Incidental Mutation 'R1837:Nlrp3'
ID 205419
Institutional Source Beutler Lab
Gene Symbol Nlrp3
Ensembl Gene ENSMUSG00000032691
Gene Name NLR family, pyrin domain containing 3
Synonyms Mmig1, Cias1, NALP3, cryopyrin, Pypaf1
MMRRC Submission 039864-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.076) question?
Stock # R1837 (G1)
Quality Score 225
Status Validated
Chromosome 11
Chromosomal Location 59432395-59457781 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) G to A at 59439742 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Valine to Isoleucine at position 440 (V440I)
Ref Sequence ENSEMBL: ENSMUSP00000098707 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000079476] [ENSMUST00000101148] [ENSMUST00000149126]
AlphaFold Q8R4B8
Predicted Effect probably benign
Transcript: ENSMUST00000079476
AA Change: V440I

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000078440
Gene: ENSMUSG00000032691
AA Change: V440I

DomainStartEndE-ValueType
PYRIN 4 87 6.39e-33 SMART
FISNA 135 206 1.45e-22 SMART
Pfam:NACHT 216 385 6.7e-52 PFAM
low complexity region 533 539 N/A INTRINSIC
low complexity region 688 697 N/A INTRINSIC
LRR_RI 737 764 1.07e-9 SMART
LRR 766 793 5.13e1 SMART
LRR 794 821 3.86e-7 SMART
LRR 823 850 1.62e0 SMART
LRR 851 878 3.39e-3 SMART
LRR 880 907 1.2e2 SMART
LRR 908 935 2.24e-3 SMART
LRR 937 964 2.16e2 SMART
LRR 965 992 8.73e-6 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000101148
AA Change: V440I

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000098707
Gene: ENSMUSG00000032691
AA Change: V440I

DomainStartEndE-ValueType
PYRIN 4 87 6.39e-33 SMART
FISNA 135 206 1.45e-22 SMART
Pfam:NACHT 216 385 6.7e-52 PFAM
low complexity region 533 539 N/A INTRINSIC
low complexity region 688 697 N/A INTRINSIC
LRR_RI 737 764 1.07e-9 SMART
LRR 766 793 5.13e1 SMART
LRR 794 821 3.86e-7 SMART
LRR 823 850 1.62e0 SMART
LRR 851 878 3.39e-3 SMART
LRR 880 907 1.2e2 SMART
LRR 908 935 2.24e-3 SMART
LRR 937 964 2.16e2 SMART
LRR 965 992 8.73e-6 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000149126
SMART Domains Protein: ENSMUSP00000114231
Gene: ENSMUSG00000032691

DomainStartEndE-ValueType
PYRIN 4 87 6.39e-33 SMART
Pfam:FISNA 135 173 1.6e-12 PFAM
Meta Mutation Damage Score 0.1137 question?
Coding Region Coverage
  • 1x: 97.4%
  • 3x: 96.8%
  • 10x: 94.9%
  • 20x: 91.6%
Validation Efficiency 99% (86/87)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a pyrin-like protein containing a pyrin domain, a nucleotide-binding site (NBS) domain, and a leucine-rich repeat (LRR) motif. This protein interacts with the apoptosis-associated speck-like protein PYCARD/ASC, which contains a caspase recruitment domain, and is a member of the NALP3 inflammasome complex. This complex functions as an upstream activator of NF-kappaB signaling, and it plays a role in the regulation of inflammation, the immune response, and apoptosis. Mutations in this gene are associated with familial cold