Incidental Mutation 'R1837:Nefl'
ID 205431
Institutional Source Beutler Lab
Gene Symbol Nefl
Ensembl Gene ENSMUSG00000022055
Gene Name neurofilament, light polypeptide
Synonyms Nfl, CMT2E, NF68, NF-L
MMRRC Submission 039864-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R1837 (G1)
Quality Score 225
Status Validated
Chromosome 14
Chromosomal Location 68083863-68089095 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) C to T at 68086626 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Arginine to Cysteine at position 438 (R438C)
Ref Sequence ENSEMBL: ENSMUSP00000022639 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022639] [ENSMUST00000111089]
AlphaFold P08551
Predicted Effect probably damaging
Transcript: ENSMUST00000022639
AA Change: R438C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000022639
Gene: ENSMUSG00000022055
AA Change: R438C

DomainStartEndE-ValueType
Pfam:Filament_head 9 88 7e-14 PFAM
Filament 89 400 6.93e-139 SMART
low complexity region 448 470 N/A INTRINSIC
coiled coil region 473 512 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000111089
SMART Domains Protein: ENSMUSP00000106718
Gene: ENSMUSG00000022054

DomainStartEndE-ValueType
Pfam:Filament_head 9 97 1.6e-16 PFAM
Pfam:Filament 98 403 1.1e-104 PFAM
Meta Mutation Damage Score 0.0929 question?
Coding Region Coverage
  • 1x: 97.4%
  • 3x: 96.8%
  • 10x: 94.9%
  • 20x: 91.6%
Validation Efficiency 99% (86/87)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Neurofilaments are type IV intermediate filament heteropolymers composed of light, medium, and heavy chains. Neurofilaments comprise the axoskeleton and they functionally maintain the neuronal caliber. They may also play a role in intracellular transport to axons and dendrites. This gene encodes the light chain neurofilament protein. Mutations in this gene cause Charcot-Marie-Tooth disease types 1F (CMT1F) and 2E (CMT2E), disorders of the peripheral nervous system that are characterized by distinct neuropathies. A pseudogene has been identified on chromosome Y. [provided by RefSeq, Oct 2008]
PHENOTYPE: Mice homozygous for disruptions of this gene lack neurofilaments in their axons and have motor axons that are reduced in both size and number. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 85 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Actl10 G T 2: 154,553,042 G305W probably damaging Het
Actr3b A T 5: 25,825,159 T74S probably benign Het
Add2 A G 6: 86,118,558 E652G probably damaging Het
Alg9 T A 9: 50,806,315 V83D probably damaging Het
Atp13a2 T A 4: 140,994,332 Y244* probably null Het
BB014433 C G 8: 15,042,629 V75L unknown Het
Bcr A G 10: 75,168,100 probably benign Het
Begain G A 12: 109,035,323 probably benign Het
Bzw1 A G 1: 58,400,118 K67E probably damaging Het
Ccdc141 T C 2: 77,011,665 E1474G probably benign Het
Cdc73 T A 1: 143,667,657 T314S possibly damaging Het
Cfap206 T C 4: 34,728,813 T31A probably damaging Het
Cfap58 G A 19: 48,029,139 E813K probably damaging Het
Clstn2 C A 9: 97,583,540 A133S probably benign Het
Col14a1 A T 15: 55,382,495 D465V unknown Het
Col2a1 C T 15: 97,996,641 probably benign Het
Dab2 A G 15: 6,336,476 probably benign Het
Eme1 T C 11: 94,645,961 D464G probably benign Het
Eml6 T C 11: 29,749,802 probably null Het
Ern1 C A 11: 106,458,957 L44F probably damaging Het
Fam111a T A 19: 12,587,452 S188R probably benign Het
Fam151b A T 13: 92,474,131 probably benign Het
Fmo6 T C 1: 162,922,810 N226D probably benign Het
Ggt1 A G 10: 75,579,294 D214G probably benign Het
Gm14226 A G 2: 155,025,010 I296V probably benign Het
Gm9915 A T 1: 42,230,687 noncoding transcript Het
Heatr5b T C 17: 78,820,751 D485G possibly damaging Het
Helz2 A T 2: 181,229,289 I2785N probably damaging Het
Htt C T 5: 34,819,023 T723M probably benign Het
Hydin C A 8: 110,569,625 H3595Q probably benign Het
Il6ra T C 3: 89,890,272 D96G probably benign Het
Kif5a G A 10: 127,236,815 Q702* probably null Het
