glycosylation type Il. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Dec 2008]
Allele List at MGI
Other mutations in this stock
Total: 85 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Actl10 G T 2: 154,553,042 G305W probably damaging Het
Actr3b A T 5: 25,825,159 T74S probably benign Het
Add2 A G 6: 86,118,558 E652G probably damaging Het
Atp13a2 T A 4: 140,994,332 Y244* probably null Het
BB014433 C G 8: 15,042,629 V75L unknown Het
Bcr A G 10: 75,168,100 probably benign Het
Begain G A 12: 109,035,323 probably benign Het
Bzw1 A G 1: 58,400,118 K67E probably damaging Het
Ccdc141 T C 2: 77,011,665 E1474G probably benign Het
Cdc73 T A 1: 143,667,657 T314S possibly damaging Het
Cfap206 T C 4: 34,728,813 T31A probably damaging Het
Cfap58 G A 19: 48,029,139 E813K probably damaging Het
Clstn2 C A 9: 97,583,540 A133S probably benign Het
Col14a1 A T 15: 55,382,495 D465V unknown Het
Col2a1 C T 15: 97,996,641 probably benign Het
Dab2 A G 15: 6,336,476 probably benign Het
Eme1 T C 11: 94,645,961 D464G probably benign Het
Eml6 T C 11: 29,749,802 probably null Het
Ern1 C A 11: 106,458,957 L44F probably damaging Het
Fam111a T A 19: 12,587,452 S188R probably benign Het
Fam151b A T 13: 92,474,131 probably benign Het
Fmo6 T C 1: 162,922,810 N226D probably benign Het
Ggt1 A G 10: 75,579,294 D214G probably benign Het
Gm14226 A G 2: 155,025,010 I296V probably benign Het
Gm9915 A T 1: 42,230,687 noncoding transcript Het
Heatr5b T C 17: 78,820,751 D485G possibly damaging Het
Helz2 A T 2: 181,229,289 I2785N probably damaging Het
Htt C T 5: 34,819,023 T723M probably benign Het
Hydin C A 8: 110,569,625 H3595Q probably benign Het
Il6ra T C 3: 89,890,272 D96G probably benign Het
Kif5a G A 10: 127,236,815 Q702* probably null Het
Klhdc7a G T 4: 139,967,070 P189T probably benign Het
Krt7 A G 15: 101,419,582 D252G probably benign Het
Lad1 C A 1: 135,829,706 D394E probably benign Het
Lhx8 A T 3: 154,328,055 C38S possibly damaging Het
Lta4h C T 10: 93,469,175 T280M probably damaging Het
Magi2 A T 5: 20,465,827 T163S probably damaging Het
Med1 G T 11: 98,169,412 D230E probably damaging Het
Mmp1b A T 9: 7,386,409 F171I probably damaging Het
Mprip T C 11: 59,766,745 V801A probably damaging Het
Mtrf1 A G 14: 79,401,833 E135G possibly damaging Het
Muc5ac T A 7: 141,807,086 M1378K probably benign Het
Myo3a A T 2: 22,577,592 Q286L possibly damaging Het
Ndor1 C T 2: 25,248,396 G391R probably damaging Het
Nefl C T 14: 68,086,626 R438C probably damaging Het
Nlrp3 G A 11: 59,548,916 V440I probably benign Het
Notch3 A T 17: 32,124,322 L1959Q probably damaging Het
Noto A G 6: 85,424,177 T63A probably benign Het
Oc90 G A 15: 65,889,680 T163M probably damaging Het
Olfr1219 A T 2: 89,074,832 Y86* probably null Het
Olfr1436 A G 19: 12,298,376 V252A probably damaging Het
Olfr365 T A 2: 37,202,102 M287K probably benign Het
Pdpr C A 8: 111,134,734 P787T probably damaging Het
Phlda1 A G 10: 111,507,231 Q276R probably benign Het
Ptpn21 T G 12: 98,733,626 K10Q probably damaging Het
Ptprb A G 10: 116,341,626 E1364G probably benign Het
Rabep1 T A 11: 70,904,658 W237R probably damaging Het
Rai1 A T 11: 60,189,398 K1429N probably damaging Het
Rapgef1 A G 2: 29,737,426 I1027M probably damaging Het
Rit1 C G 3: 88,729,170 T127S probably damaging Het
Rpap1 A C 2: 119,769,885 probably null Het
Senp7 T A 16: 56,158,516 C471S probably benign Het
Slc16a14 A G 1: 84,912,399 V395A probably benign Het