autoinflammatory syndrome (FCAS), Muckle-Wells syndrome (MWS), chronic infantile neurological cutaneous and articular (CINCA) syndrome, and neonatal-onset multisystem inflammatory disease (NOMID). Multiple alternatively spliced transcript variants encoding distinct isoforms have been identified for this gene. Alternative 5' UTR structures are suggested by available data; however, insufficient evidence is available to determine if all of the represented 5' UTR splice patterns are biologically valid. [provided by RefSeq, Oct 2008]
PHENOTYPE: Mice homozygous for null mutations exhibit attenuated inflammatory responses related to decrease secretion of IL-1beta and IL-18. Mice heterozygous for activating mutations suffer from autoinflammatory attacks that lead to organ failure and death before weaning. [provided by MGI curators]
Allele List at MGI

All alleles(13) : Targeted(9) Chemically induced(4)

Other mutations in this stock
Total: 85 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Actl10 G T 2: 154,394,962 (GRCm39) G305W probably damaging Het
Actr3b A T 5: 26,030,157 (GRCm39) T74S probably benign Het
Add2 A G 6: 86,095,540 (GRCm39) E652G probably damaging Het
Alg9 T A 9: 50,717,615 (GRCm39) V83D probably damaging Het
Atp13a2 T A 4: 140,721,643 (GRCm39) Y244* probably null Het
BB014433 C G 8: 15,092,629 (GRCm39) V75L unknown Het
Bcr A G 10: 75,003,932 (GRCm39) probably benign Het
Begain G A 12: 109,001,249 (GRCm39) probably benign Het
Bzw1 A G 1: 58,439,277 (GRCm39) K67E probably damaging Het
Ccdc141 T C 2: 76,842,009 (GRCm39) E1474G probably benign Het
Cdc73 T A 1: 143,543,395 (GRCm39) T314S possibly damaging Het
Cfap206 T C 4: 34,728,813 (GRCm39) T31A probably damaging Het
Cfap58 G A 19: 48,017,578 (GRCm39) E813K probably damaging Het
Clstn2 C A 9: 97,465,593 (GRCm39) A133S probably benign Het
Col14a1 A T 15: 55,245,891 (GRCm39) D465V unknown Het
Col2a1 C T 15: 97,894,522 (GRCm39) probably benign Het
Dab2 A G 15: 6,365,957 (GRCm39) probably benign Het
Eme1 T C 11: 94,536,787 (GRCm39) D464G probably benign Het
Eml6 T C 11: 29,699,802 (GRCm39) probably null Het
Ern1 C A 11: 106,349,783 (GRCm39) L44F probably damaging Het
Fam111a T A 19: 12,564,816 (GRCm39) S188R probably benign Het
Fam151b A T 13: 92,610,639 (GRCm39) probably benign Het
Fmo6 T C 1: 162,750,379 (GRCm39) N226D probably benign Het
Ggt1 A G 10: 75,415,128 (GRCm39) D214G probably benign Het
Gm14226 A G 2: 154,866,930 (GRCm39) I296V probably benign Het
Gm9915 A T 1: 42,269,847 (GRCm39) noncoding transcript Het
Heatr5b T C 17: 79,128,180 (GRCm39) D485G possibly damaging Het
Helz2 A T 2: 180,871,082 (GRCm39) I2785N probably damaging Het
Htt C T 5: 34,976,367 (GRCm39) T723M probably benign Het
Hydin C A 8: 111,296,257 (GRCm39) H3595Q probably benign Het
Il6ra T C 3: 89,797,579 (GRCm39) D96G probably benign Het
Kif5a G A 10: 127,072,684 (GRCm39) Q702* probably null Het
Klhdc7a G T 4: 139,694,381 (GRCm39) P189T probably benign Het