Klhdc7a G T 4: 139,967,070 P189T probably benign Het
Krt7 A G 15: 101,419,582 D252G probably benign Het
Lad1 C A 1: 135,829,706 D394E probably benign Het
Lhx8 A T 3: 154,328,055 C38S possibly damaging Het
Lta4h C T 10: 93,469,175 T280M probably damaging Het
Magi2 A T 5: 20,465,827 T163S probably damaging Het
Med1 G T 11: 98,169,412 D230E probably damaging Het
Mmp1b A T 9: 7,386,409 F171I probably damaging Het
Mprip T C 11: 59,766,745 V801A probably damaging Het
Mtrf1 A G 14: 79,401,833 E135G possibly damaging Het
Muc5ac T A 7: 141,807,086 M1378K probably benign Het
Myo3a A T 2: 22,577,592 Q286L possibly damaging Het
Ndor1 C T 2: 25,248,396 G391R probably damaging Het
Nlrp3 G A 11: 59,548,916 V440I probably benign Het
Notch3 A T 17: 32,124,322 L1959Q probably damaging Het
Noto A G 6: 85,424,177 T63A probably benign Het
Oc90 G A 15: 65,889,680 T163M probably damaging Het
Olfr1219 A T 2: 89,074,832 Y86* probably null Het
Olfr1436 A G 19: 12,298,376 V252A probably damaging Het
Olfr365 T A 2: 37,202,102 M287K probably benign Het
Pdpr C A 8: 111,134,734 P787T probably damaging Het
Phlda1 A G 10: 111,507,231 Q276R probably benign Het
Ptpn21 T G 12: 98,733,626 K10Q probably damaging Het
Ptprb A G 10: 116,341,626 E1364G probably benign Het
Rabep1 T A 11: 70,904,658 W237R probably damaging Het
Rai1 A T 11: 60,189,398 K1429N probably damaging Het
Rapgef1 A G 2: 29,737,426 I1027M probably damaging Het
Rit1 C G 3: 88,729,170 T127S probably damaging Het
Rpap1 A C 2: 119,769,885 probably null Het
Senp7 T A 16: 56,158,516 C471S probably benign Het
Slc16a14 A G 1: 84,912,399 V395A probably benign Het
Slc45a1 C T 4: 150,638,459 G323S probably benign Het
Syne2 A T 12: 75,967,660 E3208D probably damaging Het
Tap1 C T 17: 34,188,109 A77V possibly damaging Het
Ticam1 T C 17: 56,270,799 E432G possibly damaging Het
Tmem192 C A 8: 64,964,340 probably benign Het
Trub1 T C 19: 57,453,029 V28A probably benign Het
Ttc21b A T 2: 66,197,762 L1121H probably benign Het
Ttc38 A G 15: 85,851,563 D290G probably damaging Het
Ulk1 C T 5: 110,789,381 G683D probably damaging Het
Vmn1r122 A T 7: 21,133,366 F255I probably benign Het
Vmn2r68 T A 7: 85,233,678 I289F probably damaging Het
Vps39 A T 2: 120,325,397 L514H probably damaging Het
Wdr48 T G 9: 119,905,416 S134A probably damaging Het
Yap1 A T 9: 7,962,349 Y139N probably damaging Het
Ylpm1 T C 12: 85,029,333 V486A possibly damaging Het
Zbtb38 T C 9: 96,686,995 T679A probably benign Het
Zfp292 A G 4: 34,810,264 S927P probably damaging Het
Zfp324 C T 7: 12,970,229 T115I probably benign Het
Zfp523 T A 17: 28,194,993 I34N probably damaging Het
Zfp945 A T 17: 22,851,273 C551S probably damaging Het
Zfp958 A G 8: 4,628,590 H205R probably damaging Het
Zfp974 G A 7: 27,910,356 P648L possibly damaging Het
Other mutations in Nefl
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01339:Nefl APN 14 68086482 intron probably benign
IGL01755:Nefl APN 14 68086077 missense probably damaging 1.00
IGL02825:Nefl APN 14 68084346 missense possibly damaging 0.96
IGL03297:Nefl APN 14 68084224 missense possibly damaging 0.55
PIT4418001:Nefl UTSW 14 68086530 missense probably damaging 0.99
R0503:Nefl UTSW 14 68083983 missense probably benign 0.08
R1970:Nefl UTSW 14 68086672 missense probably benign 0.20
R4812:Nefl UTSW 14 68084285 missense probably damaging 1.00
R4972:Nefl UTSW 14 68086763 intron probably benign
R5361:Nefl UTSW 14 68084639 missense probably damaging 0.99
R6357:Nefl UTSW 14 68084318 missense probably damaging 1.00
R6499:Nefl UTSW 14 68084585 missense probably damaging 1.00
R7571:Nefl UTSW 14 68084674 missense probably benign 0.00
R8086:Nefl UTSW 14 68086031 missense probably damaging 0.98
R9325:Nefl UTSW 14 68085011 critical splice donor site probably null
R9582:Nefl UTSW 14 68087400 missense unknown
Predicted Primers PCR Primer
(F):5'- ATCCAGCCTTGCTCTAACTG -3'
(R):5'- TCCACAGCCAATTTGCAATAGAG -3'

Sequencing Primer
(F):5'- AGCCTTGCTCTAACTGTACTC -3'
(R):5'- CAGCCAATTTGCAATAGAGATTCTG -3'
Posted On 2014-06-23