Incidental Mutation 'R0112:Lmo7'
ID20543
Institutional Source Beutler Lab
Gene Symbol Lmo7
Ensembl Gene ENSMUSG00000033060
Gene NameLIM domain only 7
SynonymsFBXO20, LOC380928
MMRRC Submission 038398-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.270) question?
Stock #R0112 (G1)
Quality Score225
Status Validated (trace)
Chromosome14
Chromosomal Location101729957-101934710 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) A to T at 101887193 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Stop codon at position 363 (R363*)
Ref Sequence ENSEMBL: ENSMUSP00000123706 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000100337] [ENSMUST00000159026] [ENSMUST00000159258] [ENSMUST00000159314] [ENSMUST00000159597]
Predicted Effect probably null
Transcript: ENSMUST00000100337
AA Change: R485*
SMART Domains Protein: ENSMUSP00000097910
Gene: ENSMUSG00000033060
AA Change: R485*

DomainStartEndE-ValueType
CH 14 124 2.57e-13 SMART
low complexity region 200 211 N/A INTRINSIC
Pfam:DUF4757 242 348 2.2e-14 PFAM
low complexity region 448 462 N/A INTRINSIC
Pfam:DUF4757 568 735 1.8e-46 PFAM
low complexity region 861 879 N/A INTRINSIC
low complexity region 979 991 N/A INTRINSIC
low complexity region 1003 1015 N/A INTRINSIC
PDZ 1047 1119 1.05e-8 SMART
coiled coil region 1222 1275 N/A INTRINSIC
coiled coil region 1319 1411 N/A INTRINSIC
low complexity region 1585 1596 N/A INTRINSIC
low complexity region 1599 1617 N/A INTRINSIC
LIM 1629 1687 6.54e-10 SMART
Predicted Effect probably null
Transcript: ENSMUST00000159026
AA Change: R252*
SMART Domains Protein: ENSMUSP00000124605
Gene: ENSMUSG00000033060
AA Change: R252*

DomainStartEndE-ValueType
low complexity region 215 229 N/A INTRINSIC
coiled coil region 435 471 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000159258
AA Change: R252*
SMART Domains Protein: ENSMUSP00000125465
Gene: ENSMUSG00000033060
AA Change: R252*

DomainStartEndE-ValueType
low complexity region 215 229 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000159314
AA Change: R252*
SMART Domains Protein: ENSMUSP00000124349
Gene: ENSMUSG00000033060
AA Change: R252*

DomainStartEndE-ValueType
low complexity region 215 229 N/A INTRINSIC
coiled coil region 435 492 N/A INTRINSIC
low complexity region 628 646 N/A INTRINSIC
low complexity region 746 758 N/A INTRINSIC
low complexity region 770 782 N/A INTRINSIC
PDZ 814 886 1.05e-8 SMART
coiled coil region 989 1042 N/A INTRINSIC
coiled coil region 1086 1178 N/A INTRINSIC
low complexity region 1352 1363 N/A INTRINSIC
low complexity region 1366 1384 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000159597
AA Change: R363*
SMART Domains Protein: ENSMUSP00000123706
Gene: ENSMUSG00000033060
AA Change: R363*

DomainStartEndE-ValueType
low complexity region 78 89 N/A INTRINSIC
internal_repeat_1 111 141 6.96e-5 PROSPERO
internal_repeat_1 218 248 6.96e-5 PROSPERO
low complexity region 326 340 N/A INTRINSIC
coiled coil region 546 603 N/A INTRINSIC
low complexity region 739 757 N/A INTRINSIC
low complexity region 857 869 N/A INTRINSIC