Krt7 A G 15: 101,317,463 (GRCm39) D252G probably benign Het
Lad1 C A 1: 135,757,444 (GRCm39) D394E probably benign Het
Lhx8 A T 3: 154,033,692 (GRCm39) C38S possibly damaging Het
Lta4h C T 10: 93,305,037 (GRCm39) T280M probably damaging Het
Magi2 A T 5: 20,670,825 (GRCm39) T163S probably damaging Het
Med1 G T 11: 98,060,238 (GRCm39) D230E probably damaging Het
Mmp1b A T 9: 7,386,409 (GRCm39) F171I probably damaging Het
Mprip T C 11: 59,657,571 (GRCm39) V801A probably damaging Het
Mtrf1 A G 14: 79,639,273 (GRCm39) E135G possibly damaging Het
Muc5ac T A 7: 141,360,823 (GRCm39) M1378K probably benign Het
Myo3a A T 2: 22,467,604 (GRCm39) Q286L possibly damaging Het
Ndor1 C T 2: 25,138,408 (GRCm39) G391R probably damaging Het
Nefl C T 14: 68,324,075 (GRCm39) R438C probably damaging Het
Notch3 A T 17: 32,343,296 (GRCm39) L1959Q probably damaging Het
Noto A G 6: 85,401,159 (GRCm39) T63A probably benign Het
Oc90 G A 15: 65,761,529 (GRCm39) T163M probably damaging Het
Or1l4 T A 2: 37,092,114 (GRCm39) M287K probably benign Het
Or4c114 A T 2: 88,905,176 (GRCm39) Y86* probably null Het
Or5an10 A G 19: 12,275,740 (GRCm39) V252A probably damaging Het
Pdpr C A 8: 111,861,366 (GRCm39) P787T probably damaging Het
Phlda1 A G 10: 111,343,092 (GRCm39) Q276R probably benign Het
Ptpn21 T G 12: 98,699,885 (GRCm39) K10Q probably damaging Het
Ptprb A G 10: 116,177,531 (GRCm39) E1364G probably benign Het
Rabep1 T A 11: 70,795,484 (GRCm39) W237R probably damaging Het
Rai1 A T 11: 60,080,224 (GRCm39) K1429N probably damaging Het
Rapgef1 A G 2: 29,627,438 (GRCm39) I1027M probably damaging Het
Rit1 C G 3: 88,636,477 (GRCm39) T127S probably damaging Het
Rpap1 A C 2: 119,600,366 (GRCm39) probably null Het
Senp7 T A 16: 55,978,879 (GRCm39) C471S probably benign Het
Slc16a14 A G 1: 84,890,120 (GRCm39) V395A probably benign Het
Slc45a1 C T 4: 150,722,916 (GRCm39) G323S probably benign Het
Syne2 A T 12: 76,014,434 (GRCm39) E3208D probably damaging Het
Tap1 C T 17: 34,407,083 (GRCm39) A77V possibly damaging Het
Ticam1 T C 17: 56,577,799 (GRCm39) E432G possibly damaging Het
Tmem192 C A 8: 65,416,992 (GRCm39) probably benign Het
Trub1 T C 19: 57,441,461 (GRCm39) V28A probably benign Het
Ttc21b A T 2: 66,028,106 (GRCm39) L1121H probably benign Het
Ttc38 A G 15: 85,735,764 (GRCm39) D290G probably damaging Het
Ulk1 C T 5: 110,937,247 (GRCm39) G683D probably damaging Het
Vmn1r122 A T 7: 20,867,291 (GRCm39) F255I probably benign Het
Vmn2r68 T A 7: 84,882,886 (GRCm39) I289F probably damaging Het
Vps39 A T 2: 120,155,878 (GRCm39) L514H probably damaging Het
Wdr48 T G 9: 119,734,482 (GRCm39) S134A probably damaging Het
Yap1 A T 9: 7,962,350 (GRCm39) Y139N probably damaging Het
Ylpm1 T C 12: 85,076,107 (GRCm39) V486A possibly damaging Het
Zbtb38 T C 9: 96,569,048 (GRCm39) T679A probably benign Het
Zfp292 A G 4: 34,810,264 (GRCm39) S927P probably damaging Het
Zfp324 C T 7: 12,704,156 (GRCm39) T115I probably benign Het