Slc45a1 C T 4: 150,638,459 G323S probably benign Het
Syne2 A T 12: 75,967,660 E3208D probably damaging Het
Tap1 C T 17: 34,188,109 A77V possibly damaging Het
Ticam1 T C 17: 56,270,799 E432G possibly damaging Het
Tmem192 C A 8: 64,964,340 probably benign Het
Trub1 T C 19: 57,453,029 V28A probably benign Het
Ttc21b A T 2: 66,197,762 L1121H probably benign Het
Ttc38 A G 15: 85,851,563 D290G probably damaging Het
Ulk1 C T 5: 110,789,381 G683D probably damaging Het
Vmn1r122 A T 7: 21,133,366 F255I probably benign Het
Vmn2r68 T A 7: 85,233,678 I289F probably damaging Het
Vps39 A T 2: 120,325,397 L514H probably damaging Het
Wdr48 T G 9: 119,905,416 S134A probably damaging Het
Yap1 A T 9: 7,962,349 Y139N probably damaging Het
Ylpm1 T C 12: 85,029,333 V486A possibly damaging Het
Zbtb38 T C 9: 96,686,995 T679A probably benign Het
Zfp292 A G 4: 34,810,264 S927P probably damaging Het
Zfp324 C T 7: 12,970,229 T115I probably benign Het
Zfp523 T A 17: 28,194,993 I34N probably damaging Het
Zfp945 A T 17: 22,851,273 C551S probably damaging Het
Zfp958 A G 8: 4,628,590 H205R probably damaging Het
Zfp974 G A 7: 27,910,356 P648L possibly damaging Het
Other mutations in Alg9
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01634:Alg9 APN 9 50775377 splice site probably null
IGL02792:Alg9 APN 9 50842748 missense possibly damaging 0.90
gum_drop UTSW 9 50805354 missense possibly damaging 0.90
FR4976:Alg9 UTSW 9 50775431 unclassified probably benign
R1183:Alg9 UTSW 9 50789533 missense possibly damaging 0.82
R1270:Alg9 UTSW 9 50787572 intron probably benign
R1575:Alg9 UTSW 9 50775502 missense possibly damaging 0.65
R1773:Alg9 UTSW 9 50779096 missense probably benign 0.30
R2011:Alg9 UTSW 9 50788200 missense probably damaging 1.00
R4324:Alg9 UTSW 9 50805343 missense probably damaging 1.00
R4514:Alg9 UTSW 9 50805354 missense possibly damaging 0.90
R4544:Alg9 UTSW 9 50805354 missense possibly damaging 0.90
R4546:Alg9 UTSW 9 50805354 missense possibly damaging 0.90
R4996:Alg9 UTSW 9 50808705 missense probably damaging 1.00
R5007:Alg9 UTSW 9 50788224 missense probably damaging 1.00
R5053:Alg9 UTSW 9 50788172 missense probably damaging 1.00
R5308:Alg9 UTSW 9 50822711 missense possibly damaging 0.95
R6803:Alg9 UTSW 9 50789560 missense probably benign 0.37
R6994:Alg9 UTSW 9 50792122 nonsense probably null
R6998:Alg9 UTSW 9 50789621 missense possibly damaging 0.95
R7298:Alg9 UTSW 9 50779061 missense probably damaging 0.97
R7480:Alg9 UTSW 9 50822628 missense probably benign 0.06
R7561:Alg9 UTSW 9 50842774 missense possibly damaging 0.95
R7578:Alg9 UTSW 9 50789535 missense probably benign
R7721:Alg9 UTSW 9 50776642 missense probably damaging 0.99
R7829:Alg9 UTSW 9 50788171 missense probably damaging 1.00
R7847:Alg9 UTSW 9 50789605 missense possibly damaging 0.62
R7878:Alg9 UTSW 9 50842783 missense probably benign 0.00
R8113:Alg9 UTSW 9 50808780 nonsense probably null
R8257:Alg9 UTSW 9 50779087 missense possibly damaging 0.62
RF003:Alg9 UTSW 9 50775427 unclassified probably benign
RF006:Alg9 UTSW 9 50775417 unclassified probably benign
RF058:Alg9 UTSW 9 50775427 unclassified probably benign
Z1177:Alg9 UTSW 9 50788173 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGACGCTTCGGATAGGTGAC -3'
(R):5'- TTGTTGACTTCTGGCCTAGC -3'

Sequencing Primer
(F):5'- CTTCGGATAGGTGACAGGGG -3'
(R):5'- TACAGAGCTCCAGGGTCACTC -3'
Posted On2014-06-23