low complexity region 881 893 N/A INTRINSIC
PDZ 925 997 1.05e-8 SMART
coiled coil region 1127 1180 N/A INTRINSIC
coiled coil region 1224 1316 N/A INTRINSIC
low complexity region 1490 1501 N/A INTRINSIC
low complexity region 1504 1522 N/A INTRINSIC
LIM 1534 1592 6.54e-10 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000159797
Predicted Effect probably benign
Transcript: ENSMUST00000159806
SMART Domains Protein: ENSMUSP00000124300
Gene: ENSMUSG00000033060

DomainStartEndE-ValueType
low complexity region 34 45 N/A INTRINSIC
Pfam:DUF4757 76 225 4.5e-53 PFAM
low complexity region 351 369 N/A INTRINSIC
low complexity region 469 481 N/A INTRINSIC
low complexity region 493 505 N/A INTRINSIC
PDZ 537 609 1.05e-8 SMART
internal_repeat_1 620 691 9.31e-5 PROSPERO
coiled coil region 711 764 N/A INTRINSIC
coiled coil region 808 900 N/A INTRINSIC
internal_repeat_1 921 976 9.31e-5 PROSPERO
low complexity region 1075 1086 N/A INTRINSIC
low complexity region 1089 1107 N/A INTRINSIC
LIM 1119 1177 6.54e-10 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000159812
Predicted Effect noncoding transcript
Transcript: ENSMUST00000159948
Predicted Effect noncoding transcript
Transcript: ENSMUST00000160876
Predicted Effect noncoding transcript
Transcript: ENSMUST00000161668
Predicted Effect noncoding transcript
Transcript: ENSMUST00000162091
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.1%
  • 10x: 96.0%
  • 20x: 91.8%
Validation Efficiency 100% (86/86)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein containing a calponin homology (CH) domain, a PDZ domain, and a LIM domain, and may be involved in protein-protein interactions. Several alternatively spliced transcript variants encoding different isoforms have been found for this gene, however, the full-length nature of some variants is not known. [provided by RefSeq, Jan 2009]
PHENOTYPE: Targeted mutations in this gene result in postnatal lethality, growth defects, skeletal muscle abnormalities and retinal defects reflective of retinal degeneration. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 81 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930568D16Rik T A 2: 35,354,803 Y179F probably benign Het
Abcd4 A G 12: 84,612,899 probably benign Het
Abhd12b C T 12: 70,181,017 T191M probably benign Het
Adcy5 A G 16: 35,156,178 E27G possibly damaging Het
Adgb G A 10: 10,407,158 probably benign Het
Afdn T C 17: 13,884,637 S1186P probably damaging Het
Atf6b G T 17: 34,651,626 R351L probably damaging Het
Axin2 T C 11: 108,939,397 S348P possibly damaging Het
BC030499 T C 11: 78,291,681 probably benign Het
Bfsp1 A C 2: 143,827,643 probably null Het
Brd1 A G 15: 88,730,383 V103A probably benign Het
Ccdc13 C A 9: 121,813,481 K392N probably damaging Het
Ccdc18 A G 5: 108,173,761 K577R probably damaging Het
Csmd2 G T 4: 128,496,029 G2186C probably damaging Het
Cyp2j5 A T 4: 96,629,523 M484K probably benign Het
Defb3 T A 8: 19,293,407 L12Q probably null Het
Defb7 G T 8: 19,495,170 probably null Het
Dhx35 T A 2: 158,840,620 M491K probably damaging Het