Zfp523 T A 17: 28,413,967 (GRCm39) I34N probably damaging Het
Zfp945 A T 17: 23,070,247 (GRCm39) C551S probably damaging Het
Zfp958 A G 8: 4,678,590 (GRCm39) H205R probably damaging Het
Zfp974 G A 7: 27,609,781 (GRCm39) P648L possibly damaging Het
Other mutations in Nlrp3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00421:Nlrp3 APN 11 59,456,769 (GRCm39) missense probably damaging 0.99
IGL00573:Nlrp3 APN 11 59,455,942 (GRCm39) missense possibly damaging 0.93
IGL01025:Nlrp3 APN 11 59,442,713 (GRCm39) missense probably benign 0.21
IGL01637:Nlrp3 APN 11 59,440,204 (GRCm39) missense probably damaging 0.99
IGL02010:Nlrp3 APN 11 59,440,361 (GRCm39) missense probably benign
IGL02334:Nlrp3 APN 11 59,455,909 (GRCm39) missense probably benign
IGL02417:Nlrp3 APN 11 59,456,849 (GRCm39) unclassified probably benign
IGL02578:Nlrp3 APN 11 59,439,227 (GRCm39) missense probably damaging 1.00
IGL02710:Nlrp3 APN 11 59,456,802 (GRCm39) missense probably damaging 0.99
IGL02816:Nlrp3 APN 11 59,446,608 (GRCm39) missense probably benign 0.03
IGL03157:Nlrp3 APN 11 59,440,372 (GRCm39) missense possibly damaging 0.80
IGL03334:Nlrp3 APN 11 59,439,842 (GRCm39) missense probably damaging 1.00
Flogiston UTSW 11 59,449,274 (GRCm39) missense probably benign 0.00
nd1 UTSW 11 59,456,800 (GRCm39) missense probably benign 0.45
Nd14 UTSW 11 59,446,701 (GRCm39) missense possibly damaging 0.89
Nd3 UTSW 11 59,456,800 (GRCm39) missense probably benign 0.45
nd5 UTSW 11 59,456,705 (GRCm39) missense probably benign 0.01
nd6 UTSW 11 59,440,180 (GRCm39) missense probably damaging 1.00
nd7 UTSW 11 59,446,701 (GRCm39) missense possibly damaging 0.89
Nd9 UTSW 11 59,440,180 (GRCm39) missense probably damaging 1.00
Park2 UTSW 11 59,455,954 (GRCm39) nonsense probably null
Park3 UTSW 11 59,456,676 (GRCm39) missense probably benign 0.02
Park4 UTSW 11 59,440,357 (GRCm39) missense probably benign 0.19
Park5 UTSW 11 59,439,302 (GRCm39) missense probably damaging 0.99
Park6 UTSW 11 59,439,862 (GRCm39) missense probably damaging 1.00
Park7 UTSW 11 59,438,836 (GRCm39) nonsense probably null
Park8 UTSW 11 59,457,025 (GRCm39) missense probably benign 0.19
R0008:Nlrp3 UTSW 11 59,449,274 (GRCm39) missense probably benign 0.00
R0008:Nlrp3 UTSW 11 59,449,274 (GRCm39) missense probably benign 0.00
R0052:Nlrp3 UTSW 11 59,455,954 (GRCm39) nonsense probably null
R0362:Nlrp3 UTSW 11 59,439,623 (GRCm39) missense possibly damaging 0.49
R0416:Nlrp3 UTSW 11 59,446,750 (GRCm39) splice site probably benign
R0649:Nlrp3 UTSW 11 59,439,368 (GRCm39) missense possibly damaging 0.83
R0740:Nlrp3 UTSW 11 59,439,082 (GRCm39) missense probably benign 0.01
R0863:Nlrp3 UTSW 11 59,456,676 (GRCm39) missense probably benign 0.02
R1300:Nlrp3 UTSW 11 59,446,594 (GRCm39) missense possibly damaging 0.86
R1414:Nlrp3 UTSW 11 59,440,357 (GRCm39) missense probably benign 0.19
R1622:Nlrp3 UTSW 11 59,439,302 (GRCm39) missense probably damaging 0.99
R1654:Nlrp3 UTSW 11 59,433,949 (GRCm39) missense probably benign 0.03