Dnah17 T C 11: 118,074,434 S2261G possibly damaging Het
Dnah5 A C 15: 28,263,679 E853D probably benign Het
Dner C A 1: 84,583,053 A23S probably benign Het
Dock5 A C 14: 67,819,641 S539A probably benign Het
Dsg2 T A 18: 20,583,042 F317I probably benign Het
Enox1 A T 14: 77,699,198 I539F possibly damaging Het
Eogt G A 6: 97,135,284 probably benign Het
Fbxo22 A G 9: 55,223,346 T300A probably benign Het
Fes T C 7: 80,384,005 D166G probably damaging Het
Fn1 A G 1: 71,609,653 S1366P probably damaging Het
Fndc3a A T 14: 72,540,495 probably benign Het
Foxh1 T C 15: 76,669,010 H168R probably benign Het
Galnt14 T G 17: 73,574,984 probably benign Het
Gdf6 A G 4: 9,844,482 D2G probably damaging Het
Gp6 C A 7: 4,370,184 A247S probably benign Het
Gp6 G C 7: 4,371,627 P232A probably benign Het
Grin2c A G 11: 115,251,134 Y820H probably damaging Het
Gtf2h4 T C 17: 35,670,448 T198A possibly damaging Het
Helz T C 11: 107,672,948 probably benign Het
Htr1d A G 4: 136,443,000 E180G probably benign Het
Igsf10 A G 3: 59,326,008 V1768A probably benign Het
Ints10 A T 8: 68,827,302 T694S probably damaging Het
Krt81 C A 15: 101,463,627 R24L possibly damaging Het
Lipc T A 9: 70,820,427 Y131F probably damaging Het
Litaf G T 16: 10,966,511 T45K probably damaging Het
Lrrc37a A T 11: 103,500,913 Y1229N probably benign Het
Man2a2 C T 7: 80,358,276 A943T probably damaging Het
Mtor A G 4: 148,480,923 Y1030C probably damaging Het
Naalad2 G T 9: 18,351,447 Y384* probably null Het
Nat2 C T 8: 67,501,726 Q163* probably null Het
Nell2 A G 15: 95,431,681 probably benign Het
Nphp3 C T 9: 104,037,348 H102Y possibly damaging Het
Olfr1383 A T 11: 49,524,134 H137L possibly damaging Het
Olfr1442 C T 19: 12,674,757 T184I probably benign Het
Olfr686 A T 7: 105,203,659 M228K probably benign Het
Olr1 T C 6: 129,488,906 S46G possibly damaging Het
Parg C A 14: 32,202,433 A63E probably damaging Het
Pik3cg A G 12: 32,195,715 probably benign Het
Ripk4 A G 16: 97,743,561 C629R probably benign Het
Rnf145 A G 11: 44,564,151 T620A probably benign Het
Samd9l T G 6: 3,376,031 D410A possibly damaging Het
Serpinb9f A T 13: 33,327,951 probably benign Het
Slc19a1 T C 10: 77,042,165 I178T probably benign Het
Slco1b2 A T 6: 141,671,111 Y390F probably benign Het
Speg A G 1: 75,385,032 E230G possibly damaging Het
Tbc1d9 C A 8: 83,264,837 probably benign Het
Tmem131l G A 3: 83,940,587 Q324* probably null Het
Trf A G 9: 103,226,956 probably benign Het
Trp53 T G 11: 69,588,679 Y202D probably damaging Het
Trpv1 T A 11: 73,253,272 M618K probably damaging Het
Trrap C A 5: 144,822,761 Y2250* probably null Het
Ttc3 A G 16: 94,385,322 probably benign Het
Ubtfl1 T G 9: 18,409,787 S204A probably benign Het
Uck2 A T 1: 167,227,771 Y203N probably damaging Het
Utrn A T 10: 12,686,465 L1280* probably null Het
Vmn1r178 A T 7: 23,894,184 H146L possibly damaging Het
Vmn2r100 C A 17: 19,522,120 P252Q possibly damaging Het
Vmn2r108 T C 17: 20,471,635 M209V probably benign Het
Vmn2r9 G A 5: 108,843,125 T790I probably damaging Het
Vmn2r94 C A 17: 18,243,604 R808L probably benign Het
Zbtb7c A T 18: 76,136,891 S17C probably damaging Het
Zfp811 C T 17: 32,797,764 R434Q probably damaging Het
Zkscan6 A T 11: 65,814,863 probably benign Het
Other mutations in Lmo7
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00569:Lmo7 APN 14 101887051 missense probably damaging 0.99
IGL00733:Lmo7 APN 14 101915702 missense probably damaging 1.00
IGL00778:Lmo7 APN 14 101910885 splice site probably benign
IGL01014:Lmo7 APN 14 101920557 splice site probably benign
IGL01401:Lmo7 APN 14 101794277 nonsense probably null
IGL01550:Lmo7 APN 14 101926140 utr 3 prime probably benign
IGL01570:Lmo7 APN 14 101902371 critical splice donor site probably null
IGL01602:Lmo7 APN 14 101910756 splice site probably benign
IGL01605:Lmo7 APN 14 101910756 splice site probably benign
IGL02012:Lmo7 APN 14 101888716 intron probably benign
IGL02145:Lmo7 APN 14 101902223 missense probably benign 0.00
IGL02236:Lmo7 APN 14 101926088 splice site probably benign
IGL02318:Lmo7 APN 14 101900066 splice site probably benign
IGL02345:Lmo7 APN 14 101887473 missense probably damaging 1.00
IGL02498:Lmo7 APN 14 101807482 missense probably benign 0.01
IGL02583:Lmo7 APN 14 101933924 utr 3 prime probably benign
IGL02670:Lmo7 APN 14 101880980 missense probably damaging 1.00
IGL02694:Lmo7 APN 14 101887170 missense probably damaging 1.00
IGL03026:Lmo7 APN 14 101929333 utr 3 prime probably benign
IGL03062:Lmo7 APN 14 101912079 missense possibly damaging 0.66
IGL03068:Lmo7 APN 14 101875492 unclassified probably benign
IGL03178:Lmo7 APN 14 101929260 nonsense probably null
IGL03279:Lmo7 APN 14 101900508 missense probably benign 0.30
PIT4458001:Lmo7 UTSW 14 101887487 nonsense probably null
R0029:Lmo7 UTSW 14 101933921 utr 3 prime probably benign
R0345:Lmo7 UTSW 14 101876877 missense probably damaging 1.00
R0372:Lmo7 UTSW 14 101918053 splice site probably benign
R0393:Lmo7 UTSW 14 101900456 missense probably benign
R0514:Lmo7 UTSW 14 101887173 missense probably damaging 1.00
R0514:Lmo7 UTSW 14 101896559 missense probably damaging 1.00
R0526:Lmo7 UTSW 14 101900560 missense probably damaging 1.00
R0615:Lmo7 UTSW 14 101876859 nonsense probably null
R0900:Lmo7 UTSW 14 101887188 missense probably damaging 1.00
R0961:Lmo7 UTSW 14 101794269 missense probably benign 0.00
R0964:Lmo7 UTSW 14 101920567 splice site probably benign
R1078:Lmo7 UTSW 14 101920474 splice site probably benign
R1252:Lmo7 UTSW 14 101900583 missense probably damaging 1.00
R1527:Lmo7 UTSW 14 101876828 missense probably damaging 1.00
R1537:Lmo7 UTSW 14 101929264 utr 3 prime probably benign
R1565:Lmo7 UTSW 14 101887521 missense probably damaging 0.99
R1637:Lmo7 UTSW 14 101880832 missense probably damaging 1.00
R1943:Lmo7 UTSW 14 101902302 missense probably damaging 1.00
R1967:Lmo7 UTSW 14 101900215 missense probably benign 0.36
R2002:Lmo7 UTSW 14 101887061 missense probably benign 0.13
R2057:Lmo7 UTSW 14 101887178 missense probably damaging 1.00
R2131:Lmo7 UTSW 14 101900238 missense probably damaging 0.99
R2153:Lmo7 UTSW 14 101920515 utr 3 prime probably benign