R1715:Nlrp3 UTSW 11 59,434,177 (GRCm39) missense probably damaging 1.00
R1754:Nlrp3 UTSW 11 59,449,228 (GRCm39) missense possibly damaging 0.80
R1905:Nlrp3 UTSW 11 59,439,862 (GRCm39) missense probably damaging 1.00
R2281:Nlrp3 UTSW 11 59,439,962 (GRCm39) missense possibly damaging 0.70
R4296:Nlrp3 UTSW 11 59,440,487 (GRCm39) missense possibly damaging 0.89
R4305:Nlrp3 UTSW 11 59,438,836 (GRCm39) nonsense probably null
R4540:Nlrp3 UTSW 11 59,442,725 (GRCm39) missense possibly damaging 0.83
R4591:Nlrp3 UTSW 11 59,440,048 (GRCm39) missense probably benign 0.00
R4816:Nlrp3 UTSW 11 59,439,127 (GRCm39) missense probably benign 0.32
R4913:Nlrp3 UTSW 11 59,440,064 (GRCm39) missense probably benign 0.09
R4970:Nlrp3 UTSW 11 59,439,554 (GRCm39) missense probably damaging 1.00
R5051:Nlrp3 UTSW 11 59,457,025 (GRCm39) missense probably benign 0.19
R5112:Nlrp3 UTSW 11 59,439,554 (GRCm39) missense probably damaging 1.00
R5185:Nlrp3 UTSW 11 59,455,910 (GRCm39) missense probably benign 0.05
R5417:Nlrp3 UTSW 11 59,439,889 (GRCm39) missense probably damaging 1.00
R5709:Nlrp3 UTSW 11 59,446,574 (GRCm39) nonsense probably null
R5869:Nlrp3 UTSW 11 59,438,960 (GRCm39) missense probably damaging 1.00
R5898:Nlrp3 UTSW 11 59,437,678 (GRCm39) missense probably benign 0.00
R5953:Nlrp3 UTSW 11 59,437,617 (GRCm39) missense probably benign
R5979:Nlrp3 UTSW 11 59,439,797 (GRCm39) missense probably benign 0.06
R6359:Nlrp3 UTSW 11 59,439,392 (GRCm39) missense probably damaging 0.97
R6723:Nlrp3 UTSW 11 59,456,018 (GRCm39) missense probably damaging 1.00
R7261:Nlrp3 UTSW 11 59,439,272 (GRCm39) missense possibly damaging 0.83
R7349:Nlrp3 UTSW 11 59,438,912 (GRCm39) missense probably damaging 1.00
R7388:Nlrp3 UTSW 11 59,455,892 (GRCm39) missense probably benign 0.00
R7715:Nlrp3 UTSW 11 59,433,829 (GRCm39) splice site probably null
R7916:Nlrp3 UTSW 11 59,442,689 (GRCm39) missense probably benign 0.00
R8222:Nlrp3 UTSW 11 59,439,614 (GRCm39) missense probably damaging 0.98
R8360:Nlrp3 UTSW 11 59,440,229 (GRCm39) missense probably benign 0.02
R8390:Nlrp3 UTSW 11 59,442,616 (GRCm39) missense possibly damaging 0.47
R8550:Nlrp3 UTSW 11 59,440,097 (GRCm39) missense probably damaging 1.00
R8738:Nlrp3 UTSW 11 59,440,216 (GRCm39) missense probably benign 0.00
R8940:Nlrp3 UTSW 11 59,455,870 (GRCm39) missense probably benign 0.26
R8990:Nlrp3 UTSW 11 59,439,584 (GRCm39) missense probably damaging 0.99
R9324:Nlrp3 UTSW 11 59,434,141 (GRCm39) missense probably damaging 1.00
R9673:Nlrp3 UTSW 11 59,440,148 (GRCm39) missense probably damaging 1.00
RF031:Nlrp3 UTSW 11 59,449,378 (GRCm39) frame shift probably null
RF040:Nlrp3 UTSW 11 59,449,378 (GRCm39) frame shift probably null
Z1088:Nlrp3 UTSW 11 59,442,686 (GRCm39) missense possibly damaging 0.67
Predicted Primers PCR Primer
(F):5'- TTTCTCCAACGAGCTGCAGG -3'
(R):5'- GTAGAATCTCTCGCAGTCCAC -3'

Sequencing Primer
(F):5'- TCCAAGAGAATGAGGTCC -3'
(R):5'- TGGAACACGTTCATCCTCAGG -3'
Posted On 2014-06-23