R2257:Lmo7 UTSW 14 101900130 missense probably damaging 1.00
R2355:Lmo7 UTSW 14 101888685 missense probably damaging 1.00
R2356:Lmo7 UTSW 14 101886945 missense probably damaging 1.00
R2898:Lmo7 UTSW 14 101876914 missense possibly damaging 0.93
R3847:Lmo7 UTSW 14 101922095 critical splice acceptor site probably null
R3848:Lmo7 UTSW 14 101922095 critical splice acceptor site probably null
R3849:Lmo7 UTSW 14 101922095 critical splice acceptor site probably null
R3916:Lmo7 UTSW 14 101929342 utr 3 prime probably benign
R4050:Lmo7 UTSW 14 101902277 nonsense probably null
R4326:Lmo7 UTSW 14 101900074 missense possibly damaging 0.93
R4357:Lmo7 UTSW 14 101887655 missense probably null 1.00
R4571:Lmo7 UTSW 14 101887594 missense probably damaging 0.96
R4658:Lmo7 UTSW 14 101886957 missense probably damaging 1.00
R4857:Lmo7 UTSW 14 101887348 intron probably null
R5006:Lmo7 UTSW 14 101926237 utr 3 prime probably benign
R5528:Lmo7 UTSW 14 101902086 missense probably damaging 1.00
R5588:Lmo7 UTSW 14 101896590 splice site probably null
R5643:Lmo7 UTSW 14 101929336 utr 3 prime probably benign
R5644:Lmo7 UTSW 14 101929336 utr 3 prime probably benign
R5650:Lmo7 UTSW 14 101898674 missense probably damaging 1.00
R5737:Lmo7 UTSW 14 101887236 missense probably damaging 1.00
R5832:Lmo7 UTSW 14 101884213 missense probably damaging 1.00
R5966:Lmo7 UTSW 14 101900502 missense possibly damaging 0.92
R6026:Lmo7 UTSW 14 101880990 missense probably benign 0.04
R6072:Lmo7 UTSW 14 101929336 utr 3 prime probably benign
R6158:Lmo7 UTSW 14 101900137 missense probably benign 0.03
R6246:Lmo7 UTSW 14 101918700 missense probably damaging 1.00
R6335:Lmo7 UTSW 14 101900636 missense probably damaging 1.00
R6620:Lmo7 UTSW 14 101875452 missense probably benign 0.29
R6658:Lmo7 UTSW 14 101910845 missense possibly damaging 0.84
R6917:Lmo7 UTSW 14 101918010 missense probably damaging 1.00
R7064:Lmo7 UTSW 14 101884179 missense probably damaging 1.00
R7072:Lmo7 UTSW 14 101898700 critical splice donor site probably null
R7121:Lmo7 UTSW 14 101887035 missense probably damaging 1.00
R7136:Lmo7 UTSW 14 101920539 missense unknown
R7196:Lmo7 UTSW 14 101896500 missense possibly damaging 0.75
R7228:Lmo7 UTSW 14 101896535 missense probably damaging 0.99
R7337:Lmo7 UTSW 14 101884204 missense probably damaging 0.98
R7341:Lmo7 UTSW 14 101885512 missense probably benign 0.30
R7408:Lmo7 UTSW 14 101880953 missense probably damaging 1.00
R7432:Lmo7 UTSW 14 101902115 missense probably benign 0.42
R7470:Lmo7 UTSW 14 101900604 missense possibly damaging 0.83
R7506:Lmo7 UTSW 14 101919609 missense unknown
R7559:Lmo7 UTSW 14 101887226 nonsense probably null
R7565:Lmo7 UTSW 14 101885301 missense probably damaging 0.98
R7788:Lmo7 UTSW 14 101898576 missense possibly damaging 0.64
X0066:Lmo7 UTSW 14 101887461 missense probably damaging 1.00
X0067:Lmo7 UTSW 14 101886933 splice site probably null
Predicted Primers PCR Primer
(F):5'- GCTCATAACTCGCAGGAAGAATCGC -3'
(R):5'- TGTCCTTTCGAGCACAGAGAGAAAC -3'

Sequencing Primer
(F):5'- AGGAAGAATCGCTCTCCCG -3'
(R):5'- CACAGAGAGAAACTTCGCTTG -3'
Posted On2013-04-11